ID: 1175944757

View in Genome Browser
Species Human (GRCh38)
Location 20:62553523-62553545
Sequence GAGGAGTCCAGGTTCCCAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175944757_1175944763 15 Left 1175944757 20:62553523-62553545 CCCTCTGGGAACCTGGACTCCTC 0: 1
1: 0
2: 2
3: 28
4: 236
Right 1175944763 20:62553561-62553583 TCGCCTGCATCTTCGGAGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
1175944757_1175944762 8 Left 1175944757 20:62553523-62553545 CCCTCTGGGAACCTGGACTCCTC 0: 1
1: 0
2: 2
3: 28
4: 236
Right 1175944762 20:62553554-62553576 GTCTTTCTCGCCTGCATCTTCGG 0: 1
1: 0
2: 0
3: 18
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175944757 Original CRISPR GAGGAGTCCAGGTTCCCAGA GGG (reversed) Exonic
900406775 1:2496241-2496263 GAGGAGGCCAGGGTCCAAGGGGG - Intronic
901672345 1:10863175-10863197 GAGGCGCCCAGGTGCCCAGCCGG - Intergenic
901744977 1:11366382-11366404 GAGGGGTCCAGGGAGCCAGATGG - Intergenic
902231229 1:15028961-15028983 GAAGAGGCCAGGGTCCCCGATGG - Intronic
902682108 1:18050812-18050834 GAGGAGCCCAGGGACCCAGCTGG - Intergenic
903005209 1:20293756-20293778 AAGGAATCCAGGAACCCAGAGGG - Intronic
903489904 1:23720458-23720480 TAGGAGGCCAGGTTCTCAGCAGG - Intergenic
903655507 1:24946792-24946814 GAGAAGTCCAGGCTGCCAGTGGG - Intronic
904999376 1:34656435-34656457 GAAGAGCCCTGGATCCCAGAAGG + Intergenic
905775390 1:40664734-40664756 ATGGAGTCCAGGTACCCAGGCGG + Intronic
905897329 1:41557420-41557442 GATGAGGGCAGTTTCCCAGAGGG + Intronic
907277311 1:53323984-53324006 AATGAGTCCAAGTTCCCAAAGGG - Intronic
909492612 1:76242301-76242323 GAGGAGTGCTGGTTCCTAGCTGG + Intronic
914907200 1:151756358-151756380 TAGAAGTCCTGGTTCCCAGAAGG + Intergenic
918447648 1:184630976-184630998 GAGGAGGCTTGGTTCCCAGTGGG - Intergenic
920030912 1:203036865-203036887 GTGGAGGGCAGGGTCCCAGAAGG - Intronic
920390952 1:205600696-205600718 GAGCTGTCCAGATACCCAGATGG + Exonic
920534126 1:206726474-206726496 CAGGAGGCAAGGTTCCCAGGAGG - Intronic
920895284 1:210042133-210042155 CAGGAGGACAGGTCCCCAGATGG - Intronic
921381219 1:214526503-214526525 AAGGACTCAAGGTCCCCAGATGG + Intronic
921474448 1:215589568-215589590 GAAGATTCCAGATTCCCAGAAGG + Intronic
921477939 1:215632765-215632787 AAGGAGCCCATGTTCCTAGAAGG - Intronic
921919414 1:220649639-220649661 CAGTAGTGCAGGTTCCTAGATGG - Intronic
922861877 1:228825982-228826004 GAGAAGTTCAGGTTCCCATTTGG + Intergenic
924324189 1:242878814-242878836 GAGCAGTTCAGGTTCGCAGCAGG + Intergenic
924627226 1:245705636-245705658 GAGGAGGACAGGTTCACACAAGG - Intronic
924708569 1:246517096-246517118 CAGGAGCCCAGGTCTCCAGATGG - Intergenic
1064915072 10:20447837-20447859 GAGGAGTCCATGCAACCAGAGGG - Intergenic
1070568138 10:77619572-77619594 GAGGAGTCGTGGTTCACTGAGGG + Intronic
1070695963 10:78563290-78563312 GACGAGGCCAAGTTCCCTGAAGG - Intergenic
1072070102 10:91908074-91908096 GAGAAGTCCAGGTTCTCGAATGG - Exonic
1073946424 10:108755934-108755956 GAGGAGAGCAGATTCCCACAAGG + Intergenic
1074264650 10:111889506-111889528 GAGAAGTCCAGTTACCCAGCAGG + Intergenic
1075512488 10:123083789-123083811 GAGGAGTCCAGGTGGCCAGAAGG + Intergenic
1075520832 10:123142729-123142751 GGGGAGTCCAGGTGCCCCGCGGG - Intergenic
1076215710 10:128692102-128692124 GAGGAGGAAAGGTTACCAGAGGG + Intergenic
1076603925 10:131677245-131677267 GAGGGGCCCAGGTTCCCAGCAGG + Intergenic
1078537345 11:12185614-12185636 GAGGAGACCAGGTACCTAAAGGG + Intronic
1078549320 11:12269524-12269546 GAGGAGTCCTGGTGTCCAGAGGG + Intergenic
1079389161 11:20006192-20006214 AGGGTGTCCAGGTTCCCATAGGG + Intronic
1081811642 11:45917576-45917598 GACCCGTCCAGGTTCCCAAAGGG - Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083943584 11:65911745-65911767 GGCCAGACCAGGTTCCCAGAGGG + Intergenic
1084189534 11:67492802-67492824 GAGGATCCCAGGTTCCCTGGAGG + Intronic
1085384317 11:76148404-76148426 GAGAAGTCCAGGTGGCCAGCAGG - Intergenic
1085476904 11:76794728-76794750 TGGGTGTCCAGATTCCCAGATGG - Intronic
1085561159 11:77473845-77473867 GCGGAGACCAGGTTCCTCGAGGG + Exonic
1085690566 11:78660605-78660627 GAGGAAAGCAGGTTGCCAGATGG - Intronic
1088819720 11:113447066-113447088 GAGGATCCCAAGTTCCCTGAGGG - Intronic
1088878033 11:113952002-113952024 GTGGAGCCCAGGGTCACAGAGGG - Intergenic
1091283564 11:134395850-134395872 CAGGAGTCCAGGGTCTCAGAAGG + Intronic
1091560492 12:1609176-1609198 CAGGAGCCCAGGATCCCAGGAGG - Intronic
1091714498 12:2767389-2767411 GAGGAGTCCAGATCCACAGAGGG - Intergenic
1091887461 12:4027097-4027119 CAGGAGTGGAGGTTCCCAGAGGG + Intergenic
1092231191 12:6776341-6776363 GAGGAGGCCAGGTTTCGAGGTGG - Intronic
1094096983 12:26717356-26717378 GAGGAGTCCATGCTCACATATGG + Intronic
1098991142 12:77065760-77065782 GAGGTTTCCAGGTACCCGGAAGG - Intergenic
1099234059 12:80061161-80061183 GAGGAGTCTGTGATCCCAGAAGG + Intergenic
1099965460 12:89440643-89440665 GAGGAGAGTAGGTTCCAAGATGG + Intronic
1101427918 12:104602960-104602982 CAGGAGTCCATTTTTCCAGAAGG - Intronic
1102617263 12:114165496-114165518 GAGGAGTTCAGTATCCCTGAAGG + Intergenic
1107084307 13:36409264-36409286 GAAGAGTGCATGTTCCCATAAGG + Intergenic
1108958481 13:56189787-56189809 GAGGAGTCCAGCTGTCCAGATGG + Intergenic
1109671637 13:65615680-65615702 CAGGAGTCAAGGTTCACTGAAGG - Intergenic
1112326351 13:98444905-98444927 CAAGGCTCCAGGTTCCCAGAAGG - Intronic
1114848961 14:26359712-26359734 AAGGACTCCAGGTTCCCTCAAGG + Intergenic
1118865363 14:69698970-69698992 GACAATTCCAGGTTCGCAGAAGG - Intronic
1119137932 14:72237953-72237975 CAGGAAGCCAGGTACCCAGAGGG - Intronic
1119400605 14:74359813-74359835 GAGGACTGCAGGGTCCCAGCAGG - Exonic
1121598929 14:95188092-95188114 GATGAGTCCAGGTGCCCACCTGG + Exonic
1122071473 14:99208135-99208157 GAGGAGTCTACTTTCCCACAGGG + Intronic
1123439672 15:20281360-20281382 GAGAGGCCCAGGTGCCCAGAGGG - Intergenic
1125328864 15:38564042-38564064 GAGGAGTGCAGCTTCCCATACGG + Intronic
1125425539 15:39544710-39544732 GGAGAGACCAGGTACCCAGAAGG + Intergenic
1128384422 15:67137083-67137105 GAGGAGTCCTGGTTCCTTCAAGG + Intronic
1130987666 15:88855268-88855290 CTGGAGTCCAGGTCTCCAGAGGG - Exonic
1132557178 16:577847-577869 CAGGAGGACAGGTCCCCAGAGGG - Intronic
1133211223 16:4264328-4264350 GATGCGTCCAGGGTCCCACAGGG - Intronic
1133484696 16:6208516-6208538 TAAGAGTCCCTGTTCCCAGATGG - Intronic
1133773670 16:8882374-8882396 GAGGAGGCCCGGTTGCCAGGAGG - Intergenic
1135479735 16:22813302-22813324 GAGCTGTCCAGGGTACCAGAGGG - Intergenic
1135956938 16:26963676-26963698 CAGGAGACCATGGTCCCAGATGG + Intergenic
1136845495 16:33573038-33573060 GAGAGGCCCAGGTGCCCAGAGGG + Intergenic
1138096922 16:54219132-54219154 GAGGAGTTCGGGATCCAAGAAGG - Intergenic
1138685367 16:58720666-58720688 GAGGAATCCTGGAACCCAGAAGG - Intronic
1138947752 16:61872743-61872765 GAGGAGGGCAGGTACTCAGATGG + Intronic
1141163997 16:81648060-81648082 GTGGAGGCCAGGTAACCAGAAGG - Intronic
1142138696 16:88463049-88463071 GATGGGTGCAGGTGCCCAGAAGG - Intronic
1203107203 16_KI270728v1_random:1421691-1421713 GAGAGGCCCAGGTGCCCAGAGGG + Intergenic
1144437648 17:15255855-15255877 GAGCAGGCCAGGTGCCCAAAGGG - Intronic
1144754818 17:17672984-17673006 GCTGAATCCAGGTGCCCAGAAGG + Intergenic
1145084438 17:19924803-19924825 GAGGAGTCCTGGAGCCCAGGAGG - Intronic
1147122340 17:38343206-38343228 GGGGTGTCCAGGTCCCCAGGAGG + Exonic
1147460378 17:40564497-40564519 AAGAAGACCAGGTTCCTAGATGG - Intronic
1147864371 17:43543118-43543140 GAGCAGCTCAGGTTCCCAGCTGG - Intronic
1148443170 17:47722176-47722198 CAGGAGTCCTGGTTTCCAGGTGG - Intergenic
1148550909 17:48550470-48550492 TTGTAGTCCAGGTTCCCGGAAGG + Exonic
1148745866 17:49917789-49917811 GAAGAGTGGAGCTTCCCAGATGG - Intergenic
1149641540 17:58206080-58206102 TAGGAGACCAGGGTTCCAGAGGG + Exonic
1149987011 17:61354909-61354931 GAGGAGTCCACCTGCCCTGAAGG - Intronic
1150215799 17:63468454-63468476 TAGGGGTCCAGGATCCCAGCTGG + Intergenic
1152499423 17:80698048-80698070 GAGTAGACAAGGATCCCAGACGG + Intronic
1152586106 17:81190193-81190215 GGGGAGGCCTGGTACCCAGATGG + Intronic
1155842042 18:30658480-30658502 GAGATGTACAAGTTCCCAGAGGG + Intergenic
1156136985 18:34053392-34053414 GAGGAGTCCTGGATCTCAGCTGG + Intronic
1157440055 18:47703940-47703962 CAGGAGACCAGGATTCCAGATGG + Intergenic
1157500728 18:48188751-48188773 TAGGAGCCCAGGTTCCCGGTGGG - Intronic
1157810245 18:50690013-50690035 CAGGACTCCAGGTTCCCATCTGG + Intronic
1158290919 18:55941438-55941460 AAGGAGTCTAGGTGCCTAGATGG + Intergenic
1159800889 18:72898200-72898222 GGGGAAGCCATGTTCCCAGAGGG + Intergenic
1160500248 18:79398088-79398110 GAGGCGCCCAGGTCCTCAGATGG - Intronic
1160556117 18:79726667-79726689 TAGGAGTCCAGTTCCCCACACGG + Intronic
1160931154 19:1569960-1569982 GAGAAGTCCAGGACCCCAGGAGG - Intergenic
1161101662 19:2424679-2424701 GAGGGGTCCGGTTTTCCAGAGGG + Intronic
1161801806 19:6420436-6420458 GAAGAGTACAGGGTCCCAGACGG - Exonic
1163508919 19:17724053-17724075 GAGGGGTTCATGTTCCCTGAGGG + Intronic
1163720834 19:18897426-18897448 GAGGAAGCCAGGATACCAGACGG - Intergenic
1166304612 19:41930575-41930597 GAGGAGTCCTGCCTTCCAGAGGG - Intergenic
1167356027 19:49004658-49004680 GAGGACGCCATGTTCCAAGAGGG + Intronic
925251501 2:2442718-2442740 GAAGAGGCCATGTTCCCAGGTGG + Intergenic
925275474 2:2645181-2645203 GAGGAGGCCAGGTTTTCTGAAGG - Intergenic
925710018 2:6730012-6730034 TAGAAGTCCTGGTTCACAGAAGG + Intergenic
925903537 2:8525473-8525495 GAGATGTCCAGGTTCCAACAAGG - Intergenic
926612837 2:14963561-14963583 CAGAATTCCAGGTTCCCAGAAGG - Intergenic
928074765 2:28254122-28254144 GAGTAGCCCAGGTTCTAAGACGG + Intronic
929406360 2:41647137-41647159 ATGGAAACCAGGTTCCCAGATGG + Intergenic
929756197 2:44767780-44767802 GAGGAGTCCAGGGAGCCAGGAGG - Intronic
933805694 2:85996908-85996930 AAGGAGTACAGGATCCCAGGTGG - Intergenic
937065400 2:119013199-119013221 GCTGATTCCAGGTTCCCAGCTGG + Intergenic
937146496 2:119649855-119649877 CAGGAGGCCAGGTCCTCAGATGG - Intronic
937910143 2:127071611-127071633 GAGAACTCCAGGTTCCAGGAGGG + Intronic
939302474 2:140362570-140362592 GAAGGATCCATGTTCCCAGAGGG - Intronic
942031987 2:171971948-171971970 CAGGAGTACAGGGTCCCAAAGGG + Intronic
943916606 2:193643535-193643557 GATAAGTCCAGGTGCCCACAGGG - Intergenic
944583219 2:201150951-201150973 GAGGAGTCCTGGAACCCAGAGGG + Intronic
945146554 2:206744270-206744292 ATGGACTGCAGGTTCCCAGAGGG + Intronic
946194979 2:218027467-218027489 CAGGAGTTCACCTTCCCAGAGGG - Intergenic
946308891 2:218871996-218872018 GAGGTGTCCAGCCTCCAAGAAGG + Intronic
947957554 2:234206545-234206567 GAGGATTCTAAGTTCCAAGAGGG + Intergenic
948878169 2:240841222-240841244 CAGGAATCCAGCTTCCCAGCTGG + Intergenic
1169487399 20:6044639-6044661 GAGGAATCCAGGGTCCAAGGAGG + Exonic
1170922565 20:20692511-20692533 GAACAGGCCAGGTTCCGAGAGGG - Intronic
1171250364 20:23641604-23641626 GAGGAGTCCAGCTGCCCAGGAGG + Intergenic
1171256474 20:23692408-23692430 GAGGAGTCCAGCTGCCCAGGAGG + Intergenic
1171263828 20:23754338-23754360 GAGGAGTCCAGCTGCCCAGGAGG + Intergenic
1171273005 20:23831009-23831031 GAGGAGTCTAGCTGCCCAGGAGG + Intergenic
1171279347 20:23882921-23882943 GAGGAGTCCAGTTGCCCAGGAGG + Intergenic
1172213477 20:33217304-33217326 GAGGAGGCCAGGGCTCCAGAGGG - Intronic
1172444313 20:34985093-34985115 GCGGATGCCAGCTTCCCAGAGGG - Exonic
1172804059 20:37598535-37598557 CAGGAGTTCAGGCTCCAAGATGG - Intergenic
1172973237 20:38888566-38888588 GAGGAGTCCAGGGGGCCAGTGGG - Intronic
1173137230 20:40449153-40449175 GAGGGGTCCAGGAAGCCAGATGG + Intergenic
1174304940 20:49608441-49608463 GAGGAATCATGGTTACCAGATGG - Intergenic
1174429981 20:50460704-50460726 CAGGAGTCCAAGTCCCCAGAGGG + Intergenic
1175592036 20:60200798-60200820 GAGGTGTCCAGGTTCTCACTGGG - Intergenic
1175600681 20:60270278-60270300 CTAGAGTCCAGGATCCCAGAGGG - Intergenic
1175764555 20:61583336-61583358 GAGGTGGCCAGGTGGCCAGATGG + Intronic
1175944757 20:62553523-62553545 GAGGAGTCCAGGTTCCCAGAGGG - Exonic
1176105129 20:63382304-63382326 AAAGAGTCTAGGTCCCCAGATGG - Intergenic
1176130287 20:63493904-63493926 GGGGAGTGCAGGGTCCCTGATGG + Intronic
1177510781 21:22084720-22084742 GAGGAGTCGAGATTCACAGTGGG - Intergenic
1178737632 21:35167114-35167136 GAGAAGGCCAGGGTCACAGAAGG - Intronic
1180176931 21:46095403-46095425 GAGGTGGCCAGGTCACCAGAAGG - Intergenic
1180701753 22:17785073-17785095 GTGGAGTCCGTGTTCCCAGAGGG - Intergenic
1180743019 22:18066887-18066909 GTGGAGACCAGGTTCTCAGATGG + Intergenic
1182779518 22:32856490-32856512 GAGGAGTCTCAGTACCCAGAAGG - Intronic
1184152370 22:42646490-42646512 GTGGAGGCCAGGGTCCCAGTGGG - Intronic
1184696180 22:46140276-46140298 GAGAGGCCCAGGTGCCCAGAGGG - Intergenic
1184923781 22:47623741-47623763 GAGAAGCCCAGGCTCCCAGAGGG + Intergenic
1185290159 22:50020501-50020523 GAGGAGTGCATGTTGTCAGATGG - Intronic
1185290165 22:50020564-50020586 GAGGAGTGCACGTTGTCAGATGG - Intronic
1185290173 22:50020627-50020649 GAGGAGTGCACGTTGTCAGATGG - Intronic
1185290175 22:50020649-50020671 GAGGAGTGCATGTTGTCAGATGG - Intronic
1185290177 22:50020671-50020693 GAGGAGTGCACGTTGTCAGATGG - Intronic
1185290187 22:50020791-50020813 GAGGAGTGCATGTTGTCAGATGG - Intronic
950427392 3:12931801-12931823 GGGGAGGCCAGGTCCACAGAAGG + Intronic
952573055 3:34740994-34741016 GAGGATTCCTGGTTCCATGAGGG + Intergenic
953293970 3:41694522-41694544 GAGAAGTCTAGGTTCACATAAGG + Intronic
955001511 3:54931612-54931634 CAGGACCCCAGGTTCCCACATGG + Intronic
957063980 3:75506143-75506165 GAGGAGCCCAAGTTCCCTCAGGG - Intergenic
961915148 3:130366439-130366461 GTTGAGCCCATGTTCCCAGACGG + Intronic
963744219 3:149109731-149109753 GAGGAGTGCAGGTGCACAGCAGG + Intergenic
963934505 3:151038294-151038316 GTGGAGTCATGGTTCCCAGTTGG + Intergenic
966986290 3:185183254-185183276 TAGAAGTCCTGGTTCCTAGAGGG + Intergenic
967130340 3:186464862-186464884 CAGAGGTCCTGGTTCCCAGAGGG + Intergenic
967159648 3:186724281-186724303 AAGAAGTCCAGGCTCCCAGGGGG + Intronic
967892891 3:194375578-194375600 AAGGAGCTCAGGTTCCCTGATGG + Intergenic
969007889 4:4036371-4036393 GAGGAGCCCAGGTCCCCTCAGGG - Intergenic
979617026 4:122754565-122754587 AAGGAGTCAAGGGTCCCACAGGG + Intergenic
983070073 4:163257285-163257307 GAAGAACCCAGGTTCCTAGAGGG - Intergenic
983529082 4:168791306-168791328 GAGTAATACAGGGTCCCAGAGGG - Intronic
983989191 4:174097289-174097311 GAGGTGTTCAGCTTCCCATATGG + Intergenic
985656742 5:1135797-1135819 GAGGAGTGCAGTTTCACAGCTGG + Intergenic
987028420 5:13951757-13951779 GAGGGCTCCAGTTTCCCTGAGGG + Intergenic
992325667 5:75657007-75657029 GAGGAGGCTAGGTTCCCTGGAGG - Intronic
993585103 5:89714879-89714901 GAAGATTTCAGGTTCCCTGAAGG - Intergenic
994733987 5:103529277-103529299 GAGGAGTGCAGGTTGCAAGCTGG - Intergenic
995894596 5:116997809-116997831 AAGGAGTCCAGGTGCACAGTAGG - Intergenic
997607563 5:135186015-135186037 TAGGGGTCTAGGGTCCCAGAAGG + Intronic
997879085 5:137573835-137573857 GAGGAGCCCAGGTGCCTAGAAGG - Intronic
998744271 5:145239289-145239311 GAGGAGTGGATTTTCCCAGAAGG + Intergenic
1002452233 5:179325653-179325675 GAGAGGCCCAGGTTCCCCGAGGG - Intronic
1002528955 5:179832377-179832399 GAGGTGTGCAGGTTCCCTGTGGG + Intronic
1003414832 6:5898410-5898432 GGAGAGTCTGGGTTCCCAGAAGG - Intergenic
1003614300 6:7641431-7641453 CAGGAGGACAGGTGCCCAGATGG - Intergenic
1006166964 6:32070819-32070841 GAGGAGCGCAGGATCCCTGATGG + Intronic
1006506129 6:34489935-34489957 GGAGAGACCAGGTCCCCAGAAGG - Intronic
1007659566 6:43475497-43475519 GAGGCTTCCAGATTCCCAGAGGG - Intergenic
1012171021 6:96016386-96016408 GAGGGGTTCAGGTTGCCAGCAGG - Intronic
1012487379 6:99737421-99737443 GAAAAGTACAGGTTCCCTGAAGG - Intergenic
1016393822 6:143601703-143601725 GTGGACTCCTGGGTCCCAGATGG + Intronic
1017461547 6:154655612-154655634 GAGGCATCCAATTTCCCAGATGG - Intergenic
1018991281 6:168676063-168676085 GAGGAGGCCAGGGTCGCAGGAGG - Intergenic
1021423736 7:20474582-20474604 GTGGAGCACAGGTCCCCAGATGG + Intergenic
1022337119 7:29432333-29432355 CAGGGGTCCAAGTTCCCACAAGG + Intronic
1023142878 7:37120150-37120172 TTGGGGTCCAGGTTCCAAGATGG + Intronic
1023855689 7:44182252-44182274 TAGAAGTCCTGGTTCTCAGAGGG + Intronic
1024554099 7:50588581-50588603 GAGGACCCCAAGTTCCCCGAGGG + Intergenic
1026521538 7:71122350-71122372 GTGGAGTCCAGGTTTCTAGGGGG - Intergenic
1028404712 7:90463043-90463065 GAGGTGGCCAGGTTCCTAGAAGG - Intronic
1029091108 7:98049195-98049217 CAGGAATGCAGGTTGCCAGAGGG - Intergenic
1029465472 7:100721921-100721943 GGGGAGTCAAGGGTCCCTGAAGG - Intronic
1029581588 7:101439954-101439976 GAGGACACCAGGCTCCAAGAGGG - Intronic
1031070578 7:117156988-117157010 TAAGAGTCTAGGTTACCAGATGG + Intronic
1032488972 7:132309642-132309664 GAGGAGGCCAGATTTCCAGCAGG - Intronic
1035472117 7:159117106-159117128 GAGGAGACCAGGTTCACAGAGGG + Intronic
1036614757 8:10379586-10379608 GAGGAGACCAGGGTGCCAGAGGG - Intronic
1037323337 8:17664551-17664573 GAGGAGGCCGGTTTCCCAGGCGG - Intronic
1037990525 8:23318785-23318807 GGGGAGGCCAAGCTCCCAGAGGG + Intronic
1038147658 8:24913568-24913590 GAAAAGTCCAGGTTCCCATGCGG + Exonic
1038338423 8:26663647-26663669 GAGGAGGACAGATGCCCAGAGGG - Intergenic
1039014402 8:33129853-33129875 GAGAAGTCCAAGATACCAGAAGG + Intergenic
1039324123 8:36466191-36466213 GAGAAGGCTAGGTTCACAGATGG - Intergenic
1039587842 8:38721372-38721394 GAGGAGTCCAGGTTAGGACACGG + Intergenic
1040111981 8:43570686-43570708 GAGGAGGCCGGGGTCCCACATGG - Intergenic
1042390267 8:68226407-68226429 CTGGAGTCCAGGTTCTCAGCTGG - Intronic
1044409039 8:91865055-91865077 TAGGATTCCATGTTTCCAGAAGG + Intergenic
1047406132 8:124587140-124587162 CAGGAGAGCAGGTTCCCTGAGGG + Intronic
1048684810 8:136892597-136892619 GAGGAATCCAGCTTCCTAAATGG - Intergenic
1049651241 8:143771018-143771040 GCGGAGCCCAGGGCCCCAGAGGG - Intergenic
1051025342 9:12603774-12603796 GAGGATTCCTGATTCCCAGTGGG + Intergenic
1051091302 9:13412038-13412060 GGGAAGTCCATTTTCCCAGAAGG - Intergenic
1051867089 9:21695365-21695387 GAAGAGTGCAGGGTCCCAGACGG + Intergenic
1052358162 9:27527803-27527825 GAGAAGTCAGGGTCCCCAGATGG - Intronic
1053290935 9:36879293-36879315 GAGGAATCCTGGTGGCCAGAGGG + Intronic
1057204062 9:93160179-93160201 GAGGTGACCAGGGGCCCAGAGGG + Intergenic
1057472194 9:95367915-95367937 TAGGAGTCTGGCTTCCCAGAAGG - Intergenic
1060036387 9:120259633-120259655 ATGGAGTTCAGGTTCCCAGCAGG + Intergenic
1060747226 9:126145621-126145643 AATGAGACCAGGTGCCCAGATGG - Intergenic
1061150607 9:128826086-128826108 GAGGAATCCGAGTTCCGAGAGGG - Exonic
1061873129 9:133531228-133531250 CAGGAGTCCTGGTGCCCAGAAGG + Intergenic
1061889154 9:133608732-133608754 AAGGCGGCCAGGTTTCCAGAGGG + Intergenic
1061904579 9:133690135-133690157 GAGGACCCCAGGATCCCAGAGGG - Intronic
1062135519 9:134925351-134925373 GAGAAGACCAGGTTCACAGATGG + Intergenic
1062136644 9:134932320-134932342 GAGGAGTTAAGGTCCTCAGATGG - Intergenic
1062399828 9:136367459-136367481 GAGCAGTTCAGGGTCCCAGCAGG - Intronic
1185836134 X:3346906-3346928 GAGAAGTCCAGGACCCCAGGAGG + Intergenic
1186483915 X:9918400-9918422 GTGGATTCCTGGTTCACAGATGG + Intronic
1186735389 X:12458049-12458071 TAAAATTCCAGGTTCCCAGAAGG - Intronic
1189488685 X:41452735-41452757 GAGAAGTCAATGTTTCCAGAGGG - Intronic
1191099670 X:56712044-56712066 GATGGGTCCAAGTTCCCAGGGGG - Intergenic
1193370248 X:80687684-80687706 TAAGATTCCAGATTCCCAGAAGG - Intronic
1195796449 X:108653458-108653480 GAGTAGTTCAGGTTTCGAGAGGG + Intronic
1199590515 X:149463769-149463791 CTGGAGATCAGGTTCCCAGAAGG - Intergenic
1200064461 X:153497824-153497846 CAGGAGTCTAGAGTCCCAGAAGG - Intronic
1201232836 Y:11881649-11881671 AAGGATTCCTGGTTCCTAGATGG + Intergenic
1202577133 Y:26339823-26339845 GAGGAGCCCAGTATCTCAGATGG - Intergenic