ID: 1175952768

View in Genome Browser
Species Human (GRCh38)
Location 20:62592261-62592283
Sequence GGGGGCTGTCTGCACCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175952768_1175952774 -4 Left 1175952768 20:62592261-62592283 CCCAGCTGGTGCAGACAGCCCCC No data
Right 1175952774 20:62592280-62592302 CCCCATGCCTGCCCAGGGCCAGG No data
1175952768_1175952771 -9 Left 1175952768 20:62592261-62592283 CCCAGCTGGTGCAGACAGCCCCC No data
Right 1175952771 20:62592275-62592297 ACAGCCCCCATGCCTGCCCAGGG No data
1175952768_1175952777 1 Left 1175952768 20:62592261-62592283 CCCAGCTGGTGCAGACAGCCCCC No data
Right 1175952777 20:62592285-62592307 TGCCTGCCCAGGGCCAGGCATGG No data
1175952768_1175952781 10 Left 1175952768 20:62592261-62592283 CCCAGCTGGTGCAGACAGCCCCC No data
Right 1175952781 20:62592294-62592316 AGGGCCAGGCATGGACCCCATGG No data
1175952768_1175952770 -10 Left 1175952768 20:62592261-62592283 CCCAGCTGGTGCAGACAGCCCCC No data
Right 1175952770 20:62592274-62592296 GACAGCCCCCATGCCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175952768 Original CRISPR GGGGGCTGTCTGCACCAGCT GGG (reversed) Intergenic