ID: 1175953666

View in Genome Browser
Species Human (GRCh38)
Location 20:62596969-62596991
Sequence GGCCCCACGACAGCAAGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175953666_1175953673 16 Left 1175953666 20:62596969-62596991 CCAACGCTTGCTGTCGTGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1175953673 20:62597008-62597030 AATGGAGGCCAGAGAGGCAAAGG 0: 1
1: 0
2: 7
3: 58
4: 594
1175953666_1175953670 -2 Left 1175953666 20:62596969-62596991 CCAACGCTTGCTGTCGTGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1175953670 20:62596990-62597012 CCTGTTTGACAGAGGGACAATGG 0: 1
1: 0
2: 2
3: 17
4: 222
1175953666_1175953667 -10 Left 1175953666 20:62596969-62596991 CCAACGCTTGCTGTCGTGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1175953667 20:62596982-62597004 TCGTGGGGCCTGTTTGACAGAGG 0: 1
1: 0
2: 0
3: 6
4: 86
1175953666_1175953672 10 Left 1175953666 20:62596969-62596991 CCAACGCTTGCTGTCGTGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1175953672 20:62597002-62597024 AGGGACAATGGAGGCCAGAGAGG 0: 1
1: 0
2: 5
3: 58
4: 488
1175953666_1175953671 1 Left 1175953666 20:62596969-62596991 CCAACGCTTGCTGTCGTGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1175953671 20:62596993-62597015 GTTTGACAGAGGGACAATGGAGG 0: 1
1: 0
2: 2
3: 19
4: 189
1175953666_1175953668 -9 Left 1175953666 20:62596969-62596991 CCAACGCTTGCTGTCGTGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1175953668 20:62596983-62597005 CGTGGGGCCTGTTTGACAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175953666 Original CRISPR GGCCCCACGACAGCAAGCGT TGG (reversed) Intergenic
900331951 1:2139634-2139656 GACCCCATGACAGCAACCCTGGG - Intronic
900420498 1:2554063-2554085 GTCCCCGCGACAGGAGGCGTGGG + Intergenic
904004734 1:27357789-27357811 TGCACCAGGAGAGCAAGCGTCGG - Exonic
913983789 1:143547058-143547080 AGCCCCACGCCAGCAATCCTGGG - Intergenic
919136842 1:193520131-193520153 GGCCTCACGTCAGCCAGTGTAGG + Intergenic
919457780 1:197840310-197840332 GGACCCACAAGAGCAAGCTTAGG + Intergenic
1062964753 10:1598692-1598714 GGCCCCAGGAGAGCTGGCGTGGG + Intronic
1067369773 10:45672585-45672607 GGCCCCACGACGGCCGGCGGCGG + Intronic
1076896441 10:133315020-133315042 GGCCCCACCACAGCCACCCTCGG - Intronic
1077100131 11:819006-819028 GGCCCCACGTCAGGTCGCGTGGG + Intronic
1078823346 11:14905074-14905096 GGCCCCACGACCGCGGGTGTCGG + Intronic
1084568442 11:69944701-69944723 GGCCCACAGACAGCAGGCGTGGG - Intergenic
1091400114 12:176268-176290 GGCCCCACGAGCCCAAGCCTGGG + Exonic
1091602264 12:1925164-1925186 GGCCCCAGGACCCCATGCGTAGG + Intergenic
1101753505 12:107602831-107602853 GGCCTGAGGACAGCAAGCGATGG - Intronic
1126480315 15:49111261-49111283 GGCCCCAGGACAGCATGCACTGG - Intronic
1132205940 15:99986171-99986193 GGCCCCACCAAAGCAAGTGCAGG + Intronic
1135167930 16:20156959-20156981 GGCCCCATGCCAGGAAGTGTGGG - Intergenic
1136222006 16:28835087-28835109 TGCCCGACGTCAGCATGCGTGGG - Exonic
1136599848 16:31277854-31277876 TACCCCAACACAGCAAGCGTGGG + Intronic
1138580748 16:57939257-57939279 GGCCCCAAGACACCAAGGATGGG + Intronic
1143010924 17:3865815-3865837 GGCCCAACGACAGTGAGAGTGGG + Exonic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1147440666 17:40445443-40445465 GGTCCCAGGACAGGAAGCTTGGG - Intronic
1151421418 17:74000560-74000582 GGCCCCAAGACAGAAAGCTGGGG + Intergenic
1154072172 18:11162518-11162540 GGCCCCACAACAGAAAGTGCTGG + Intergenic
1160355034 18:78220418-78220440 GGCCAGAAGACAGCAAGCCTTGG + Intergenic
1160554816 18:79718167-79718189 GGACCCAAGACTGCAAGCGGGGG - Intronic
1161681161 19:5680524-5680546 GGCGCCGCGACAGGAAGCGGCGG - Exonic
1163263325 19:16204258-16204280 GGCCCAAGGACAGGAAGGGTGGG - Intronic
1167066062 19:47186987-47187009 GTCCCCACCACAGCTAGCATAGG + Intronic
935314753 2:101820818-101820840 TGCCCCATGACAGCAAGCCCTGG + Intronic
944001429 2:194842986-194843008 GGCCCCACAGCAGCATGCGGGGG - Intergenic
948547530 2:238743359-238743381 GGCCCCAAGAGAGCAAGCGCTGG - Intergenic
1172179132 20:32989977-32989999 GGCCCCACAACAGTAAAAGTTGG - Intronic
1173203176 20:40969074-40969096 AGCCTCAGGACAGCAAGTGTGGG + Intergenic
1175953666 20:62596969-62596991 GGCCCCACGACAGCAAGCGTTGG - Intergenic
1176213885 20:63939272-63939294 GTGCCCACGCCCGCAAGCGTGGG - Intergenic
1177260746 21:18725889-18725911 GGCCCCTAGACAGCATGCTTGGG - Intergenic
1180786489 22:18550603-18550625 GGCCACAGCACAGCAAGCGAGGG + Intergenic
1181243409 22:21490156-21490178 GGCCACAGCACAGCAAGCGAGGG + Intergenic
1183821176 22:40346857-40346879 GGCCCCAGGAAAGCAAGGGCAGG + Intronic
1185265797 22:49903420-49903442 GGCCCTCGGGCAGCAAGCGTGGG + Exonic
951931612 3:27973705-27973727 GGCCCCACGACAGCATCTGTGGG + Intergenic
953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG + Intergenic
955185540 3:56711681-56711703 GGTCCCACCACAGCAAGCACCGG - Intergenic
956568605 3:70668568-70668590 AGACCCACTACAGCAAGCTTTGG + Intergenic
966390805 3:179451105-179451127 GGCCCCACGACCGCCGGCGCAGG - Intronic
968995400 4:3942155-3942177 TGCCCCAGGACACCAAGTGTGGG + Intergenic
969515990 4:7648545-7648567 GGCCCCACGAGGGCAGGGGTTGG - Intronic
984894683 4:184527522-184527544 GGCCGCACCACAGCACGCTTCGG + Intergenic
990728929 5:58787085-58787107 AGCCCCACAACAGCACGCATTGG + Intronic
990772773 5:59268457-59268479 GGCACAATGACAGCAAGCCTGGG - Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
1002211559 5:177602402-177602424 GGCCCCAGCACAGCAAGCACAGG - Intronic
1013298314 6:108780179-108780201 GTGCCCACGAGAGCAAGAGTGGG + Intergenic
1018859380 6:167699543-167699565 GGCCCTGGGACAGCAAGGGTGGG + Intergenic
1019164860 6:170091405-170091427 GGCCCCCAGACAGGAAGGGTGGG - Intergenic
1019168379 6:170114665-170114687 AGACCCACGACAACAAGCGGGGG - Intergenic
1031216411 7:118898792-118898814 GGACCCAGGACATCAAGCTTTGG - Intergenic
1035984110 8:4406630-4406652 GGCCACACAACAGGAAGCATGGG + Intronic
1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG + Exonic
1041688720 8:60668482-60668504 GGCCCCACAACAGCAGCTGTGGG + Intergenic
1053392740 9:37747318-37747340 TGCCCCACTGCAGCAAGCATAGG + Intronic
1061148106 9:128812219-128812241 GGCGCCACTGCAGCAAGCCTGGG - Intergenic
1062427628 9:136513190-136513212 GGCCCCACAACAGCAGCCCTGGG + Intronic
1192790535 X:74378249-74378271 GGCCCCATGACACAAAGCGGGGG - Intergenic
1196613509 X:117741426-117741448 GGCCAGACAACAGCAAGTGTTGG + Intergenic
1197713057 X:129686134-129686156 GGCCCCAAGAAAGCAAGCCTTGG + Intergenic
1197785659 X:130194276-130194298 GGCCACATGACTGCAAGTGTTGG + Intergenic