ID: 1175954102

View in Genome Browser
Species Human (GRCh38)
Location 20:62599513-62599535
Sequence CTCCCATGACAGAGGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175954102_1175954108 -7 Left 1175954102 20:62599513-62599535 CCCAGGCTCCTCTGTCATGGGAG No data
Right 1175954108 20:62599529-62599551 ATGGGAGGGGTGCGAGTTCTTGG No data
1175954102_1175954109 -4 Left 1175954102 20:62599513-62599535 CCCAGGCTCCTCTGTCATGGGAG No data
Right 1175954109 20:62599532-62599554 GGAGGGGTGCGAGTTCTTGGAGG No data
1175954102_1175954113 26 Left 1175954102 20:62599513-62599535 CCCAGGCTCCTCTGTCATGGGAG No data
Right 1175954113 20:62599562-62599584 TGTGGCCTGCCCAGGACCACTGG No data
1175954102_1175954110 8 Left 1175954102 20:62599513-62599535 CCCAGGCTCCTCTGTCATGGGAG No data
Right 1175954110 20:62599544-62599566 GTTCTTGGAGGCCGAGAGTGTGG No data
1175954102_1175954111 18 Left 1175954102 20:62599513-62599535 CCCAGGCTCCTCTGTCATGGGAG No data
Right 1175954111 20:62599554-62599576 GCCGAGAGTGTGGCCTGCCCAGG No data
1175954102_1175954114 27 Left 1175954102 20:62599513-62599535 CCCAGGCTCCTCTGTCATGGGAG No data
Right 1175954114 20:62599563-62599585 GTGGCCTGCCCAGGACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175954102 Original CRISPR CTCCCATGACAGAGGAGCCT GGG (reversed) Intergenic
No off target data available for this crispr