ID: 1175956022

View in Genome Browser
Species Human (GRCh38)
Location 20:62609861-62609883
Sequence CCAGGTAAACAGAAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175956016_1175956022 0 Left 1175956016 20:62609838-62609860 CCCCGGGGCATTAAGAGGTCTCT No data
Right 1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG No data
1175956018_1175956022 -2 Left 1175956018 20:62609840-62609862 CCGGGGCATTAAGAGGTCTCTCC No data
Right 1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG No data
1175956014_1175956022 4 Left 1175956014 20:62609834-62609856 CCCACCCCGGGGCATTAAGAGGT No data
Right 1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG No data
1175956012_1175956022 5 Left 1175956012 20:62609833-62609855 CCCCACCCCGGGGCATTAAGAGG No data
Right 1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG No data
1175956017_1175956022 -1 Left 1175956017 20:62609839-62609861 CCCGGGGCATTAAGAGGTCTCTC No data
Right 1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG No data
1175956015_1175956022 3 Left 1175956015 20:62609835-62609857 CCACCCCGGGGCATTAAGAGGTC No data
Right 1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175956022 Original CRISPR CCAGGTAAACAGAAGCTGGA AGG Intergenic
No off target data available for this crispr