ID: 1175957381

View in Genome Browser
Species Human (GRCh38)
Location 20:62618328-62618350
Sequence GGTCCTAGTGGGGCACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175957381_1175957390 14 Left 1175957381 20:62618328-62618350 CCTGTTTGTGCCCCACTAGGACC No data
Right 1175957390 20:62618365-62618387 CCAGCCCTGAGAGCCCCACAGGG No data
1175957381_1175957385 -9 Left 1175957381 20:62618328-62618350 CCTGTTTGTGCCCCACTAGGACC No data
Right 1175957385 20:62618342-62618364 ACTAGGACCTGTCTCCTGCACGG No data
1175957381_1175957388 13 Left 1175957381 20:62618328-62618350 CCTGTTTGTGCCCCACTAGGACC No data
Right 1175957388 20:62618364-62618386 GCCAGCCCTGAGAGCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175957381 Original CRISPR GGTCCTAGTGGGGCACAAAC AGG (reversed) Intergenic
No off target data available for this crispr