ID: 1175958007

View in Genome Browser
Species Human (GRCh38)
Location 20:62621258-62621280
Sequence CCTGCCAGGCTGCGACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175958007_1175958016 11 Left 1175958007 20:62621258-62621280 CCCTGGGGTCGCAGCCTGGCAGG No data
Right 1175958016 20:62621292-62621314 CCGATCCCCGCCGGCCAGCCTGG No data
1175958007_1175958022 25 Left 1175958007 20:62621258-62621280 CCCTGGGGTCGCAGCCTGGCAGG No data
Right 1175958022 20:62621306-62621328 CCAGCCTGGCATCACCCACACGG No data
1175958007_1175958012 2 Left 1175958007 20:62621258-62621280 CCCTGGGGTCGCAGCCTGGCAGG No data
Right 1175958012 20:62621283-62621305 CTGCGCACCCCGATCCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175958007 Original CRISPR CCTGCCAGGCTGCGACCCCA GGG (reversed) Intergenic
No off target data available for this crispr