ID: 1175958463

View in Genome Browser
Species Human (GRCh38)
Location 20:62623191-62623213
Sequence CGGAGGCTGTGGAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175958463_1175958480 28 Left 1175958463 20:62623191-62623213 CCGTCCTCCCTCCACAGCCTCCG No data
Right 1175958480 20:62623242-62623264 CAGCCAAAGGGCTGCCCGGGTGG No data
1175958463_1175958477 24 Left 1175958463 20:62623191-62623213 CCGTCCTCCCTCCACAGCCTCCG No data
Right 1175958477 20:62623238-62623260 TCCACAGCCAAAGGGCTGCCCGG No data
1175958463_1175958473 15 Left 1175958463 20:62623191-62623213 CCGTCCTCCCTCCACAGCCTCCG No data
Right 1175958473 20:62623229-62623251 ACACCGTCCTCCACAGCCAAAGG No data
1175958463_1175958479 25 Left 1175958463 20:62623191-62623213 CCGTCCTCCCTCCACAGCCTCCG No data
Right 1175958479 20:62623239-62623261 CCACAGCCAAAGGGCTGCCCGGG No data
1175958463_1175958474 16 Left 1175958463 20:62623191-62623213 CCGTCCTCCCTCCACAGCCTCCG No data
Right 1175958474 20:62623230-62623252 CACCGTCCTCCACAGCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175958463 Original CRISPR CGGAGGCTGTGGAGGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr