ID: 1175962163

View in Genome Browser
Species Human (GRCh38)
Location 20:62642655-62642677
Sequence CGCCCCCGCGCGCATCCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 214}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175962163_1175962182 30 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962182 20:62642708-62642730 GCCTCTCCGCGGGGGAGGGCAGG 0: 1
1: 0
2: 8
3: 64
4: 287
1175962163_1175962174 20 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962174 20:62642698-62642720 AGCGCCCCGAGCCTCTCCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 92
1175962163_1175962175 21 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962175 20:62642699-62642721 GCGCCCCGAGCCTCTCCGCGGGG 0: 1
1: 0
2: 8
3: 28
4: 84
1175962163_1175962181 26 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962181 20:62642704-62642726 CCGAGCCTCTCCGCGGGGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 96
1175962163_1175962169 -6 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962169 20:62642672-62642694 GGGGCGGGAGGCCTGGGCACCGG 0: 1
1: 0
2: 4
3: 93
4: 728
1175962163_1175962176 22 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962176 20:62642700-62642722 CGCCCCGAGCCTCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 12
4: 108
1175962163_1175962173 19 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962173 20:62642697-62642719 GAGCGCCCCGAGCCTCTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 113
1175962163_1175962179 25 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962179 20:62642703-62642725 CCCGAGCCTCTCCGCGGGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175962163 Original CRISPR CGCCCCCGCGCGCATCCCCC CGG (reversed) Intronic