ID: 1175962170

View in Genome Browser
Species Human (GRCh38)
Location 20:62642683-62642705
Sequence GGGGCGCTCGGCCGGTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175962170_1175962181 -2 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962181 20:62642704-62642726 CCGAGCCTCTCCGCGGGGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 96
1175962170_1175962182 2 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962182 20:62642708-62642730 GCCTCTCCGCGGGGGAGGGCAGG 0: 1
1: 0
2: 8
3: 64
4: 287
1175962170_1175962173 -9 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962173 20:62642697-62642719 GAGCGCCCCGAGCCTCTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 113
1175962170_1175962174 -8 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962174 20:62642698-62642720 AGCGCCCCGAGCCTCTCCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 92
1175962170_1175962179 -3 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962179 20:62642703-62642725 CCCGAGCCTCTCCGCGGGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 113
1175962170_1175962176 -6 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962176 20:62642700-62642722 CGCCCCGAGCCTCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 12
4: 108
1175962170_1175962185 11 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962185 20:62642717-62642739 CGGGGGAGGGCAGGACCGAGCGG 0: 1
1: 0
2: 3
3: 33
4: 421
1175962170_1175962186 17 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962186 20:62642723-62642745 AGGGCAGGACCGAGCGGAATCGG 0: 1
1: 0
2: 0
3: 0
4: 101
1175962170_1175962187 20 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962187 20:62642726-62642748 GCAGGACCGAGCGGAATCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175962170_1175962175 -7 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962175 20:62642699-62642721 GCGCCCCGAGCCTCTCCGCGGGG 0: 1
1: 0
2: 8
3: 28
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175962170 Original CRISPR GGGGCGCTCGGCCGGTGCCC AGG (reversed) Intronic