ID: 1175962179

View in Genome Browser
Species Human (GRCh38)
Location 20:62642703-62642725
Sequence CCCGAGCCTCTCCGCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175962163_1175962179 25 Left 1175962163 20:62642655-62642677 CCGGGGGGATGCGCGCGGGGGCG 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1175962179 20:62642703-62642725 CCCGAGCCTCTCCGCGGGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 113
1175962170_1175962179 -3 Left 1175962170 20:62642683-62642705 CCTGGGCACCGGCCGAGCGCCCC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1175962179 20:62642703-62642725 CCCGAGCCTCTCCGCGGGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175962179 Original CRISPR CCCGAGCCTCTCCGCGGGGG AGG Intronic