ID: 1175963540

View in Genome Browser
Species Human (GRCh38)
Location 20:62648794-62648816
Sequence GCCTCTTGTCCCCACCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175963529_1175963540 27 Left 1175963529 20:62648744-62648766 CCTGGCTCCCAGGGCCTTGGCTG 0: 1
1: 1
2: 8
3: 70
4: 611
Right 1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 223
1175963533_1175963540 13 Left 1175963533 20:62648758-62648780 CCTTGGCTGATGACTGGAATTCA 0: 1
1: 0
2: 2
3: 27
4: 416
Right 1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 223
1175963531_1175963540 19 Left 1175963531 20:62648752-62648774 CCAGGGCCTTGGCTGATGACTGG 0: 1
1: 0
2: 1
3: 35
4: 263
Right 1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 223
1175963530_1175963540 20 Left 1175963530 20:62648751-62648773 CCCAGGGCCTTGGCTGATGACTG 0: 1
1: 0
2: 2
3: 31
4: 472
Right 1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175963540 Original CRISPR GCCTCTTGTCCCCACCGGCC AGG Intronic
900106316 1:982601-982623 TCCTCTTGTCCCCTCTGGCTCGG - Intergenic
900141725 1:1141583-1141605 CCCTCCTGTCCCCACCAACCCGG + Intergenic
900395525 1:2451751-2451773 GCGAGTTGGCCCCACCGGCCTGG + Intronic
900892563 1:5460075-5460097 GGCTGCTGTCCCCACAGGCCTGG - Intergenic
902391035 1:16106658-16106680 TCCTATTGTCCCCACTGGCAAGG + Intergenic
902940993 1:19799991-19800013 GCGCCTGGTCGCCACCGGCCGGG + Intergenic
903181793 1:21608575-21608597 GCTTCATGTCCCCACCCCCCAGG + Intronic
906774603 1:48518109-48518131 TCCTATTGTCCCCACTGGCAAGG + Intergenic
910127497 1:83860509-83860531 GGCTCTGGTCCTAACCGGCCTGG + Intergenic
910220562 1:84885720-84885742 GCCTCTTGTCCTCGGCTGCCAGG - Intronic
913351877 1:117870446-117870468 GCCTTTTGTCCCCACCTCTCTGG - Exonic
913942036 1:125118633-125118655 GCTTCTTGCCCCCACTGCCCGGG + Intergenic
915366870 1:155321643-155321665 AGCTCTTGTCCTCACTGGCCGGG + Intronic
915515094 1:156408067-156408089 GCCTCTTTTATCCACTGGCCAGG - Intronic
917511199 1:175670608-175670630 TCCTCTTGTCCCCAGCGACCTGG - Intronic
917737314 1:177932772-177932794 GCATCTTCTCCCCACCAGGCTGG - Exonic
917799592 1:178558863-178558885 TCCTATTGTCCCCACTGGCAAGG + Intergenic
918048243 1:180954040-180954062 GCGGGCTGTCCCCACCGGCCAGG + Intergenic
918616791 1:186553387-186553409 GCATCATGACCCCACCTGCCTGG - Intergenic
919789123 1:201278867-201278889 CCATCTTGTGCCCACCTGCCTGG + Intergenic
920173290 1:204084660-204084682 GCCTCTTGTCTCCTCCTCCCTGG + Intronic
920528392 1:206685025-206685047 GCCGCTGGCTCCCACCGGCCCGG - Exonic
922416632 1:225428126-225428148 GCCTCCCCTCCCCACCGGCGAGG + Intronic
1064336432 10:14447825-14447847 GCCACCTGTCCCCACTTGCCAGG - Intronic
1069546930 10:69335356-69335378 GCCTCTTCTCCCCTCCAGCTGGG - Intronic
1069579389 10:69554960-69554982 GCCACTTCTCCCCACCTCCCTGG + Intergenic
1069722717 10:70559979-70560001 CCCCCTTCTCCCCACCGCCCTGG - Intronic
1070770590 10:79080127-79080149 TCCTCATGTCCCCACCTTCCTGG + Intronic
1071291903 10:84194745-84194767 GCCTCATGTCTCCGCCGGCGCGG - Exonic
1075708238 10:124515787-124515809 GCGTTATGTCCCCACCAGCCAGG - Intronic
1076538114 10:131195896-131195918 GCACCCTGTCCCCACTGGCCTGG + Intronic
1076541932 10:131220209-131220231 GCCTATTGCCCCCAACAGCCTGG + Intronic
1077677780 11:4212250-4212272 GCCTCTGGTCTCCCGCGGCCCGG - Intergenic
1078051333 11:7967421-7967443 GCCTCTTGTGCCCACTGCTCAGG + Intergenic
1082301420 11:50510525-50510547 TCCTATTGTCCCCACTGGCAAGG - Intergenic
1084410903 11:69005412-69005434 GCGACTTGTCCCTCCCGGCCAGG + Exonic
1084843497 11:71878788-71878810 CCCTGTTGCCCCCACCGGGCTGG - Intronic
1084980642 11:72826845-72826867 ACCTCTCCTCCCCACCAGCCAGG + Intronic
1088746658 11:112809686-112809708 GCCTCTGGTCTCCCCAGGCCTGG - Intergenic
1088925646 11:114298430-114298452 TGCTCTTGTCCCCAAAGGCCTGG - Intronic
1090193909 11:124799534-124799556 GCCTCTTGCCCCCACCGCCGGGG - Intronic
1091565537 12:1645556-1645578 GCAACTTGTCCCCATCAGCCGGG - Intronic
1092605256 12:10111629-10111651 CCCACTTGTCCCCACCCACCGGG - Intergenic
1094492745 12:30971137-30971159 GCCTCTCATCCCAACCTGCCTGG + Intronic
1094512066 12:31102914-31102936 GGCTCTTGTCTCCCCCGCCCAGG + Exonic
1096462371 12:51829097-51829119 GCCCCTTCTCCACACCGGCCTGG - Intergenic
1096660417 12:53120764-53120786 GCCTCTTGTCCCCAACCACCAGG + Exonic
1096841010 12:54379195-54379217 TCCCCTTCTCCCCGCCGGCCGGG - Intronic
1097662446 12:62445845-62445867 CCATCTTGTCCCCACCACCCTGG - Intergenic
1097854238 12:64445053-64445075 CCCTCTTTTCCCCACCCCCCAGG + Exonic
1101913620 12:108879664-108879686 GCCTCATCTCCCCAGCGTCCTGG + Intronic
1103358983 12:120342582-120342604 GCCCCTTGCCCCCTGCGGCCTGG + Exonic
1103916582 12:124378878-124378900 GCCTTGTGTCCCCACAGCCCTGG - Intronic
1104010275 12:124925376-124925398 TCCTCTTGTGCCCACCCACCTGG + Intergenic
1104988607 12:132611496-132611518 GCCTCCTATCCCCTCTGGCCGGG - Intergenic
1107784095 13:43937094-43937116 CCCTCTTTTCCCCACAGTCCTGG - Intergenic
1110317941 13:74133027-74133049 GCCCCTTGTCAACTCCGGCCAGG + Intronic
1112423521 13:99275635-99275657 GCCTCTTCTACCCACCCCCCAGG + Intronic
1112842688 13:103600078-103600100 GCCGGCTGGCCCCACCGGCCCGG + Intergenic
1113812837 13:113152996-113153018 GTCTCTCCTCCCCACTGGCCCGG - Intergenic
1113923039 13:113925115-113925137 GCCTCTTCTCCCCAGAGTCCTGG + Intergenic
1121614316 14:95302858-95302880 TCCTCTTTTCACCACAGGCCAGG + Intronic
1121885773 14:97541410-97541432 GCCTGTTTCCCCCACCTGCCTGG - Intergenic
1122273316 14:100578051-100578073 GCCTCCCGTCCTCACAGGCCAGG + Intronic
1122362396 14:101175154-101175176 GCCTCCTGCCCACACCTGCCAGG - Intergenic
1124087677 15:26566599-26566621 GCCTGTTGTCCCCACTGTCCAGG + Intronic
1125674261 15:41494089-41494111 GCCGCTTGGCCCCGCGGGCCCGG - Exonic
1128914783 15:71549864-71549886 CCCTCCTCTCCCCACCTGCCAGG - Intronic
1129256379 15:74336299-74336321 GCCTCTTCTCTCCACCCTCCTGG - Intronic
1129332326 15:74834052-74834074 GGCTTTTGTCCCCAGAGGCCGGG - Intergenic
1131155598 15:90073354-90073376 TCCTCTTGCCCGCACTGGCCAGG - Intronic
1133839678 16:9396196-9396218 TCCTCTGGGCCCCACCTGCCAGG + Intergenic
1135208159 16:20499834-20499856 GCCTCCTGTCCCCACAGGTTTGG + Intergenic
1135210740 16:20523866-20523888 GCCTCCTGTCCCCACAGGTTTGG - Intergenic
1135324854 16:21519870-21519892 GCCGCTCTTCCCCACCTGCCCGG - Intergenic
1136403551 16:30030880-30030902 GCCTCCCCTCCCCACCTGCCTGG - Exonic
1139529900 16:67537856-67537878 GCCCCCAGCCCCCACCGGCCCGG - Intronic
1140599216 16:76455329-76455351 GCCTCTTGTCCCCATGGGCAGGG + Intronic
1141609185 16:85171432-85171454 GCCTGTGGACTCCACCGGCCTGG + Exonic
1141699513 16:85636036-85636058 GCCGCTGGTCCCCACTGGCCAGG + Intronic
1142037059 16:87868927-87868949 GCCGCTCTTCCCCACCTGCCCGG - Exonic
1142347878 16:89565591-89565613 GGCACTTGTCCCCACCAGCGGGG - Exonic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1142998832 17:3777655-3777677 TCCTCTTTTCCCTACAGGCCTGG - Exonic
1143509260 17:7386544-7386566 TCCTCTTGTCTCCACAGGCCGGG + Exonic
1146140152 17:30360184-30360206 GCCTCTTATTAACACCGGCCTGG - Intergenic
1146257075 17:31397782-31397804 GCCTCTTGTGCCCACCAGTTTGG + Intronic
1146788002 17:35735021-35735043 ACCTCTTGTCCCCACAGTCCAGG + Exonic
1147327752 17:39677890-39677912 CCCACTTGTCCCCACCGCCATGG - Intronic
1147726117 17:42567106-42567128 TCATCTTGTACCCACCGGACCGG - Exonic
1151556108 17:74847530-74847552 GCCTCTTGCCCCCAGAGTCCGGG - Exonic
1151954251 17:77372828-77372850 GGCTCTTGAGCCCACAGGCCGGG + Intronic
1152245491 17:79182889-79182911 GCCCCGAGTCCCCAGCGGCCCGG + Intronic
1152500925 17:80708582-80708604 GACTGTTGTCCCCACCCTCCAGG + Intronic
1152500944 17:80708655-80708677 GACTGTTGTCCCCACCCTCCAGG + Intronic
1152587071 17:81193890-81193912 GGGTCCTGGCCCCACCGGCCTGG + Intronic
1152696040 17:81796077-81796099 CCGGCTTGTCCCCCCCGGCCTGG + Intergenic
1152840885 17:82567415-82567437 GCCACTTTTTCCCACCGGGCTGG - Intronic
1153977665 18:10283614-10283636 GCCACGTGTCCTCTCCGGCCAGG + Intergenic
1154950973 18:21209474-21209496 GCCTGTTGTGCTCACAGGCCAGG + Intergenic
1160006495 18:75072737-75072759 GCCACTTGTCCCCTGGGGCCAGG - Intergenic
1160232519 18:77058700-77058722 GCTGCTTGACCCCACAGGCCTGG - Intronic
1160447588 18:78939657-78939679 GCCTGTTGTCCCTGCAGGCCCGG - Intergenic
1160682947 19:420295-420317 GGCTCTTGTGCACCCCGGCCTGG - Intronic
1161069686 19:2253849-2253871 GTCTCTTGTCCCCTGCGCCCGGG - Intronic
1161951380 19:7469844-7469866 GCCAGCTGTCCCCACCCGCCAGG - Intronic
1162413032 19:10517750-10517772 GCCTCTTCTCCCCAGCGGAGGGG + Intronic
1162499238 19:11041983-11042005 GCCTCTTGTCCCCAACCTCCTGG - Intronic
1163614086 19:18316470-18316492 GCCTGTTGTCCCCAGCTGCTTGG - Intronic
1163648600 19:18504162-18504184 GCCACTTGTGCCAACAGGCCAGG + Intronic
1164024906 19:21343135-21343157 TCCTATTGTCCCCACTGGCAAGG + Intergenic
1164146483 19:22515610-22515632 GCCTCTGGTCCCGAGCTGCCTGG - Intronic
1165068773 19:33243293-33243315 GCATCTTCTCCTCACCAGCCAGG - Intergenic
1165155620 19:33785487-33785509 GCTTCTTGTTCCCACAGACCTGG + Intergenic
1165866039 19:38939674-38939696 TCCTATTGTCCCCACTGGCAAGG + Intronic
1165903860 19:39181621-39181643 CCTTCCTGACCCCACCGGCCCGG + Intronic
1166690490 19:44819302-44819324 ACCCCTTGACCCCACCAGCCGGG + Intronic
1168352854 19:55686477-55686499 TCCTCCTGTCTGCACCGGCCTGG - Intronic
1168503446 19:56912971-56912993 GCCTGTTTCCTCCACCGGCCTGG - Intergenic
925592598 2:5525511-5525533 CCCTCCTGTCCGCACCTGCCTGG + Intergenic
927118157 2:19925165-19925187 TCCTATTGTCCCCACTGGCAAGG - Intronic
927464615 2:23327799-23327821 GCCTCTTGTTCCCAGCTCCCTGG - Intergenic
928022509 2:27715751-27715773 GCCTCTGGGCCCCTCTGGCCGGG - Intergenic
929753983 2:44748470-44748492 GCCGCATGTCCCAACCAGCCAGG + Intronic
931300383 2:60973364-60973386 CCCCGTTGTCCCCACAGGCCTGG + Intronic
931719472 2:65056674-65056696 GCCTCGCGTCCCCGCCGGCAAGG + Intronic
931836977 2:66109267-66109289 GCCTCTAGTAACCACCAGCCAGG - Intergenic
932826618 2:74947451-74947473 CCATCTTGTCCCCACCCCCCAGG - Intergenic
934251670 2:90360420-90360442 GCTTCTTGCCCCCACCGCCCGGG - Intergenic
934251701 2:90360528-90360550 GCTTCTTGCCCCCGCCGCCCCGG - Intergenic
934257734 2:91442415-91442437 GCTTCTTGCCCCCGCCGCCCCGG + Intergenic
934257765 2:91442523-91442545 GCTTCTTGCCCCCACCGCCCGGG + Intergenic
934928044 2:98395932-98395954 GTCCCTGGTCCCCACCGACCTGG + Exonic
937044425 2:118843665-118843687 GCCTGCTGTCCTCACCGCCCCGG + Intronic
937338422 2:121076027-121076049 GCCTCCTGTCCCCGCTGCCCTGG + Intergenic
944271169 2:197786180-197786202 TCCGCTTCTCCCCACCCGCCAGG - Exonic
946171868 2:217900435-217900457 GCCCCCTGCCCCCACGGGCCAGG + Intronic
946372962 2:219291611-219291633 TCCTTTTCTCCCCACCTGCCCGG + Intronic
947746201 2:232508490-232508512 GCCCCTCCTCCCCACCTGCCAGG - Intergenic
948795421 2:240399978-240400000 GCCTCGGGTGCCCACCAGCCTGG + Intergenic
1168812235 20:711633-711655 GCCTCATGTCCCCACCCACTAGG + Intergenic
1168894344 20:1313211-1313233 GCCTCCTAACCCCAGCGGCCAGG - Intronic
1168938243 20:1686370-1686392 GCCTCCTGGCCCCACCCTCCTGG - Intergenic
1170307471 20:14955544-14955566 GCTTCTTGGCCACACAGGCCTGG - Intronic
1171177188 20:23061381-23061403 CCCTCTTCTACCCACAGGCCTGG + Intergenic
1171235992 20:23525562-23525584 GCATCTCATCCCCAGCGGCCTGG + Intergenic
1173497349 20:43529163-43529185 GCCTTTAGGCCCCACCCGCCTGG - Intronic
1173783506 20:45775597-45775619 GCCTGTTGTTCCCACAGGGCGGG - Exonic
1173895214 20:46545836-46545858 GGCTCTGGGCCCCACAGGCCAGG - Exonic
1174054541 20:47788862-47788884 GCCTGCGGTCCCCACCGGCCTGG - Intergenic
1174353879 20:49985822-49985844 GCCCTTTGTCCCCGCCGGCCTGG + Intronic
1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG + Intronic
1176044203 20:63083989-63084011 GCCTTTTGTCCCCCGCGGGCAGG + Intergenic
1176254467 20:64143724-64143746 GACTCTGGTCCCCACCCACCTGG - Intergenic
1179179872 21:39036076-39036098 GCCTCCTGTCCCCACCGTAGTGG + Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179487849 21:41722368-41722390 GCCTCCTGGCCTCACCGTCCAGG - Intergenic
1180281388 22:10699467-10699489 GCTTTTTGTCCCCACCGCCATGG + Intergenic
1180708560 22:17824418-17824440 GCATCTTCTCTCCACAGGCCAGG + Intronic
1181968218 22:26671343-26671365 GCCTCCCGCCCCCACCAGCCAGG - Intergenic
1182698015 22:32209298-32209320 GCCTCATGCCCCCTCAGGCCAGG - Intergenic
1183101573 22:35587454-35587476 GCCTCTGGTCCCAATCTGCCAGG - Intergenic
1184035736 22:41917273-41917295 CCCTCCTGCCCCCACCGTCCTGG + Intergenic
1184164138 22:42717499-42717521 GCCTCCTGTCCTCACCAGCCCGG + Intronic
952878155 3:37965561-37965583 TCCTCTTTCCCCCACCAGCCTGG + Intronic
953494712 3:43376058-43376080 GCCTCTTGTCACCAACTGGCTGG + Intronic
954445593 3:50545146-50545168 GCCTCTTGGCCCCATCTCCCAGG + Intergenic
954679010 3:52331437-52331459 TCCTCTGGTCCTCACCGGTCAGG - Intronic
956195733 3:66651668-66651690 GCCGGCTGGCCCCACCGGCCCGG + Intergenic
959987142 3:112586487-112586509 GCCTCTTCTCCCCACAGGAAAGG - Intergenic
962184900 3:133247820-133247842 GCCTTTTTTCTCCACTGGCCTGG - Intronic
963170268 3:142243224-142243246 CCCTCTGGTCTCCACCAGCCAGG + Intergenic
967770510 3:193329399-193329421 TCCTCATGTCCTCACCTGCCAGG - Intronic
968662100 4:1802897-1802919 GTCTCTTGTCCCCGCAGTCCTGG + Exonic
971380849 4:26096206-26096228 GCCTCATTTCCCCCCCGCCCCGG + Intergenic
982337887 4:154260205-154260227 GCCTCCTTTCCCCACCGACCCGG + Intronic
982646195 4:158027344-158027366 GCCTCTAGTCACCCCCTGCCAGG + Intergenic
984296557 4:177861678-177861700 GCCCCTTGCCCCCACAGGCTTGG + Intronic
985513557 5:325389-325411 GCCTGTTCTCCCCACCAGACTGG + Intronic
990837338 5:60036741-60036763 CCCTCGTGTCCTCACAGGCCTGG + Intronic
993406019 5:87512471-87512493 TCCTATTGTCCCCGCTGGCCAGG - Intergenic
995592439 5:113713382-113713404 TCCTATTGTCCCCACTGGCAAGG - Intergenic
997806668 5:136924658-136924680 GCCTCTGGCCCCTACCTGCCAGG + Intergenic
999263256 5:150250584-150250606 CCCTCTTGGCCCCATGGGCCAGG + Intronic
1001476580 5:172054894-172054916 GTGTCATGTCCCCACCAGCCTGG - Intronic
1001821397 5:174713126-174713148 GACTCTAGTCGCCACCAGCCAGG - Intergenic
1002061940 5:176630348-176630370 GCCCCTGGTCCACCCCGGCCTGG - Exonic
1002660894 5:180790664-180790686 GCCCCATGTCCTCACAGGCCAGG - Exonic
1003874452 6:10423700-10423722 GCGTGGTGTCCCAACCGGCCTGG + Intergenic
1004180274 6:13375413-13375435 GCCTCCCATCCCCACCGCCCTGG - Intronic
1005694199 6:28336049-28336071 GCCCCTTGTCGCGACCCGCCAGG - Intronic
1009250447 6:61292101-61292123 TCCTATTGTCCCCACTGGCAAGG + Intergenic
1014457570 6:121654082-121654104 TCCTCTTGTCCACACCACCCAGG - Intergenic
1017774933 6:157673134-157673156 GCCTCTGGTGTCCCCCGGCCTGG - Exonic
1018399239 6:163405711-163405733 GCCTCCTTCCCGCACCGGCCTGG + Intergenic
1018768982 6:166956101-166956123 GGCGCTTGTCCGCACCGCCCAGG + Exonic
1019014654 6:168871158-168871180 GCCTCATCTCCCCAGGGGCCCGG + Intergenic
1020090898 7:5340148-5340170 GCCTCTTGTGCCAAACTGCCAGG + Intronic
1020144488 7:5632188-5632210 CCCTCCTGCCCCCACTGGCCAGG - Intronic
1022672779 7:32471809-32471831 TCCTCTTGTCCACACCACCCAGG - Intergenic
1024984062 7:55180744-55180766 GCCTCCCTTCCCCACAGGCCAGG - Intronic
1025106607 7:56175687-56175709 GGCGCTTGTCCGCACCGCCCAGG - Intergenic
1025320121 7:58086962-58086984 GCTTCTTGCCCCCACTGCCCGGG + Intergenic
1025478559 7:60956582-60956604 GCTTGTTGCCCCCACCGCCCTGG + Intergenic
1025878514 7:65509689-65509711 GCTTCTTGCCCCCACCGTCGCGG - Intergenic
1026795738 7:73364734-73364756 ACCTCTTCTCCGCACCAGCCCGG - Intergenic
1029113995 7:98228111-98228133 GCCACCTCTCCCCACAGGCCTGG - Exonic
1029625503 7:101718162-101718184 GCCTCTTTCCCCCACGGGGCTGG - Intergenic
1034213565 7:149385759-149385781 ACCTCTCTTCCCCACCAGCCTGG + Intergenic
1034434346 7:151056050-151056072 GGCTCTGGTCCCCACCTTCCTGG + Intronic
1036834442 8:12049268-12049290 CCCTGTTGCCCCCACCGGGCTGG + Intergenic
1036856285 8:12295832-12295854 CCCTGTTGCCCCCACCGGGCTGG + Intergenic
1037662682 8:20941010-20941032 GCCTGCTGTCCCCAGGGGCCTGG + Intergenic
1042282044 8:67065022-67065044 GCCTTCTCTCCCCAACGGCCAGG + Intronic
1044275050 8:90289497-90289519 GCCTCCTTTCCTCACTGGCCTGG - Intergenic
1044858044 8:96495168-96495190 GCCTCTGTCCCCCAGCGGCCAGG - Intronic
1045320738 8:101080067-101080089 GCCTCTCCTCCCCACTGGACTGG - Intergenic
1048241647 8:132748373-132748395 GCCTCTTCTCACCATCTGCCAGG - Intronic
1049573098 8:143378660-143378682 GCCACTGGGCCCCACCGCCCTGG - Intronic
1049743284 8:144251077-144251099 GCCTCATGCCCCCGCCTGCCAGG - Intronic
1049787177 8:144456543-144456565 GCCACCTCTCCCCACCAGCCAGG + Intronic
1052880403 9:33598259-33598281 GCATCTGGTCCCCTACGGCCTGG + Intergenic
1056846760 9:90045005-90045027 GGCCCTTGTCTCCACTGGCCCGG - Intergenic
1057054637 9:91950688-91950710 CGCGCTTGTCCCCACCGACCTGG - Intergenic
1057297911 9:93860120-93860142 GCCCCTCATCCCCAGCGGCCAGG + Intergenic
1059991347 9:119869191-119869213 GCCTGTTTTCCCCACCAGACTGG - Intergenic
1060514630 9:124258107-124258129 GCCGCGGGGCCCCACCGGCCCGG - Intronic
1062436326 9:136548053-136548075 GCCTCACCTCCCCACCAGCCTGG + Intergenic
1062493842 9:136822309-136822331 GCCTCTGCTCCCCACCAACCCGG + Intronic
1062567120 9:137168317-137168339 GCCCCTTGACCCCACACGCCGGG + Exonic
1186867533 X:13734985-13735007 TCGTCTTGGCCCCACCGCCCGGG + Exonic
1187388886 X:18873025-18873047 GCCGCTTGTCCCCATGGCCCTGG + Intergenic
1192173328 X:68870412-68870434 TCCTCCTTTCCCCACCAGCCAGG - Intergenic
1193048751 X:77079312-77079334 TCCTATTGTCCCCACTGGCAAGG - Intergenic
1194536068 X:95107114-95107136 TCCTATTGTCCCCACTGGCAAGG + Intergenic
1195691471 X:107629061-107629083 GCCACGTGTCCCTACCGCCCTGG - Intronic
1196828706 X:119759774-119759796 GTCTCCTGTAACCACCGGCCTGG + Exonic
1198283886 X:135171175-135171197 CCCAGTTGTCACCACCGGCCTGG + Exonic
1198286249 X:135194683-135194705 CTCTGTTGTCACCACCGGCCTGG + Intergenic
1199846227 X:151694749-151694771 GCGTCCTGTCCCCACCCCCCGGG - Intergenic