ID: 1175963838

View in Genome Browser
Species Human (GRCh38)
Location 20:62650300-62650322
Sequence CAGCTGGGCTTGGGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 1, 2: 2, 3: 58, 4: 465}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175963838_1175963845 -3 Left 1175963838 20:62650300-62650322 CCCTTCTTCCCCAAGCCCAGCTG 0: 1
1: 1
2: 2
3: 58
4: 465
Right 1175963845 20:62650320-62650342 CTGCAATGTCCTGTTCCCCTTGG 0: 1
1: 0
2: 1
3: 22
4: 197
1175963838_1175963851 12 Left 1175963838 20:62650300-62650322 CCCTTCTTCCCCAAGCCCAGCTG 0: 1
1: 1
2: 2
3: 58
4: 465
Right 1175963851 20:62650335-62650357 CCCCTTGGTGGGGCCAGTCCAGG 0: 1
1: 0
2: 4
3: 21
4: 208
1175963838_1175963853 13 Left 1175963838 20:62650300-62650322 CCCTTCTTCCCCAAGCCCAGCTG 0: 1
1: 1
2: 2
3: 58
4: 465
Right 1175963853 20:62650336-62650358 CCCTTGGTGGGGCCAGTCCAGGG 0: 1
1: 0
2: 3
3: 35
4: 205
1175963838_1175963848 2 Left 1175963838 20:62650300-62650322 CCCTTCTTCCCCAAGCCCAGCTG 0: 1
1: 1
2: 2
3: 58
4: 465
Right 1175963848 20:62650325-62650347 ATGTCCTGTTCCCCTTGGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 141
1175963838_1175963846 0 Left 1175963838 20:62650300-62650322 CCCTTCTTCCCCAAGCCCAGCTG 0: 1
1: 1
2: 2
3: 58
4: 465
Right 1175963846 20:62650323-62650345 CAATGTCCTGTTCCCCTTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
1175963838_1175963855 14 Left 1175963838 20:62650300-62650322 CCCTTCTTCCCCAAGCCCAGCTG 0: 1
1: 1
2: 2
3: 58
4: 465
Right 1175963855 20:62650337-62650359 CCTTGGTGGGGCCAGTCCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 215
1175963838_1175963847 1 Left 1175963838 20:62650300-62650322 CCCTTCTTCCCCAAGCCCAGCTG 0: 1
1: 1
2: 2
3: 58
4: 465
Right 1175963847 20:62650324-62650346 AATGTCCTGTTCCCCTTGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1175963838_1175963856 19 Left 1175963838 20:62650300-62650322 CCCTTCTTCCCCAAGCCCAGCTG 0: 1
1: 1
2: 2
3: 58
4: 465
Right 1175963856 20:62650342-62650364 GTGGGGCCAGTCCAGGGGCTAGG 0: 1
1: 0
2: 3
3: 58
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175963838 Original CRISPR CAGCTGGGCTTGGGGAAGAA GGG (reversed) Intronic
900174302 1:1285042-1285064 CAGATGGCCTTGGGGACGCAGGG + Intronic
900537455 1:3185948-3185970 CAGCTGGGCTCAGGGCAGAGTGG + Intronic
900772997 1:4560842-4560864 CAGCTGGGCTTAAGAAAGACAGG - Intergenic
900957113 1:5892850-5892872 GAGGTGGGCTTGGGGAGGACAGG - Intronic
901303764 1:8217673-8217695 AAGCTGGGCTTGGCGAGGGAGGG + Intergenic
901727918 1:11256887-11256909 CAGCCAGGCTTGGGGAACGATGG - Intronic
902244901 1:15114468-15114490 CAGCTGCCCCTGGGGAAGATAGG + Exonic
902286369 1:15410704-15410726 TAGCTGGGATCGGGGAAGGAAGG - Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
903557339 1:24203272-24203294 CAGGAGGGCACGGGGAAGAAAGG - Intergenic
903814654 1:26056070-26056092 CAGCTGAGGTTGGGGGACAAGGG - Intronic
904116236 1:28163964-28163986 CAGCTGGGGGTGGGGTAGAGAGG + Intronic
904275894 1:29384135-29384157 CAGCTGGGCATCAGGAAGGAAGG + Intergenic
904300773 1:29551996-29552018 GAGCTGGGCTTGGGGACACAGGG + Intergenic
904325978 1:29727538-29727560 CAGGTGGGCTGGGGGAGGAGTGG + Intergenic
904325999 1:29727594-29727616 CAGGTGGGCTGGGGGAGGAGTGG + Intergenic
904457430 1:30656047-30656069 GAGCTGGGCTTGGGGACACAGGG - Intergenic
905462907 1:38133228-38133250 GAACTGGGGATGGGGAAGAAGGG + Intergenic
905624608 1:39480032-39480054 AGGGTGGGATTGGGGAAGAAGGG - Intronic
905975059 1:42168558-42168580 CAGAGGGGCTTGGGGAACAAGGG - Intergenic
906332997 1:44903422-44903444 ATGCTGGGAATGGGGAAGAAGGG - Intronic
906913498 1:49982539-49982561 CAGAAAGGCTTGGGGCAGAAAGG + Intronic
906951909 1:50341552-50341574 CAGCTGGGAATGGGGAGGAGAGG - Intergenic
907308053 1:53524563-53524585 CAGCTGGGGGTGTGGAAGGAAGG + Intronic
907446301 1:54510113-54510135 CAGCTGGGCAGAGGGTAGAAAGG + Intergenic
907677903 1:56535690-56535712 AAGCTCTGCTTGGGGAAGGAAGG + Intronic
909643022 1:77888308-77888330 CAGCCAGGCCTGGGGAAGGAAGG - Intergenic
909784341 1:79592285-79592307 TATCTGGCCTTGGGGATGAAGGG + Intergenic
909951306 1:81723206-81723228 CAGCTGCATTTGGGGGAGAAGGG - Intronic
910975593 1:92902341-92902363 CAGCTTGGCTTGGGGATGTGTGG + Intronic
912385957 1:109271268-109271290 CGGCAGGGCTTTGAGAAGAAAGG + Exonic
912387634 1:109280191-109280213 CAAATGGGCTTGAGGAAGAAGGG - Intronic
912394905 1:109335058-109335080 CAACTGGGGTTGGGGGAGACAGG + Intronic
912491714 1:110066109-110066131 CAGCTGTGGTTGGGGGAGGATGG + Intronic
912658171 1:111506030-111506052 TAGATGGACTTGGGGGAGAAGGG - Intronic
912735325 1:112145098-112145120 CAGCTGGGCAGGGGGAGGATGGG + Intergenic
913126668 1:115797090-115797112 CAGATGGGATTGGGGAAGCTAGG - Intergenic
913359827 1:117968018-117968040 CTGCTGGACTTGGAGGAGAAGGG - Intronic
914343955 1:146782172-146782194 CAGCTGGGGACGGGGAAGAAAGG - Intergenic
914359414 1:146919868-146919890 TATCTGGGCTTAGGGAAGATGGG + Intergenic
915014691 1:152721766-152721788 CAGGTGGGATTGAGGAGGAAAGG - Intergenic
915491625 1:156253123-156253145 CAGCCGGGCCGGGGGAAGAGTGG + Intronic
915665116 1:157437469-157437491 CAGCCAGGGTTGGGGAAAAAAGG - Intergenic
915843866 1:159241249-159241271 CAGCAGGGCTTTGGAAATAAAGG - Intergenic
916586427 1:166153902-166153924 GAGGTGGGGTTGGGGAAGAATGG - Intronic
916663782 1:166947539-166947561 CAGCTGGCTTTGGAGAAAAATGG + Intronic
916713975 1:167434736-167434758 CAGCAGGGTTTGGGGAGGGAAGG + Intronic
917515598 1:175705040-175705062 CAGCTGGGCTAAGGGCAGGAAGG + Intronic
917969658 1:180198594-180198616 CAGCTGGGGCTGGGGAGGGATGG + Exonic
919794207 1:201311421-201311443 CAGCTGGGCGTGTGGGTGAAGGG + Intronic
919980346 1:202639022-202639044 CAGATGGGCTTGGGGAAGGGAGG - Intronic
920825511 1:209421181-209421203 CAGCTGGCCCTGGGGAAGCCTGG + Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
921745800 1:218739589-218739611 CAGCTGGGCAAGGGGAGGAGTGG - Intergenic
922429151 1:225529861-225529883 GAGCTGGGGTTGGGGAGGACAGG - Intronic
922886867 1:229027239-229027261 CACCTGGGATCGGGGAAGGAAGG - Intergenic
922976043 1:229784306-229784328 CAGCTGGGATTGGCGAAGTCTGG - Intergenic
923010587 1:230084593-230084615 CTGGTGGGCTCGGGGGAGAATGG + Intronic
923542333 1:234897502-234897524 CAGCTGGGGTTGGGGAGCATTGG - Intergenic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1065307418 10:24382200-24382222 CAGATGGGCTTGGGGATAAGAGG + Intronic
1065614277 10:27504340-27504362 CAGCTGGGCTCGGAGCGGAACGG + Exonic
1066263423 10:33751432-33751454 GATCTGGGACTGGGGAAGAAAGG - Intergenic
1066602865 10:37126085-37126107 CTGGGGGGCCTGGGGAAGAAGGG + Intronic
1066975369 10:42363510-42363532 CAGCTGGGGTTGGGATGGAAGGG - Intergenic
1067015798 10:42755556-42755578 CAGCTGAGCTTGGGGAGAATGGG - Intergenic
1067078634 10:43201937-43201959 CAGCTTGGCCTGGGGCAGCAGGG + Exonic
1067745117 10:48929741-48929763 GAGCTGGGCTTGGGACAGACAGG - Intronic
1067932106 10:50572503-50572525 GAGATGGGTTGGGGGAAGAAGGG + Intronic
1069774721 10:70919658-70919680 CAGCTGGGCTTGGGTCTGCAAGG + Intergenic
1071391875 10:85183567-85183589 CAGCTGGACTTTGAAAAGAAGGG - Intergenic
1072409269 10:95184871-95184893 CAGCTGGAGTTGGAGGAGAAGGG - Intergenic
1073070500 10:100790510-100790532 AGCCTGTGCTTGGGGAAGAAGGG - Intronic
1073438304 10:103535787-103535809 CAGCTTGGCTTGGGGATGTTGGG + Intronic
1074290346 10:112133510-112133532 CGTCTGTGCTGGGGGAAGAAGGG - Intergenic
1074853599 10:117457510-117457532 CAGCTAGGCAGGGAGAAGAATGG + Intergenic
1074892352 10:117746246-117746268 CAGCGGGGCATGGGGAGGAAGGG - Intergenic
1075678304 10:124313258-124313280 CAACTGGACTTGGGGCAAAATGG - Intergenic
1075904832 10:126072172-126072194 CAACTGTGCTGGGGGAAGATAGG - Intronic
1076512963 10:131025372-131025394 CAGCTGGGATAAGGGAAGGAGGG - Intergenic
1077332181 11:1988566-1988588 CAGCTGGGGATGGGGGAGAGGGG + Intergenic
1077405020 11:2378959-2378981 CAGCCCGGCTTGGGGAAGGTGGG - Intronic
1077442076 11:2573584-2573606 CAGCTGGGCCTAGGGAAGCAGGG + Intronic
1077900293 11:6481967-6481989 AGGCTGGGCATGGGGAAGAAAGG + Intronic
1078062095 11:8054933-8054955 GAGGTGGGCTTGGGCAAGATGGG + Intronic
1080776474 11:35391626-35391648 CAGGTTTGGTTGGGGAAGAAGGG + Intronic
1080784618 11:35463430-35463452 CAACTGGGCCGGGGGAACAAAGG + Intronic
1082984615 11:59157781-59157803 CAGCTGAGGTTGAGGCAGAAGGG - Intergenic
1083160911 11:60853571-60853593 CTGCTGGGCCTGGTGGAGAATGG - Exonic
1083773921 11:64883948-64883970 GAGCTGGGCTTGTTGAAGATGGG - Intronic
1083873435 11:65506729-65506751 GAGCTGGGCTGGGGGAGAAATGG + Intergenic
1084020103 11:66412189-66412211 CAGGTTGGCTTCCGGAAGAATGG + Intergenic
1084170511 11:67398702-67398724 CAGGTGAGTGTGGGGAAGAAAGG - Exonic
1084420050 11:69055904-69055926 GAGGTGGGCGTGGGGCAGAAAGG + Intronic
1084651973 11:70494831-70494853 CAGCTGGACTTGGTCATGAAGGG - Intronic
1084946177 11:72639786-72639808 CAGCTGGGGTTGGGGGGGCATGG + Intronic
1084972654 11:72780346-72780368 CAGGTGGGCTGGGGAAGGAAGGG - Intronic
1085513781 11:77100759-77100781 CAGCAGTTCTTGGGGTAGAATGG - Intronic
1085871078 11:80349865-80349887 GAGCTGGGCTTGGGGTTGATGGG + Intergenic
1086950400 11:92884923-92884945 CATGTGGGCTTTGGGCAGAAGGG + Intronic
1089286545 11:117411283-117411305 CAGCAGGACTGGGGGAATAAGGG - Intronic
1089369224 11:117942362-117942384 CGGCTGGCCTCGGGGGAGAATGG - Intergenic
1089503232 11:118945299-118945321 CAGCTGAGCTTGGGGACTACTGG - Intronic
1089603572 11:119629002-119629024 CTGCTGGGCTTGGCAATGAAAGG - Intronic
1089835077 11:121363261-121363283 CTTCCGGGCTTGGCGAAGAAGGG - Intergenic
1090098987 11:123773816-123773838 TGGCTGGCCTTGGGAAAGAATGG + Intergenic
1091132683 11:133159746-133159768 CAGCTGGGCTTTGGGAGACAGGG - Intronic
1202815162 11_KI270721v1_random:43742-43764 CAGCTGGGGATGGGGGAGAGGGG + Intergenic
1092121212 12:6045222-6045244 CACCTGGGCTTTGGAAAGAAAGG - Intronic
1092285180 12:7124526-7124548 GGGCTGGGCTGGGGGAAGAGTGG + Intronic
1092312468 12:7373481-7373503 CAGCTGGGCTGTGGGGAGAATGG - Exonic
1093036105 12:14333924-14333946 GAGGTGACCTTGGGGAAGAATGG - Intergenic
1094241654 12:28233248-28233270 CACCAGGGGTTGGGGGAGAATGG - Intronic
1095119061 12:38392634-38392656 AAGCTGAGGATGGGGAAGAAAGG + Intergenic
1095925817 12:47578119-47578141 CAGCTGGTCAAGGGGAAGACAGG + Intergenic
1096480574 12:51938083-51938105 CGCCTGGGTTTGGGGGAGAAAGG - Intergenic
1096985027 12:55750542-55750564 GAGCAGGGTTTGGGGAATAAGGG - Exonic
1097156675 12:57016876-57016898 TAGCTGGTCTTGGGGGAGAATGG - Intronic
1097157286 12:57022251-57022273 TAGCTGGCCTTGGGGGAGAATGG - Intronic
1098749647 12:74278080-74278102 CAGGTCTCCTTGGGGAAGAATGG - Intergenic
1099306406 12:80961776-80961798 AGGCTAGTCTTGGGGAAGAATGG + Intronic
1099799748 12:87442443-87442465 CAGCTGGCTTTGGGGAAAAGGGG + Intergenic
1100197812 12:92267430-92267452 CAACTGGGGCTGGAGAAGAAGGG - Intergenic
1100882579 12:99035197-99035219 TGGCTGGCTTTGGGGAAGAAGGG - Intronic
1101403533 12:104408766-104408788 AAGCTAGGCTCAGGGAAGAATGG + Intergenic
1101535492 12:105612681-105612703 CACCTCAGGTTGGGGAAGAAAGG + Intergenic
1101551981 12:105771741-105771763 CAGCCAGGCTTGGGGAGGATGGG + Intergenic
1101716686 12:107318608-107318630 CAGCGGGGCTCAGGGAAGAGCGG + Exonic
1101845853 12:108362479-108362501 CAGTTGGTCTTGGGCAAGAGAGG - Intergenic
1102000758 12:109556807-109556829 CAGGAGAGCTTGGGGAAGCAGGG + Exonic
1102144140 12:110641796-110641818 CAGGTGGGCTGGGGGGAGACTGG + Intronic
1102453502 12:113057502-113057524 GAGCTGGGCTGGGGGACGAGGGG - Intronic
1103086007 12:118061830-118061852 GAGCTGGGCTTAGGGGAAAATGG + Intronic
1103730967 12:123027544-123027566 CATCTGGGGATGGGGATGAATGG + Intronic
1105650243 13:22369533-22369555 TGGCTAGCCTTGGGGAAGAATGG + Intergenic
1105689708 13:22823683-22823705 CGGCTGGCCTTGGAGAAGATGGG + Intergenic
1106131135 13:26940449-26940471 CATCTGGGTTTGGGGTAGAAAGG + Intergenic
1108346570 13:49552233-49552255 CAGCTGGGCCTGGGAAACAATGG - Exonic
1111002572 13:82205167-82205189 CAGCTGTGCTTGGGAAGGCAGGG - Intergenic
1111922205 13:94424250-94424272 CAGCTGATCTTGGGTAAGCAAGG - Intergenic
1112036021 13:95497396-95497418 TGGCTGGGCTTAAGGAAGAAGGG + Intronic
1112669522 13:101618558-101618580 CAGATGACCTTTGGGAAGAATGG + Intronic
1113119354 13:106909778-106909800 CACCAGGGCTAGGGGAAGAAAGG - Intergenic
1113504630 13:110806794-110806816 CAGCTGGCCTTTAGGAAGCAGGG - Intergenic
1113693232 13:112326639-112326661 CAGCGGGGCCTGGGGAGGCAGGG + Intergenic
1113751251 13:112777883-112777905 CATCTGGCGTTGGGGGAGAAAGG - Intronic
1116694907 14:48161244-48161266 CAGAAGGGCTTGGAGAATAAGGG + Intergenic
1118365620 14:65093110-65093132 CAGAAGGGAGTGGGGAAGAATGG + Intronic
1118739723 14:68730938-68730960 AAGATGGGCTTGGGGAGGAAGGG - Intergenic
1119383065 14:74240754-74240776 GAGCTGGGCTCCGGGAAGACTGG - Intronic
1120338839 14:83192867-83192889 GAGCTGGGTTAAGGGAAGAAGGG + Intergenic
1120563024 14:86019686-86019708 GAACAGGGCTTGGGGAAGTAGGG - Intergenic
1122081175 14:99268961-99268983 CAGCTGGGCATGGGGGTGAGGGG - Intronic
1122287733 14:100661864-100661886 CAGCTGGCCCTGAGGAAGGAAGG + Intergenic
1122594369 14:102879027-102879049 GTGATGGGCTTGGGGGAGAATGG + Intronic
1124496044 15:30187824-30187846 CAGATGGGCTTGGGGAAGGGAGG - Intergenic
1124747530 15:32350823-32350845 CAGATGGGCTTGGGGAAGGGAGG + Intergenic
1124779302 15:32615129-32615151 CATCTGGGCTTCCGTAAGAACGG + Intronic
1125750335 15:42023515-42023537 CATCTGGGATAGGGGAAGTAGGG + Intronic
1126210065 15:46092081-46092103 CAGCGCAGCTTGAGGAAGAAGGG - Intergenic
1126235742 15:46382186-46382208 CAGCTGGGCATGGAAAACAATGG - Intergenic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1128793178 15:70447993-70448015 CAGCTGGGCTGCGGGAGGAGAGG + Intergenic
1128985884 15:72220903-72220925 CAGCTGGGCTTAGGGAAGTCTGG + Intronic
1129078798 15:73021472-73021494 CAGCAGGGCCTGCGGAGGAAGGG + Intergenic
1129536295 15:76315970-76315992 CAGCTGGTCTTCTGGAGGAATGG + Intergenic
1131053404 15:89362341-89362363 AAGCGGGGCGTGGGGAGGAAAGG + Intergenic
1131290601 15:91103644-91103666 CAGCTGTCCTTGGTGCAGAAGGG + Intronic
1133447938 16:5878168-5878190 CAGCTGGACATGTGGATGAAGGG + Intergenic
1133690657 16:8211284-8211306 GAGCTGAGCTCGGGGAAGAGAGG + Intergenic
1135175521 16:20224746-20224768 GAACTGGGCTTAGGGATGAAGGG + Intergenic
1135240883 16:20806441-20806463 CAGCTGGACTTGGAAAAGCAAGG - Exonic
1136104354 16:28018860-28018882 CAGCTGGGCTTGGGGATCAAAGG - Intronic
1136153305 16:28366046-28366068 CAGCTGGAGTTGGAGGAGAAGGG - Intergenic
1136209781 16:28749221-28749243 CAGCTGGAGTTGGAGGAGAAGGG + Intergenic
1136613420 16:31380789-31380811 GAGCAGGGCCTGGGGAAGGAGGG + Intronic
1136686038 16:31995539-31995561 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1136786650 16:32939068-32939090 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1136883119 16:33914722-33914744 CTGCTGGGCCTGGGGATGAAAGG - Intergenic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1137866211 16:51899221-51899243 CAGCTGGGCTGTGGGGAGACAGG - Intergenic
1138079474 16:54075986-54076008 CACCTGAGCTAGGGGAAGATGGG - Intronic
1138461046 16:57147794-57147816 CAGCTGGGCTGGAGGAAGTTGGG - Exonic
1139372438 16:66477425-66477447 CAGCTGTGCTTGGTGAGGAGAGG + Intronic
1139512060 16:67433139-67433161 AAGCTGGGGTTGGGGGAGAGAGG + Intronic
1139990040 16:70933163-70933185 CAGCTGGGGATGGGGAAGAAAGG + Intronic
1140230906 16:73116358-73116380 AAGGAGGGCTTGGAGAAGAAAGG + Intergenic
1141847105 16:86618390-86618412 CAGTTGGGGTTGGGGCAGGAAGG - Intergenic
1142026648 16:87817995-87818017 CAGATGTGCCTGGGGGAGAAGGG + Intergenic
1142070081 16:88087058-88087080 CAGCCGGGCTGTGGGAAGATGGG + Intronic
1142178896 16:88657725-88657747 CAGCTGGGCTTGGGTCAGTCTGG - Intronic
1203088887 16_KI270728v1_random:1200738-1200760 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1142528820 17:564898-564920 CAGCTGTGCTGTGTGAAGAATGG + Intronic
1142706418 17:1697758-1697780 CAGTCGGGGTTGGGGAAGGAAGG + Intergenic
1142715603 17:1745403-1745425 CAGGTGGGGCTGGGGAAGAGTGG + Intronic
1142900435 17:3008179-3008201 GGGTTGGGATTGGGGAAGAAAGG + Intronic
1142928398 17:3260877-3260899 CAGCGTGGCTGGGGGAAGAGGGG - Intergenic
1143373777 17:6455684-6455706 CAGCAGCGCAGGGGGAAGAAGGG + Intronic
1143562547 17:7704456-7704478 AAGCGGGGCTGGGAGAAGAAGGG - Intergenic
1143610844 17:8016562-8016584 CAGCTGGGGTTGGGGCTGAGGGG - Intronic
1144284001 17:13755191-13755213 GAGCTAGGCTTGATGAAGAACGG + Intergenic
1144718903 17:17454214-17454236 GAGTTTGGCTTGGGGAGGAAAGG + Intergenic
1146629932 17:34462655-34462677 CAGGTGGGCTGGGGGAGGAGGGG - Intergenic
1147147001 17:38491207-38491229 CTGCTGGGCCTGGGGATGAAAGG + Intronic
1147582676 17:41636088-41636110 CAGCTGGCCTAGGGGAGGATGGG - Intergenic
1147910212 17:43851548-43851570 CAGATGGACTTGGGGAAGTGGGG + Intronic
1148469573 17:47884881-47884903 CAGCTGGGTTTGGTGGAGCAAGG - Intergenic
1148641194 17:49189037-49189059 CAATAGGGCTTGGGGCAGAAGGG + Intergenic
1148712583 17:49692502-49692524 CAGCTGGGTGTGGTGACGAATGG + Intergenic
1148789678 17:50166255-50166277 GAGCTGGGCTCTGGGATGAAGGG + Intronic
1149083034 17:52680798-52680820 CATCTAGGGTTTGGGAAGAATGG + Intergenic
1149780985 17:59396434-59396456 AAGCAGGGGTTGGGGCAGAAGGG + Intronic
1150445228 17:65223454-65223476 CAGCTCTGGTGGGGGAAGAAAGG - Intronic
1151329235 17:73397109-73397131 CAGATGGGCCTGGGGAAGCAGGG + Intronic
1152786925 17:82253156-82253178 CTCATGGGCCTGGGGAAGAAGGG - Exonic
1152931000 17:83109833-83109855 CGGCTGGGCTTGGGGCAAGAGGG - Intergenic
1154148500 18:11886693-11886715 CAGGTGAGCTGGGGGAGGAAAGG - Exonic
1154410477 18:14138615-14138637 AAGCAAGGCTTGGGTAAGAAGGG + Intergenic
1155340089 18:24805155-24805177 CGGCTAGCCTTGGGGGAGAATGG - Intergenic
1155540583 18:26864357-26864379 CACCCGGGCCTGGGCAAGAAAGG - Intronic
1156409003 18:36810152-36810174 CAGGGGTGCTTGGGGCAGAAGGG - Intronic
1158110969 18:53941178-53941200 CAGCTGGTGCTGGAGAAGAATGG + Intergenic
1158561067 18:58514047-58514069 GAGCGGGGCTTGGGGAAAAAAGG + Intronic
1160329426 18:77978145-77978167 AAGCTGGGTGTGGGGAAGTAGGG - Intergenic
1161184504 19:2907428-2907450 TAGCTGGCCTTGGGGATGAGAGG - Intronic
1161307886 19:3577621-3577643 CAGCGGGGCGTGGGGAGGGATGG - Intronic
1161313543 19:3607551-3607573 CAGCTCGGGCTGGGGAAGGAGGG + Intergenic
1161734776 19:5984876-5984898 CAGCTGGGCTTCAGGAAAAGGGG + Intergenic
1161778758 19:6278278-6278300 CTTCTGGGCTTGAGGAAGAGGGG + Intronic
1162152546 19:8656329-8656351 GAGGTGGGCTTCAGGAAGAAGGG - Intergenic
1163038215 19:14583843-14583865 AACCTGGGCTTTGGGTAGAAAGG - Intronic
1163038901 19:14588100-14588122 AACCTGGGCTTTGGGTAGAAAGG - Intronic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1163194164 19:15702961-15702983 CAGCTCTGATGGGGGAAGAAGGG - Intergenic
1163665933 19:18604131-18604153 CAGCTTGGCCTGGGCAGGAAGGG + Intronic
1164254717 19:23517415-23517437 CAGGTGGACTAGGGGTAGAAAGG + Intergenic
1164274242 19:23702740-23702762 CAGGTGGGCTAGAGGAAGAAAGG - Intergenic
1164757598 19:30702068-30702090 CAGCTGGCTTTGTGGAAGAGAGG - Intronic
1164990269 19:32677570-32677592 TAGCTGCTCTTGGGGACGAATGG - Exonic
1165446484 19:35859639-35859661 CAGCTGGCCCTGGGAAAGAGGGG + Intronic
1165648683 19:37467476-37467498 CAGGTGGGGTCGGGGAAGTAGGG - Intronic
1166269819 19:41707083-41707105 CAGCTGAGCCCGGGGAAGGAGGG - Intronic
1167115705 19:47488023-47488045 CAGCTGGTTTTGGGGGTGAAGGG + Exonic
1167312345 19:48744361-48744383 GAACTGGGCTTGGAGAAGTAAGG + Intronic
1167517608 19:49932510-49932532 CAGGTGGGGTTGGGGAAGGTTGG - Exonic
1167557846 19:50206615-50206637 CTGCTGGGCTTGGGGATGGGAGG + Intronic
1168259611 19:55186068-55186090 CAGATGGGCTGGGGGGAGAGTGG + Intronic
925517007 2:4693715-4693737 CTGCTGGTCTTGGGGAATTAGGG + Intergenic
925729732 2:6910644-6910666 CAGGTGGGCTTGAGCAGGAATGG - Intergenic
926198134 2:10775820-10775842 CTGGTGGGCATGAGGAAGAAGGG - Intronic
926489170 2:13502755-13502777 TATCAGGGGTTGGGGAAGAAAGG - Intergenic
928567191 2:32564918-32564940 GAGCTGAGGGTGGGGAAGAAAGG + Intronic
928601432 2:32907615-32907637 CAGGTGGGCCTGGGCAAGATGGG - Intergenic
928640784 2:33296628-33296650 CAGCTGAGCCTGGGAAAGATTGG + Intronic
930774372 2:55158120-55158142 AGGCAGGGCTTGGGGAAGAGAGG + Intergenic
931012241 2:57930018-57930040 CACCTGGGGCTGGGGAAGAGTGG + Intronic
932448561 2:71795379-71795401 CAGCTGAGCTTACGGGAGAAAGG - Intergenic
932518316 2:72378286-72378308 CAGCTGGGATTGGTGGAGCAAGG - Intronic
933747256 2:85580285-85580307 TTGCTGGGCATGGGGAAGAGTGG + Intronic
933747502 2:85581833-85581855 CAGCAGGGCCTCGGGAAGAGGGG - Exonic
933890999 2:86769814-86769836 CCAGTGGGCCTGGGGAAGAAGGG + Intronic
935210365 2:100934747-100934769 CAGCTGTGGTTGGGGGAGATGGG + Intronic
935495883 2:103781321-103781343 GAGCTTGGCTTTAGGAAGAAGGG + Intergenic
935784131 2:106533606-106533628 CAGCTTGGCCTGGAGAAGCAAGG + Intergenic
935836933 2:107064907-107064929 CTACTGAGCTTGGGAAAGAATGG - Intergenic
936397927 2:112143155-112143177 CAGGTGGTCATGGGGAAGGAAGG + Intronic
936917610 2:117655737-117655759 CAGCGGGGGTTGGGGGTGAAAGG + Intergenic
936978631 2:118243340-118243362 CACCTGTGCTTGGGGAAGGCAGG + Intergenic
937336953 2:121068085-121068107 GGGCTGGCCTTGGGGAAGAGGGG - Intergenic
937779873 2:125824898-125824920 CAGCTGGTCATTTGGAAGAAAGG - Intergenic
939529240 2:143336678-143336700 TACCTGGGCCTGGGAAAGAAGGG - Intronic
940378127 2:152980879-152980901 CAAGGGGCCTTGGGGAAGAAAGG + Intergenic
941007577 2:160263353-160263375 GAGCTGGGCTTAGGGTAGCAGGG - Intronic
941979753 2:171441690-171441712 GAGCTGGGATTGGGAAGGAAGGG + Intronic
946137270 2:217657539-217657561 GAGCTGGGCTTGCGGAGGATGGG - Intronic
946372738 2:219290506-219290528 GAGCTGGGGTTGGGGCAGGAAGG + Intronic
947720286 2:232365823-232365845 CAGCTGGGCTGGAGGGGGAAGGG + Intergenic
947737698 2:232465189-232465211 CAGCTGAGGTTGGGGAAGCCAGG + Intergenic
948374834 2:237514538-237514560 TGGCTGGCCTTGGGGAAGAATGG + Intronic
948751063 2:240133532-240133554 CAGGTGGGCTGGGAGAGGAAAGG + Intronic
1168889867 20:1288004-1288026 CAGCTGGGATGGTGGAAGCATGG + Intronic
1170993107 20:21323318-21323340 CATGTGGTCTTGGGGTAGAAAGG + Intronic
1171388014 20:24783162-24783184 CACCTGGGCAGGGGGAAGGAGGG - Intergenic
1172135110 20:32681475-32681497 CAGCTGGCTCTGGGGAAGGAAGG - Intergenic
1172174862 20:32966131-32966153 CAGCTGGGATTGGAAAGGAAAGG + Intergenic
1172909735 20:38399096-38399118 GAGCTGGGCGTGGGAAGGAAAGG + Intergenic
1173078301 20:39841930-39841952 CAGATGTGCTTGGAGAAAAAAGG + Intergenic
1173904162 20:46613755-46613777 CAGCGGGGCTCGGGGCAGAAGGG + Intronic
1174045192 20:47728184-47728206 CAGCTGGACCGAGGGAAGAAGGG + Intronic
1174238569 20:49114618-49114640 CAGCTGCCTGTGGGGAAGAAGGG - Exonic
1174421377 20:50401218-50401240 AAGCTGGGCTCTGGGAAGGATGG + Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1174480250 20:50826214-50826236 AATCTGGCCTTGGGGAAGAAAGG + Intronic
1174716274 20:52762154-52762176 CAAATGGCTTTGGGGAAGAAAGG - Intergenic
1175655224 20:60763985-60764007 CAACTGGGTCTGGGGAAGGAGGG - Intergenic
1175667676 20:60874014-60874036 AAGCTAGGCTTGGAGAAGAGTGG + Intergenic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1175998540 20:62821906-62821928 AAGGTGGGGTTGGGGGAGAAAGG - Intronic
1176030720 20:63009896-63009918 CTGCTGGGATTGGGGAAGGGAGG + Intergenic
1176862588 21:14019798-14019820 AAGCAAGGCTTGGGTAAGAAGGG - Intergenic
1177320010 21:19508918-19508940 CAGCTGGGCTTTGGGATGTTGGG + Intergenic
1179502843 21:41820888-41820910 CAGCTGGGCTAGGGGCAGCAGGG - Intronic
1179596681 21:42447381-42447403 CAGCTGGGCTGGTGGACGATGGG - Exonic
1181282191 22:21727995-21728017 CTGCTGGGCGTGGCGATGAAGGG + Intronic
1181439184 22:22927067-22927089 CTGCTGGGCTTGAGGCAGGAAGG - Intergenic
1181773827 22:25145467-25145489 CATTTGGGATTGGGGAAGACTGG + Intronic
1181910403 22:26233960-26233982 TGGCTGGGCATTGGGAAGAAAGG + Intronic
1182286952 22:29254333-29254355 CAGGAGGGCTTGGGGAAGGCTGG - Intronic
1182342439 22:29634536-29634558 GGGCTGGGCTTTGGCAAGAAGGG - Intronic
1182481999 22:30615180-30615202 CAGGAGGGCTTGGAGAAGAAGGG - Intronic
1183304958 22:37077927-37077949 CTGCTGGGCTGGGGGAACCATGG - Intronic
1183341328 22:37283556-37283578 CATCTGGGGGTGGGGAGGAAGGG - Intronic
1183948443 22:41339733-41339755 CATCAGGACTTGGGGAAGCAAGG - Intronic
1184204124 22:42990251-42990273 CAACTGGCTTTGGGTAAGAAGGG + Intronic
1184272398 22:43392354-43392376 CACGTGGGCTCGAGGAAGAATGG - Intergenic
1184684135 22:46088343-46088365 CAGCTGGCCTTCGATAAGAAAGG - Intronic
1184747824 22:46466239-46466261 CAGCTGGGGTCGGGGAGGGAAGG - Intronic
949573086 3:5312033-5312055 CACTTGGGGTTGGTGAAGAATGG + Intergenic
949644820 3:6081110-6081132 GAACTGGGCTTGAGGTAGAAGGG + Intergenic
950042717 3:9930457-9930479 CAGGTGAGCTGGTGGAAGAAGGG + Exonic
950090307 3:10290201-10290223 CAGGTGGGCCTGGGGGAGAGAGG + Exonic
950612903 3:14137502-14137524 GGGCTGGGCTGGGGGAAGACAGG - Intronic
950719793 3:14874882-14874904 CAGCTGGTCCTGGGGAAGCCAGG + Intronic
950821186 3:15760711-15760733 TAGCTGAGTTTGGGGAAAAAAGG + Intronic
952298503 3:32083367-32083389 CACCTGTCCATGGGGAAGAAGGG + Intergenic
952981493 3:38739546-38739568 GAGCTGGGCGTGGCCAAGAAGGG - Exonic
953377377 3:42440204-42440226 CAGCAGGGATGGGAGAAGAAGGG + Intergenic
953391183 3:42534765-42534787 CAGGAGGGCTGGGGGCAGAAGGG + Intronic
953742307 3:45548185-45548207 CAGCTGGGGTTGGGGAGGACAGG - Exonic
954290578 3:49647861-49647883 CCTCTGGGAGTGGGGAAGAAGGG - Intronic
954488365 3:50876543-50876565 CAGCTGCATTTGGGGAAGAGGGG + Intronic
954628782 3:52037118-52037140 CTGCTGGGCTGGGGGAAGGTGGG + Intergenic
954879187 3:53822456-53822478 CAGCTGGGGTCCTGGAAGAAGGG - Intronic
955882296 3:63560357-63560379 AAGCTGTGATTGGGGAAGTAAGG + Intronic
956693042 3:71895217-71895239 CAGGTGGGATTGGGAGAGAATGG + Intergenic
956731848 3:72203769-72203791 CAGCTGGGTTGGGCCAAGAAAGG - Intergenic
957466742 3:80603463-80603485 CCACTGTGCTTAGGGAAGAAAGG + Intergenic
959502491 3:107122573-107122595 AGGCTGGGCTAGGGGAAGACAGG + Intergenic
960942985 3:122946642-122946664 CAGCTGGGCTGAGGGACCAAAGG + Intronic
961171768 3:124802331-124802353 CAGTTGGGCTTTGGCAAGCAGGG - Intronic
961504715 3:127362493-127362515 CAGCAGTGCTGGGGGCAGAAAGG + Intergenic
962345671 3:134617710-134617732 CAACTGGGCTGGGGGTACAAAGG + Intronic
962367513 3:134796031-134796053 GAGCTGGGCGTTGGGGAGAAAGG + Intronic
962506627 3:136052833-136052855 CAGAAGGGCTTGGGAAAGAATGG - Intronic
964540273 3:157771984-157772006 CAGGCGGAGTTGGGGAAGAAAGG + Intergenic
964843043 3:161015208-161015230 CAGCTGGTTTAGGGGAAGGAAGG - Intronic
965652394 3:170947489-170947511 CAGGTGGGCTTGGGCAAGGCAGG - Intergenic
966680367 3:182635839-182635861 CAGCTGATCTTGGGGAAGGCTGG - Intergenic
967335262 3:188337135-188337157 CAGCTCGGCTTGGGGATGTCGGG + Intronic
968012964 3:195298973-195298995 TAGCTGGGCTATGGGAAGAGGGG - Intronic
968053603 3:195673757-195673779 GAGGTGGGCTTGTGGAGGAATGG + Intergenic
968102210 3:195974605-195974627 GAGGTGGGCTTGTGGAGGAATGG - Intergenic
968701890 4:2061324-2061346 CAGCGGGGCTGGGGGAGGCACGG + Intronic
968970911 4:3793298-3793320 CAGCTGGGCTTGGTGAGGTCTGG + Intergenic
969106508 4:4810771-4810793 CAGCTGGGATTGGGGATGCAAGG + Intergenic
969116396 4:4872986-4873008 CAGCCGGGCTGGGGGAGGCAGGG + Intergenic
969186688 4:5479639-5479661 CAGCAGGGCTTGGGTAACACTGG + Intronic
969365882 4:6694097-6694119 CAGCGGGGGCTGGGGAAGAAGGG + Intronic
969457158 4:7306647-7306669 AAGCTGGTCCTGGGGAAGGAGGG + Intronic
969494141 4:7516281-7516303 CAGCTGGGCGTGGGGAGGGACGG + Intronic
970284664 4:14497060-14497082 CAGATCAGCTTGGGGAGGAAGGG - Intergenic
970806025 4:20033047-20033069 CAACTGCCCTGGGGGAAGAAAGG - Intergenic
971168855 4:24212811-24212833 CAGCTTTCCTTGGGTAAGAATGG - Intergenic
971384230 4:26128145-26128167 CAGCTGGGCCTTGGGAAGGCAGG + Intergenic
971501817 4:27326392-27326414 CATCTGTGTTTGGGGGAGAAAGG + Intergenic
971532537 4:27707107-27707129 TGGTTGGGTTTGGGGAAGAAAGG - Intergenic
972948392 4:44286571-44286593 TAGCTGGGCATGTGGATGAAGGG + Intronic
973650193 4:52991460-52991482 CAACTGGGCTAGGGGGAGGATGG + Intronic
974054569 4:56972482-56972504 CAGATGGCTTTGGGGAACAATGG + Intronic
974448529 4:62018658-62018680 CAGCTGGGATTGGCGTAGGAAGG + Intronic
976118914 4:81758852-81758874 CTGCTGGGTTTGGGACAGAAAGG - Intronic
977302457 4:95282943-95282965 TGGCTGGTCTTGGGGAAGAATGG + Intronic
978567956 4:110104660-110104682 TAACTAGGCTTGGGGAGGAACGG - Intronic
978966661 4:114749519-114749541 GAGCTCTTCTTGGGGAAGAATGG - Intergenic
981041860 4:140230521-140230543 CTATTAGGCTTGGGGAAGAAGGG - Intergenic
981430454 4:144652404-144652426 GAGCTGGGCTGGGAGAACAAAGG - Intronic
981656631 4:147119240-147119262 CAGTTGGGATTGGGAAAGTAGGG + Intergenic
982033164 4:151321172-151321194 TAGCTTGGGTGGGGGAAGAAGGG - Intronic
982169058 4:152643740-152643762 GAGATGGGGTTGGGGAAGGATGG + Intronic
982940253 4:161542576-161542598 CAGCTTGGCTGGTTGAAGAATGG - Exonic
983604082 4:169565793-169565815 CTGCGGGGTTGGGGGAAGAATGG + Intronic
984437172 4:179722093-179722115 TAGCTCGGCCTGGGGAGGAAGGG - Intergenic
985164959 4:187083229-187083251 CAGCTGAGGTTGGGGAAGGTTGG - Intergenic
985699888 5:1364440-1364462 TGGCTGGGCTTGGGGAATAATGG + Intergenic
986208583 5:5648836-5648858 CAGCGGGACTTGGGGCAGAGTGG - Intergenic
987197087 5:15537521-15537543 CTGCAGGGGATGGGGAAGAACGG - Intronic
988158452 5:27486612-27486634 CAGCTGGGCTTGGGAAGCCAGGG - Intergenic
988454241 5:31373208-31373230 CAGCTAGGGTTGGGGAGGGAGGG - Intergenic
988730547 5:33968487-33968509 CAGCCTGGCTTGGTGAGGAAGGG - Intronic
990347686 5:54885554-54885576 CAGCTGGCCTTGTGGATGAATGG - Intergenic
990767594 5:59203839-59203861 GAGCAGGGCCTGGGGGAGAATGG + Intronic
992684820 5:79189043-79189065 TAGCTGGGCATGGTGGAGAAAGG - Intronic
992875369 5:81049229-81049251 TAAATGGGCTTGGGGAATAAAGG - Intronic
993846092 5:92945468-92945490 CAGCTGGGCTTTGGTTAGAAGGG - Intergenic
994094944 5:95839966-95839988 CAACTAGGCTTTGAGAAGAAGGG + Intergenic
995995368 5:118291818-118291840 CAGCTGGGGTTGGGTACCAATGG + Intergenic
996862916 5:128084729-128084751 CACCAGGGGCTGGGGAAGAAGGG - Intronic
997529338 5:134572382-134572404 CGGCTGGGCTCAGGAAAGAACGG + Intronic
998389754 5:141779889-141779911 CAGCTGGGCCTGGGGATGTGAGG - Intergenic
998953064 5:147411388-147411410 CAGCTGGGCTTGGGAGGCAAGGG + Intronic
999377832 5:151099163-151099185 GAAATGGGCTTGGGGCAGAAAGG - Intergenic
999802186 5:155048526-155048548 CAGCTGAGTCTGTGGAAGAAGGG + Intergenic
1000962364 5:167614863-167614885 CTGCTTGCCTTGTGGAAGAATGG - Intronic
1001273541 5:170333532-170333554 GTGCTGGGCTTGGGGAAGCCAGG - Intergenic
1001424024 5:171611878-171611900 CCCCTGGACTTGGAGAAGAAAGG + Intergenic
1001848449 5:174941861-174941883 CAGCTGGGCTGCCTGAAGAAAGG + Intergenic
1002348913 5:178568586-178568608 GAGCTGGGGTTAGGGAGGAAAGG - Intronic
1002520862 5:179792747-179792769 GAGCTGAGCTTGGGGCAGCAAGG + Intronic
1004860856 6:19803573-19803595 CAGCTGGGCCAGGGGATTAAAGG + Intergenic
1004982255 6:21038405-21038427 CAGCAGGGCTGGGGGCAGAAGGG + Intronic
1006143757 6:31946179-31946201 AAGCTGGGCCTGGGGCAGGATGG - Exonic
1006600019 6:35219117-35219139 AAACTGGGGTGGGGGAAGAAAGG - Intronic
1007836111 6:44674948-44674970 CAGCTGAGCTTCGGAGAGAAAGG - Intergenic
1007899957 6:45401794-45401816 CAGCTGGGGTAGGAGAAGAGAGG - Intronic
1008142678 6:47850130-47850152 CATCTGGGCTTGAGCAAGAACGG + Intergenic
1008380756 6:50837529-50837551 CAGGTGGGCTTTGTGAGGAAGGG - Intronic
1011355482 6:86469011-86469033 CAGCTGGGCTTGGGTCCAAAGGG + Intergenic
1011725222 6:90204180-90204202 GAGCTGGGATTTAGGAAGAAAGG + Intronic
1013488049 6:110617179-110617201 CAGCTGGTGTTGGGGAAGTGGGG - Intronic
1013624061 6:111919827-111919849 CAGCTGGTTTGGGGGAAGAAAGG - Intergenic
1014233109 6:118926087-118926109 CAGCTAGGGTTATGGAAGAATGG - Intronic
1014653538 6:124071097-124071119 CAACTGGCCTAGCGGAAGAAAGG + Intronic
1015563775 6:134544346-134544368 GAGATGGGGTTTGGGAAGAATGG - Intergenic
1017597396 6:156044271-156044293 CAGGAGGGCTTCAGGAAGAAAGG - Intergenic
1017737870 6:157380746-157380768 CAGCTGGGGAGGAGGAAGAAGGG + Intergenic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018611792 6:165654355-165654377 GAGCGGGGCCTGGGGAAGCAGGG - Intronic
1018890673 6:167979430-167979452 GAGCTGGGGTGGGGGAAGGAGGG - Intergenic
1019015062 6:168874059-168874081 CCGCTGGGCTTGGAGAAAGAGGG + Intergenic
1019981121 7:4622980-4623002 CAACAGGGACTGGGGAAGAAAGG + Intergenic
1021830398 7:24602025-24602047 CAGATGGGTTTTGGAAAGAAAGG - Intronic
1022400349 7:30030261-30030283 AAGTTGGGGATGGGGAAGAATGG - Intronic
1022539502 7:31122697-31122719 CAGCTTGGCTGGGGGAGGAGTGG - Intergenic
1022838947 7:34144272-34144294 GAGGTGGGCTAGGGGAAGAGGGG + Intronic
1023278429 7:38545308-38545330 AATCTGGGCTTGGGGAATAAGGG + Intronic
1023698286 7:42869796-42869818 CAGATGGAGTTGGGGAAGATGGG - Intergenic
1026915146 7:74115637-74115659 CGGATGGGTTTGGGGAAGGAAGG + Intronic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1028854699 7:95577442-95577464 GAGCTGGGATTGGGGAACTAAGG - Intergenic
1029105041 7:98167992-98168014 CAGCTGTGCTTGGGGAGAAGTGG + Intronic
1029238371 7:99142602-99142624 GGGCGGGGCTAGGGGAAGAAGGG + Intronic
1029508191 7:100975603-100975625 GAGGTGGGATTGGGGCAGAAAGG + Intronic
1029571660 7:101373843-101373865 CAGATGAGCTGGGGGAAGAGGGG - Intronic
1031401201 7:121328187-121328209 CAACTGAGGTTGGGGGAGAAGGG + Intronic
1031468566 7:122143660-122143682 AAGCTGGGCGTGGGGAGGGAAGG + Intronic
1031811835 7:126379456-126379478 CAGATGGGCATGGGTATGAATGG + Intergenic
1031975259 7:128089624-128089646 GGGCTGGGCTTGGTGAAGGAAGG + Exonic
1032070869 7:128805922-128805944 CATCTGGGGTGGGGGCAGAAGGG + Intronic
1032094511 7:128931295-128931317 CCCCTGGGCCTGGGGAAGGATGG - Intergenic
1032112852 7:129091540-129091562 TAGCTTGGCTTGGGGCAGGAGGG + Intergenic
1032324943 7:130918794-130918816 CAGCTCGGCTCAGTGAAGAAGGG - Intergenic
1032424226 7:131807788-131807810 CAGCTGGGCTTATGGAAGGAAGG - Intergenic
1032709965 7:134452800-134452822 CAACAGGCTTTGGGGAAGAAAGG + Intronic
1033360469 7:140635647-140635669 CCCCTGGCCTTGGGGAAGGAAGG - Intronic
1034156510 7:148959954-148959976 CAGCTGAGCCTGTGGAAGACAGG + Intergenic
1034636936 7:152575103-152575125 CAGCTGTGCTTGGGGCTGATCGG + Intergenic
1035047259 7:155975792-155975814 CAGCAGGACTTTAGGAAGAAAGG + Intergenic
1035519922 8:267154-267176 CAGGTGGGCTTTGGGGACAAGGG + Intergenic
1035880756 8:3242277-3242299 TAGCTCGGCCTGGGGAGGAAGGG + Intronic
1036993352 8:13626070-13626092 CAGCTGACATGGGGGAAGAAAGG - Intergenic
1037118252 8:15251941-15251963 CAGTTAGACTTGGGGAAAAATGG - Intergenic
1037256013 8:16954615-16954637 GAGATGGGGTTGGGGAAGAAAGG + Intergenic
1037617579 8:20533511-20533533 CTGCTGTGATGGGGGAAGAAGGG - Intergenic
1037958763 8:23080262-23080284 CAGCTGCGCTTAGGGAAGGCAGG + Intergenic
1037966595 8:23138943-23138965 CAGCTGTGCTTAGGGAAGGCAGG - Intronic
1038172302 8:25147213-25147235 CAGATGGGCCAAGGGAAGAATGG + Intergenic
1038450686 8:27637198-27637220 CAGCTGGCCGTGGGGCAGGAGGG - Intronic
1038563427 8:28599908-28599930 CAGCTGCATTTGGGGTAGAAGGG + Intergenic
1038973090 8:32659701-32659723 CAGCTGGAGTTAGGGAAGACAGG - Intronic
1038976177 8:32698678-32698700 CACCAGTGCTTGGGGAAGAATGG + Intronic
1039242740 8:35574266-35574288 CTGTTGGGATTGGAGAAGAAAGG + Intronic
1040296448 8:46151504-46151526 CACCTGGGTTCTGGGAAGAAAGG + Intergenic
1041079476 8:54202669-54202691 CAGCTGAGCTTGGGGATGTTGGG + Intergenic
1041111264 8:54484998-54485020 AAGCTGGGCTCAGAGAAGAATGG + Intergenic
1045060860 8:98409762-98409784 CAGCTGGGCATGAGTCAGAAGGG - Intronic
1047510806 8:125513772-125513794 CCGCTGAGCTTGGGGGAGCAAGG - Intergenic
1048119406 8:131563221-131563243 CAGCATGGCATGGGGAAGACTGG + Intergenic
1048574350 8:135679281-135679303 CAGCTGGGCTTGGGGATGGGTGG + Intergenic
1048577157 8:135701865-135701887 CAGCTTGGCTTGGGGATGGGTGG + Intergenic
1049358019 8:142198330-142198352 CTGCTGGGCTGGGGCAGGAAGGG + Intergenic
1049415404 8:142492678-142492700 CAGCTGGGCTGGGGAAAGCTGGG + Intronic
1049465173 8:142747955-142747977 CAGATGGCCTTGGGGAAGTCAGG + Intergenic
1049621179 8:143598980-143599002 CAGCTGGGCTTGGGCAGGGCGGG - Exonic
1049769932 8:144375056-144375078 CAGCTGGGCTGGGGCACGAGTGG - Intronic
1049925621 9:404208-404230 CAGCTTGCCTGGGGGAAGCAAGG + Intronic
1050151474 9:2622450-2622472 GAGCCGGGCTTGGGGAACAGCGG + Intronic
1050847433 9:10239893-10239915 CAGCTGGCTTTGGGGAAAAAGGG - Intronic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1053121040 9:35547739-35547761 CAGCAGGGCTTGGGGATGATTGG - Exonic
1054810877 9:69432939-69432961 CAGCTGGGGCTGGGTAAAAAGGG + Intronic
1055797572 9:79992034-79992056 CAGCTGGGCTTGAGGATCCAAGG + Intergenic
1056612440 9:88133710-88133732 CGGCTGGGCTGGGGGCAGAGAGG - Intergenic
1057211218 9:93202099-93202121 CAGGTAGGCTTGGGGAAGTGAGG + Intronic
1057445416 9:95111197-95111219 CAAATGACCTTGGGGAAGAAGGG + Intronic
1058191853 9:101926810-101926832 GAGCTGGGGTAAGGGAAGAATGG - Intergenic
1059431727 9:114254512-114254534 GAGGTGGGCTTGGGGAAGTTGGG + Intronic
1059663554 9:116425025-116425047 AAGCTGTGCTAGAGGAAGAATGG - Intergenic
1060848699 9:126857746-126857768 CAGCTGGACTTCTGGCAGAAAGG + Intergenic
1060976320 9:127767208-127767230 CAGCTCCGCTCTGGGAAGAATGG - Intronic
1061178409 9:129010630-129010652 GGGCTGGGCTCGAGGAAGAAGGG - Intronic
1061746530 9:132744220-132744242 CAGCTGTGATTGGGGACGAAGGG - Intronic
1061961243 9:133990432-133990454 CAGCTGTGGTTTGGGAAGATGGG - Intronic
1062640231 9:137515000-137515022 CAGCAGGGCTGGGGAAGGAAGGG + Intronic
1062644127 9:137538110-137538132 CAGCGTGGCTTGGGGCAGAGTGG - Intronic
1185680702 X:1886575-1886597 CTGCTGGGCTGGGAGGAGAAGGG - Intergenic
1185873239 X:3681789-3681811 TTGCTGGGCTTGAGGAAGAGAGG - Intronic
1186789732 X:12985305-12985327 CAGCTGGACATGGGGAGGAAAGG - Intergenic
1187180941 X:16943322-16943344 AAGGTGGGCTGGGGGACGAAGGG - Intergenic
1187421004 X:19133660-19133682 CTGTTGGGTTTGGGGAAGGAGGG - Intergenic
1187497493 X:19808142-19808164 CAGGTGGGGTGAGGGAAGAAGGG + Intronic
1187701656 X:21969234-21969256 AGCCTGGGCTTGGGGAAGAAGGG - Intronic
1187715155 X:22095416-22095438 CAGCTGGGCTGAGGCAAGACTGG + Intronic
1189972666 X:46434110-46434132 CATCTGGGTGTGGGGACGAATGG - Intergenic
1190708599 X:53049665-53049687 CATTTGGGATTGGGGAAGATGGG - Intronic
1191023678 X:55889892-55889914 CAGCTTTGCTTGGCTAAGAAAGG + Intergenic
1191054569 X:56228943-56228965 AAGCTGGGCTGGGGAATGAAAGG - Intergenic
1192447763 X:71223422-71223444 AAGATGGGCTTGGCAAAGAAAGG + Intronic
1192677532 X:73214316-73214338 CCGCTGGGCTTGGGGAAGAAGGG - Exonic
1192677541 X:73214358-73214380 CTGCTGGGCTTGGAGACGATGGG - Exonic
1193790564 X:85811109-85811131 GAGCTAGGATTGGTGAAGAAGGG - Intergenic
1193868450 X:86766092-86766114 CATCTTGGCTTGGAGAAGAAAGG - Intronic
1197133498 X:123033524-123033546 TAGTTGGGTTTTGGGAAGAAAGG - Intergenic
1197722401 X:129754452-129754474 CACCTGGAGTTGGGGAAGCAGGG - Exonic
1198410777 X:136365281-136365303 GAGCTGGGGTGGGGGAGGAATGG - Intronic
1199587505 X:149431747-149431769 CAGCTGAGCTTGGTGATGATGGG + Intergenic
1200236318 X:154469498-154469520 CAGGTGGCCCTGGGGAGGAATGG - Intronic
1200791063 Y:7299324-7299346 TTGCTGGGCTTGAGGAAGAGAGG + Intergenic