ID: 1175964120

View in Genome Browser
Species Human (GRCh38)
Location 20:62651961-62651983
Sequence AAGGATCTGATGGGGTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175964120 Original CRISPR AAGGATCTGATGGGGTCCCT GGG (reversed) Intronic
901777979 1:11573770-11573792 AAGGAGGTGAGGGGGTCCCCAGG - Intergenic
902076260 1:13789121-13789143 ATGGATGTGATGTGGTTCCTTGG - Intronic
902700905 1:18171283-18171305 TAGGGCCTGATGGGATCCCTGGG + Intronic
904276135 1:29385518-29385540 AAGGTTTTTCTGGGGTCCCTGGG - Intergenic
904333041 1:29777733-29777755 AAGGATGTGCTGGGGTTTCTTGG + Intergenic
904710332 1:32425394-32425416 GAGGCTCAGCTGGGGTCCCTTGG + Intergenic
904799503 1:33082424-33082446 AAGGATAAGATGAGGGCCCTAGG - Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906949389 1:50322245-50322267 AAGGAGCTGATAGGGTCTGTGGG - Intergenic
907912822 1:58841625-58841647 CAGGAGCTGATGGGGTTCCCTGG - Intergenic
909345785 1:74584680-74584702 AAGCATGTGATGGGGTATCTGGG - Intronic
911139412 1:94482651-94482673 GAGGATATGATGGGGTTCCAGGG + Intronic
912711830 1:111955455-111955477 AAGCCTCTCATGGTGTCCCTGGG + Intronic
919096545 1:193043760-193043782 AAGAATCGGAGGGGGTTCCTTGG + Intronic
920659544 1:207903521-207903543 AAGGGTCAAATGGAGTCCCTAGG - Intronic
921128496 1:212198773-212198795 AAGGACAAGCTGGGGTCCCTTGG - Intergenic
922740210 1:228010290-228010312 AGGGTCCTGGTGGGGTCCCTGGG - Intronic
923067041 1:230527492-230527514 CAGGATCTCATGGCTTCCCTTGG + Intergenic
923233503 1:232010459-232010481 AGGTATGTGATGGAGTCCCTGGG + Intronic
1063714689 10:8515021-8515043 AAGGAGCTGATGCGGGCACTGGG + Intergenic
1066663425 10:37759028-37759050 AAGGATCAGATGGACTCCCTTGG + Intergenic
1067294968 10:44970363-44970385 AGAGATCTGATGGGGTGCCCTGG + Intronic
1068512560 10:57984669-57984691 TAAGATCTGATGGGGTCCTTAGG - Intergenic
1075048072 10:119161819-119161841 AAGAATGTGCTGGGGACCCTGGG - Intronic
1077454441 11:2670001-2670023 CAGGAGCTGTTGGGGTCCCGTGG + Intronic
1083301628 11:61742644-61742666 AAGGAAGTGATGAGATCCCTGGG + Intronic
1083737625 11:64690671-64690693 ATGAATCTGATGGGGTCTGTGGG - Intronic
1084861327 11:72020185-72020207 AGAGATCTGATGGGGCCTCTTGG + Intronic
1084898951 11:72295408-72295430 AAGGATGGGATTGGGGCCCTGGG - Intronic
1086871210 11:92039069-92039091 AAGGATGTGATAGGGTTTCTTGG + Intergenic
1090447105 11:126774004-126774026 AAAAAAGTGATGGGGTCCCTGGG + Intronic
1092006960 12:5078010-5078032 GTGGATCTGTTGGGGTCCCCCGG + Intergenic
1095782105 12:46071693-46071715 AAGGAGCAGATGGGGCCCTTTGG + Intergenic
1096521987 12:52189665-52189687 AAGGGTCAGCTGGGGCCCCTTGG + Intronic
1096527004 12:52216052-52216074 ATGGAGGTGATGGGGTCCCCAGG - Intergenic
1100984521 12:100191404-100191426 AAGGAGCTGAGAGGATCCCTAGG - Intergenic
1101930693 12:109011351-109011373 AAGGCTGTGGTGGGTTCCCTTGG + Intronic
1104069793 12:125334497-125334519 AAGGACCTGACAGGGTTCCTTGG + Intronic
1104730900 12:131104774-131104796 CAGGCTCCGATGGGGTGCCTGGG + Intronic
1106733239 13:32563489-32563511 CAGGATCTGCTGGGGACCCAGGG - Intergenic
1111182858 13:84691688-84691710 AAGTATTTGTTGGGGTTCCTGGG + Intergenic
1112125429 13:96461731-96461753 AAGTATCTGGTGGAGTCACTTGG - Intronic
1113463131 13:110495718-110495740 GAGGATCTGATGGGGTCTCTAGG - Intronic
1113630850 13:111882629-111882651 ATGTGTCTGTTGGGGTCCCTGGG - Intergenic
1115893258 14:38056473-38056495 AGGGATCTGAGGGTGCCCCTAGG + Intergenic
1116565975 14:46444614-46444636 AAGGATCTGAGGTGGTTCTTAGG + Intergenic
1117072706 14:52070128-52070150 AAGGACCTCATGGGGGGCCTGGG - Intergenic
1119880891 14:78098644-78098666 AAGGATCTGAAGTGGTGCATAGG + Intergenic
1122244690 14:100394215-100394237 AAGAGTCTGCTGGGGTCACTGGG - Intronic
1124405114 15:29385056-29385078 GGGGATCTGATGGGCCCCCTGGG - Intronic
1126968385 15:54082835-54082857 AAGGCTCTGAATGGGTTCCTTGG + Intronic
1127551549 15:60043610-60043632 AAGGAGCTGCTGGGATTCCTGGG + Intronic
1128378800 15:67096131-67096153 AAGGATATGATGGGGTTCTTTGG - Intronic
1129335584 15:74850421-74850443 AAGACTCAGATGGGGTCCCAGGG + Intronic
1130970884 15:88731359-88731381 AAGGATATGATAGGGTTCGTTGG - Intergenic
1132233504 15:100201783-100201805 AAGGATGTGATGTGGTTTCTCGG + Intronic
1132693919 16:1193802-1193824 GATGAGCTGCTGGGGTCCCTGGG + Intronic
1134618002 16:15666708-15666730 AAGGATCACCTGGGGTCCCAGGG - Intronic
1136170674 16:28487400-28487422 AATGCTCTGATGTGGTTCCTCGG + Intronic
1138600085 16:58048969-58048991 AAGGCTCTGTTGGTGGCCCTGGG - Intergenic
1139268824 16:65663366-65663388 AAAAATCTGCTGGGGTCCATGGG + Intergenic
1141247975 16:82328344-82328366 AAGAATCTGATAGGGTTCCTTGG - Intergenic
1141314266 16:82945882-82945904 AAGGAACTGAGAGTGTCCCTAGG - Intronic
1146520916 17:33524931-33524953 AGGGAGCTGCTGGGCTCCCTAGG - Intronic
1146969627 17:37062212-37062234 GATGATTTGAAGGGGTCCCTGGG - Intergenic
1147483513 17:40789872-40789894 AAGTATATGATAGGGTTCCTTGG - Intergenic
1151382226 17:73733826-73733848 CAGGTTCTGTTTGGGTCCCTTGG - Intergenic
1151384898 17:73748960-73748982 AAGGCCCAGATGAGGTCCCTGGG - Intergenic
1152014911 17:77744276-77744298 AGGGCCCTCATGGGGTCCCTGGG + Intergenic
1152107384 17:78338639-78338661 AGGGCTCTGGTGAGGTCCCTGGG - Intergenic
1153803496 18:8692063-8692085 AAGGATGTGATAGGGTTTCTTGG - Intergenic
1157531174 18:48422127-48422149 AAGGATATGATAGGGTTCCTTGG - Intergenic
1160421612 18:78751434-78751456 AGGGAACTGATGGGGCCCCTGGG + Intergenic
1160785575 19:898925-898947 CAGGACCAGATGGGGTGCCTGGG + Intronic
1161361618 19:3853134-3853156 AAGGACAGGCTGGGGTCCCTGGG + Intronic
1162222142 19:9186664-9186686 AAGGATGTGAAGGGAGCCCTGGG + Exonic
1162227531 19:9236026-9236048 AAGGATGTGAAGGGGGCCCTGGG + Intergenic
1163081038 19:14942368-14942390 AAGGACATGAAGGGGTCACTGGG + Exonic
1163416049 19:17187166-17187188 AAGGGTCTGATGGGGACACAGGG - Intronic
1165467952 19:35986247-35986269 AAGGATGTAATAGGGTCACTGGG - Intergenic
1166157733 19:40927003-40927025 AAGGTTCCAATGGAGTCCCTGGG - Intergenic
1167550668 19:50158424-50158446 AAAGAGGAGATGGGGTCCCTTGG + Intronic
1168538151 19:57189239-57189261 ATGGAGCTGATGGGAGCCCTTGG + Intergenic
925050794 2:813841-813863 AAGGAGCCTATGGGATCCCTGGG + Intergenic
926003855 2:9356350-9356372 CAGGGTCGGGTGGGGTCCCTGGG - Intronic
927271528 2:21215259-21215281 AAGGATATGATTAGGTTCCTTGG + Intergenic
932729021 2:74204664-74204686 GATGATATGGTGGGGTCCCTGGG + Intronic
933533100 2:83535452-83535474 AAGGATCCGGTGAGGTCCCCTGG + Intergenic
933636310 2:84712405-84712427 ATGTTTCTGATGGGATCCCTGGG + Intronic
933823998 2:86141877-86141899 AAGGAGATGATGGAGTCCCAAGG - Exonic
934048270 2:88189753-88189775 TAGGATCTGTTAGGGTCACTGGG + Intergenic
936029926 2:109062831-109062853 AGGGATGTGTTGGGGGCCCTGGG + Intergenic
938092148 2:128441018-128441040 CAGCATCTGATGGGCTCCCCTGG - Intergenic
943367452 2:186979789-186979811 AATGATCTGCAGGGGACCCTGGG + Intergenic
944411493 2:199447489-199447511 AAGGGTTAGATGGGGTTCCTAGG - Intronic
948173667 2:235926821-235926843 AAGGATCTGAGTGGGTTCCGGGG - Intronic
948867629 2:240783650-240783672 AGGGCTCTGTTGGGGTCCCGGGG - Intronic
1169393339 20:5208034-5208056 AAGATTCTGTTGGGGTCCTTTGG + Intergenic
1173838233 20:46139435-46139457 AAGGGTCTGCTGGGGCCACTGGG + Intergenic
1175964120 20:62651961-62651983 AAGGATCTGATGGGGTCCCTGGG - Intronic
1176430000 21:6569667-6569689 AGGGCTGTGCTGGGGTCCCTGGG + Intergenic
1178767477 21:35467950-35467972 AAGGAGATGATGGGGGCCTTGGG - Intronic
1179705394 21:43177129-43177151 AGGGCTGTGCTGGGGTCCCTGGG + Intergenic
951696110 3:25447349-25447371 AAGGATCTGATGGGGGTCAGAGG - Intronic
952955616 3:38555601-38555623 GAGGATCTTCTGGGGTCCCTGGG - Intronic
954147724 3:48642500-48642522 AGGGATGTGATGGGGTGCCTTGG + Intronic
958995978 3:100905436-100905458 AAGGATATGATAGGGTTTCTTGG - Intronic
962976142 3:140447660-140447682 AAGGATCTCATGAGGTCACAAGG - Intronic
966684457 3:182679044-182679066 AATGTTCTGAGGGGGCCCCTAGG - Intergenic
966877875 3:184333836-184333858 ATCGATTGGATGGGGTCCCTGGG + Intronic
972459672 4:39289379-39289401 GAGGATCAGATGAGGTTCCTTGG + Intronic
976079810 4:81343568-81343590 AAGGCTCTGTTTGGGTTCCTCGG + Intergenic
979788939 4:124754059-124754081 AAGGATCTCAGAGGGTCACTGGG - Intergenic
983328887 4:166297927-166297949 AAGCATATGATAGGGTTCCTTGG + Intergenic
983352549 4:166610551-166610573 AATGATCTGATTGGGTGCCATGG + Intergenic
984538302 4:181004320-181004342 AAGGATATGGTGGGGTGCTTAGG + Intergenic
984714327 4:182912788-182912810 AAAGATCTGCTGGGGGCTCTGGG + Intronic
985009723 4:185570097-185570119 AAGGATCTGAGGGTGGCCTTGGG + Intergenic
991092471 5:62706386-62706408 GAGGGTCTGATGGGGCCACTTGG - Intergenic
994320945 5:98393423-98393445 AAGGAGCTGATGCGGGCACTGGG + Intergenic
995030528 5:107475506-107475528 AAGGATCTGGTGAGGATCCTGGG + Intronic
996014051 5:118511365-118511387 AGGGATCTGGTGGATTCCCTAGG - Intergenic
996765718 5:127032092-127032114 AAGGTTCTGATGAGGTCACCAGG + Intergenic
998527967 5:142859843-142859865 AAGGCTATGATAGGGTTCCTGGG + Intronic
1000975022 5:167755171-167755193 AAGGTTGTGATGGAGTCTCTGGG + Intronic
1003025031 6:2547198-2547220 AAAGATCTGATGGGGCTGCTTGG - Intergenic
1003058469 6:2843207-2843229 AAGGATGTGTTGGGGACCCTGGG - Intergenic
1004855229 6:19742967-19742989 AAGGACATGATGGGGTTCCTCGG + Intergenic
1006504456 6:34479278-34479300 AAAGGTCTGAGGGGGTCCTTTGG - Intronic
1007480799 6:42148591-42148613 AAAGACCTGATTGGGTCTCTGGG - Intergenic
1010008546 6:71023993-71024015 AAGGATATGATTGGGTTTCTTGG - Intergenic
1013353689 6:109328826-109328848 CAGGATCTGAGGGTGTTCCTGGG + Intergenic
1014923902 6:127247783-127247805 AAGCATCTGATGGTATCACTTGG + Intergenic
1017208220 6:151826559-151826581 AAGGATCCCATGTGGTGCCTAGG - Intronic
1018367302 6:163134212-163134234 AAGGATATGATAGGGTTCATTGG + Intronic
1018475099 6:164132651-164132673 AAGGGTATGACGGGGTCCCATGG - Intergenic
1018694128 6:166377270-166377292 AAGGAGCTGATGTGGGCACTGGG + Intronic
1018941986 6:168314480-168314502 AAGGAACTTGTGTGGTCCCTGGG - Intronic
1021097079 7:16547212-16547234 CAGGCTCTGGTGGGGTCTCTCGG - Intronic
1021309135 7:19071215-19071237 AAGAATTTGATGGGGTTCCTGGG - Intronic
1022126252 7:27360414-27360436 AAGGATGTGATAGGGTTCCTTGG - Intergenic
1022310051 7:29188654-29188676 CAGGATCTGCTCGGTTCCCTGGG + Intronic
1023017956 7:35984878-35984900 AAGGACATGATGAGGTCACTGGG - Intergenic
1023809648 7:43902023-43902045 AAGGACCTGAGGAGGTCACTGGG + Intronic
1023877357 7:44294210-44294232 GGGCATCTGATGTGGTCCCTTGG - Intronic
1023968384 7:44975275-44975297 AATGTTCAGATGGGGTCCCCAGG - Intronic
1024799288 7:53057678-53057700 TAGGGTCTGATGGGGAGCCTGGG - Intergenic
1028359262 7:89948241-89948263 AAGGAGATGAGGGGATCCCTGGG - Intergenic
1029643860 7:101839111-101839133 AAGGATGAGATGAGGTCACTAGG - Intronic
1029710642 7:102297464-102297486 AAGCATCTGCTGGGGTTCTTGGG + Intronic
1030341518 7:108385990-108386012 CAGGGTGTGATGGGGCCCCTAGG + Intronic
1034957386 7:155343563-155343585 AATGCTCTGATGGGTTCCCAGGG - Intergenic
1035438953 7:158879985-158880007 AAGCATCAGAAGGGGTACCTGGG - Exonic
1038488227 8:27951395-27951417 AAGGTTCTGTTGGGGGCTCTGGG - Intronic
1040511515 8:48100278-48100300 AAGGCCCTGATGTGGTACCTAGG + Intergenic
1040594717 8:48825962-48825984 AGGGTTATGATTGGGTCCCTAGG - Intergenic
1044213431 8:89579089-89579111 AAGGAGCTAATGAGCTCCCTAGG - Intergenic
1045652538 8:104354361-104354383 GAGGATATGATGGGGTCCTAAGG + Intronic
1046198675 8:110893771-110893793 AAGTAACTGTGGGGGTCCCTGGG + Intergenic
1056693201 9:88825457-88825479 ATGGCTCTGCTGGGGTCTCTGGG - Intergenic
1060660653 9:125403306-125403328 ACGCATCTGATGTTGTCCCTGGG + Intergenic
1060788449 9:126468791-126468813 AAGGACATCATGAGGTCCCTGGG - Intronic
1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG + Intronic
1061808921 9:133151341-133151363 AGGGGCTTGATGGGGTCCCTGGG - Intergenic
1061911733 9:133728595-133728617 AGGGCTCTGATGGGGTCTCAGGG - Intronic
1062029128 9:134354126-134354148 ACGGATGGGATGGGGTGCCTGGG + Intronic
1062280878 9:135751110-135751132 CAGAAGCTGATGGCGTCCCTGGG + Intronic
1062357298 9:136170905-136170927 CAGGATCTGCAGGGGTCCCAGGG - Intergenic
1062437149 9:136551367-136551389 CAGGCTCTGCAGGGGTCCCTGGG - Intergenic
1185876345 X:3705326-3705348 TAGGAGGTGATGGGGTCACTAGG - Intronic
1188652393 X:32647501-32647523 AAGGATATGATAGGGTTTCTTGG - Intronic
1189730831 X:44018992-44019014 AAGAATATGATGGGGTTCCTTGG + Intergenic
1191220627 X:57984770-57984792 AAGGAGCTGATGTGGGCACTGGG - Intergenic
1192592255 X:72370052-72370074 AAGGATCTGATGAGGAACCTGGG + Intronic
1193331623 X:80241066-80241088 AAGGTTTTTCTGGGGTCCCTTGG - Intergenic
1200739393 Y:6836937-6836959 AGGGCTCTGATGGGATCCCAGGG - Intergenic