ID: 1175964332

View in Genome Browser
Species Human (GRCh38)
Location 20:62652962-62652984
Sequence GGCTGCATCCTCATTGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175964332 Original CRISPR GGCTGCATCCTCATTGCCAC CGG Intronic
900303292 1:1988781-1988803 GGCTGCTTCCTCCCTCCCACAGG - Intronic
904280599 1:29415629-29415651 GTCACCTTCCTCATTGCCACTGG - Intergenic
904877037 1:33663245-33663267 GGCAGCATCCTCATTTCACCAGG + Intronic
905106838 1:35568512-35568534 TTCTCCAGCCTCATTGCCACTGG - Intergenic
907509979 1:54950725-54950747 GGCTGCGTCCTCAGGGCCAGGGG - Intergenic
907926004 1:58955802-58955824 GGTTGCATCCTCATTGTTTCTGG - Intergenic
910407859 1:86909599-86909621 GGCTACATTCTAATTGGCACGGG + Intronic
912005891 1:104901307-104901329 CACTGCACCCACATTGCCACAGG - Intergenic
912258165 1:108082280-108082302 GGCAGCAGCCACATTGTCACAGG - Intergenic
913705511 1:121418463-121418485 GGCTGCAACCTCCCTGCCTCGGG - Intergenic
914947568 1:152080253-152080275 GGCTGCTTCCCCATTGCTACAGG + Intergenic
915557709 1:156669607-156669629 GCCTGCATCCTCCATCCCACTGG + Exonic
922458523 1:225796753-225796775 CGCTGCAACCTCCTTGCCTCGGG - Intergenic
924120489 1:240792994-240793016 GGCTGAAGCCTCATAGCTACTGG + Intronic
1063191622 10:3700029-3700051 GGCTGGAACCTCATTTACACTGG - Intergenic
1063959870 10:11298202-11298224 GGCAGCATCCCCCTCGCCACAGG - Intronic
1064763955 10:18651849-18651871 GGCTGTTTCCCCATTGCCCCTGG - Intronic
1065057216 10:21858635-21858657 TCCTGCATCCTTATTGCCATGGG - Intronic
1066026417 10:31363495-31363517 GGCTGCTTCCCCATTGCTACAGG + Intronic
1066434850 10:35388005-35388027 GGCTGCTTCCTCCTGGACACTGG - Intronic
1069634206 10:69915551-69915573 CGCTGCATCCTCAATGCGACAGG - Intronic
1070347364 10:75557972-75557994 GGCTACATCCTCTATGCCAAGGG - Intronic
1070537901 10:77393096-77393118 GGCTGCGTCCTCTTTGCAGCTGG - Intronic
1071411509 10:85401495-85401517 AGCTGCAGACTCATTTCCACAGG + Intergenic
1072854882 10:98936282-98936304 GGCTTCATCCCCCTTTCCACAGG + Intronic
1073365996 10:102941539-102941561 GGCTGTTTCCTGAGTGCCACAGG + Intronic
1075602670 10:123781853-123781875 GCCTGCATCCCCACAGCCACAGG + Intronic
1076450961 10:130556703-130556725 GGCTGCATCCTTCCTGCCAGGGG + Intergenic
1077137301 11:1007230-1007252 AGCAACATCCTCCTTGCCACTGG + Intronic
1077806349 11:5594913-5594935 GGCTGCCTCCATATTGCCCCTGG - Intronic
1079330355 11:19527886-19527908 GGCTGCACCCTCAACCCCACAGG - Intronic
1080223049 11:29928766-29928788 TGCTCCATCCCCATTCCCACAGG + Intergenic
1083025037 11:59543431-59543453 AGCTGCAGCCTCAGTGGCACTGG - Intergenic
1084033619 11:66495005-66495027 GGCTGCCTCCTCAGAGCCATTGG - Intronic
1084542701 11:69797441-69797463 GGCTCCATCCTCATGGACAGGGG + Intergenic
1085047495 11:73362218-73362240 GGCTGCAGCCTCGCTGCCACCGG + Exonic
1086423361 11:86659615-86659637 GTCTCCATCCACACTGCCACGGG - Intronic
1092387804 12:8049539-8049561 GGCTGACTCCTGTTTGCCACTGG - Exonic
1099032227 12:77540933-77540955 GGCTGCCTGCTCAGTGTCACTGG + Intergenic
1107548547 13:41455656-41455678 GGCCGGCTCCTCATTGCCACCGG - Intergenic
1109300461 13:60585253-60585275 GGCTGCATCCTGGTTGCCTCGGG + Intergenic
1110626777 13:77662072-77662094 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1113547947 13:111168929-111168951 GTCTGCATCCTCTCTGGCACAGG - Intronic
1118259214 14:64232255-64232277 AACTGCATCCACATTGCCCCAGG + Intronic
1120253683 14:82091159-82091181 GGTTGGACCCTCAATGCCACAGG + Intergenic
1124194391 15:27608395-27608417 GGCTGCATTCTGACTGCCCCAGG - Intergenic
1124490693 15:30153208-30153230 ACCTGCATCCCCAGTGCCACAGG + Intergenic
1124709829 15:31998991-31999013 GAAGGCATGCTCATTGCCACGGG - Intergenic
1124752840 15:32385121-32385143 ACCTGCATCCCCAGTGCCACAGG - Intergenic
1124974580 15:34520820-34520842 ACCTGCATCCCCAATGCCACAGG - Intergenic
1126889875 15:53193046-53193068 GGCTGAGTCCTCATTGTCACAGG - Intergenic
1128717095 15:69916695-69916717 GGCACCATCCTCCTTGCCACAGG + Intergenic
1131266316 15:90917545-90917567 GGCAGTGTCCTCATAGCCACCGG - Intronic
1132185811 15:99800942-99800964 ACCTGCATCCTCAGTGCCACAGG + Intergenic
1132429867 15:101751756-101751778 ACCTGCATCCCCAGTGCCACAGG - Intergenic
1132804656 16:1769868-1769890 GGCTCCATCCTCAGCCCCACGGG - Exonic
1132999490 16:2841819-2841841 GGCTCCAGCGTGATTGCCACTGG - Intergenic
1134137154 16:11684891-11684913 GGCTGCATCCTCCTTGCGGAGGG + Intronic
1134343135 16:13363671-13363693 GGCTGCATCCTGCTTGTCTCTGG - Intergenic
1134472523 16:14539311-14539333 GGCTGCATTCTAACTGCCACAGG + Intronic
1134806763 16:17132470-17132492 GGCTGCATCATAATGGCAACTGG + Intronic
1135552957 16:23412329-23412351 GCCTGCATTGTCATAGCCACTGG - Intronic
1136777389 16:32879191-32879213 GGCTGCCTCCTCAGGGCCAAGGG - Intergenic
1136893236 16:33982322-33982344 GGCTGCCTCCTCAGGGCCAAGGG + Intergenic
1138386951 16:56642449-56642471 GGCTACATCTTCATTTGCACAGG - Intronic
1138829428 16:60359151-60359173 GGCCGCTTCCCCATTGCTACAGG + Exonic
1139641456 16:68294592-68294614 GGCTGCATCCTGCTTTCCTCGGG + Intronic
1140197486 16:72867144-72867166 GGCGGCATCCTCAACCCCACAGG + Intronic
1141944167 16:87298195-87298217 GGCTGCAGCAACATTGTCACTGG + Intronic
1203079802 16_KI270728v1_random:1141300-1141322 GGCTGCCTCCTCAGGGCCAAGGG - Intergenic
1143649358 17:8253969-8253991 GGCTGCCCCCTCATGGCCAGAGG - Exonic
1143949748 17:10623177-10623199 GGCTGCATGCTCTTGGCCATGGG + Intergenic
1144337559 17:14285347-14285369 CTCTTCATCATCATTGCCACTGG - Intergenic
1146469846 17:33115391-33115413 GGCTTCATCCTAAATGCAACAGG - Intronic
1146621854 17:34404863-34404885 GGCTGCATTCTCATGACCTCAGG - Intergenic
1146694696 17:34899638-34899660 TGCTGAATCCTCCTTGCCGCAGG + Intergenic
1148601610 17:48898679-48898701 GGCTGCTTCTTGATTGCCACTGG - Intergenic
1148769457 17:50058489-50058511 GGATGCATCCTCATTACCCATGG + Intronic
1150508102 17:65719861-65719883 GGCTGCATCCTCAGGGCCGTGGG + Intronic
1150808898 17:68340793-68340815 TGTAGTATCCTCATTGCCACAGG + Intronic
1151338522 17:73455316-73455338 GGCTCCATCCTCCTGCCCACAGG + Intronic
1151518947 17:74614879-74614901 GTCTACTCCCTCATTGCCACTGG + Intronic
1153696312 18:7646333-7646355 AGGGGCATCCTCATTGCCTCTGG + Intronic
1159868515 18:73734288-73734310 GGCTGCATTCTAATTGCCACTGG - Intergenic
1163157255 19:15446214-15446236 AGGTGCATCCTCACTCCCACTGG - Intronic
1167486993 19:49768313-49768335 GGCTGCATCCGCATGGGCTCTGG + Intronic
1167748967 19:51368573-51368595 GGCTGCAGCCTCAGTGGCATGGG - Exonic
1168249322 19:55132905-55132927 GGCGGCATCCTCACTTCCAGCGG + Exonic
925160464 2:1680362-1680384 GGCTGCATCTTCCTTCCCACAGG - Exonic
927517336 2:23680057-23680079 CACTGCATCCTCACAGCCACTGG - Intronic
927707345 2:25304642-25304664 GGCTGGATCCTCCTGGCCCCCGG - Intronic
928038942 2:27854300-27854322 GGCTGCATGCAGATTGTCACCGG - Intronic
929077706 2:38092210-38092232 TCCTGGAGCCTCATTGCCACAGG - Intronic
929770384 2:44886886-44886908 GGTTGCTGCCTCATTGTCACAGG + Intergenic
931086244 2:58833747-58833769 GCCTGCATCATCAGTGACACAGG - Intergenic
932063335 2:68528910-68528932 GGCTGCTTCCCCATTGCTACAGG + Intronic
932197277 2:69795746-69795768 GCCAGCATCCTCATGGCCCCAGG - Intronic
932505005 2:72220386-72220408 GGCTGCCTCCTCATGCCCCCTGG + Intronic
933697505 2:85230837-85230859 GGCTGCATACACGTTGCCAGAGG + Intronic
935737101 2:106115046-106115068 TGCTGAATCCTCATTCTCACTGG + Intronic
937908854 2:127065641-127065663 GGCTGCATCCTCATGGAGAGGGG - Intronic
938566178 2:132521078-132521100 GGCTTCGTCCTCATGGTCACAGG + Intronic
938711170 2:133977450-133977472 GGCTGCACCCTCACAGCCACAGG + Intergenic
940295651 2:152121439-152121461 GGCTCCATTCTCATTGCAAATGG - Intronic
943092274 2:183389692-183389714 GGGTGCATGCTCATTGGCTCTGG + Intergenic
943727110 2:191263208-191263230 GGCTGCCTCTTCCTAGCCACAGG + Intronic
946151739 2:217778201-217778223 GGGTGACTCCTCATTACCACTGG - Intergenic
946416291 2:219541641-219541663 CGCTGCATTCTCGATGCCACCGG - Exonic
948145515 2:235705297-235705319 AGCTACATCCTCTGTGCCACTGG + Intronic
948421112 2:237860453-237860475 AGCGGCAGCCTCATGGCCACAGG + Intronic
948577922 2:238965984-238966006 GGCTGCCTCCTCCTGCCCACGGG - Intergenic
948825182 2:240570569-240570591 CGCTGCATCCTCCCTGGCACAGG - Intronic
1169957420 20:11120224-11120246 GGCTGCAGACTTATTGCCTCTGG + Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1171970659 20:31562993-31563015 GGCTGCCACCTTATGGCCACTGG - Intronic
1173552275 20:43940777-43940799 GTCTACATCCTCATGCCCACTGG - Intronic
1175964332 20:62652962-62652984 GGCTGCATCCTCATTGCCACCGG + Intronic
1177517901 21:22178088-22178110 GGCTTCATCCCCCTTTCCACAGG - Intergenic
1178674835 21:34622291-34622313 GGTTTCATCCTCATTGAGACAGG + Intergenic
1179826897 21:43971325-43971347 GGCTGCATGGTCACTGCCAGAGG - Intronic
1180210920 21:46295239-46295261 GACCCCATCCTCATAGCCACAGG + Intronic
1181468362 22:23122879-23122901 GGCAGCACCCTCCTTGCCAGTGG - Intronic
1183545818 22:38454571-38454593 AGCTGCATCCTCGTTGCAAATGG - Intronic
949662115 3:6291637-6291659 GGCTATACCCTCAATGCCACAGG - Intergenic
949943958 3:9175603-9175625 AGCTGCATCCTCATTGCCTGGGG - Intronic
950051635 3:9995581-9995603 GGCTTCATTCTGTTTGCCACTGG - Intronic
950168855 3:10822387-10822409 GGCTCCATCTACTTTGCCACGGG - Intronic
950475321 3:13211200-13211222 GGCTGGATCCTCATTTCTTCAGG - Intergenic
954199349 3:49014918-49014940 GGATCCATCTTCACTGCCACTGG - Exonic
954361735 3:50125842-50125864 GGCCTCCTCCTCACTGCCACAGG - Intergenic
955776271 3:62437170-62437192 GGCTGCACACTCAGAGCCACAGG + Intronic
957553396 3:81735529-81735551 AGCTGCATCCGCATCGCCATGGG - Intronic
959108882 3:102097781-102097803 GGCTGAATCTTGATTGACACAGG + Intergenic
960157071 3:114306979-114307001 GGCTTCATCCTCACTGTCTCTGG - Intronic
961200644 3:125042832-125042854 GGCTGCAGCCACCTTCCCACAGG - Intronic
961788141 3:129359658-129359680 GGCTGGATCCTCATTTCTTCAGG + Intergenic
962947830 3:140187982-140188004 GCTTCCATCCTCATGGCCACAGG + Intronic
965430110 3:168575760-168575782 GGCTTCATCCTCCTGACCACTGG - Intergenic
965656253 3:170988815-170988837 GGCCTCATCACCATTGCCACAGG + Intergenic
965783084 3:172308626-172308648 AGCTGCATTCTCATAGCCAGTGG + Intronic
966688641 3:182722618-182722640 GTCTACATCCTCATGGCCCCAGG - Intergenic
968192247 3:196677150-196677172 GGCTGCTTCCTCATCACCTCTGG - Intronic
977890877 4:102309887-102309909 CTCTCCATCCTCATTGCCAGTGG + Intronic
979723755 4:123935059-123935081 GGCTCCATCCTCATGACCAAAGG + Intergenic
986591125 5:9372198-9372220 TACAGCAACCTCATTGCCACAGG - Intronic
987413752 5:17641228-17641250 GGGGACATCCTCATTGACACTGG - Intergenic
989342631 5:40393272-40393294 GACTGCATCCTGATGGCCACTGG - Intergenic
997367148 5:133333306-133333328 GGCTGCATCGCCATTGCCCGGGG - Intronic
997382024 5:133444971-133444993 GGCTGCCTCCACCTTTCCACAGG - Intronic
997673836 5:135697683-135697705 GCCTGCAACCTGAATGCCACTGG - Intergenic
998455142 5:142266268-142266290 GCCTCCAACCTCAATGCCACGGG - Intergenic
1000331223 5:160207142-160207164 TGCTGCAAACTCATTTCCACTGG - Intronic
1001837195 5:174842416-174842438 GGATGCATCCTCATCGCGATGGG + Intergenic
1002180366 5:177428085-177428107 GGCTGGGTCCTCATTGCCTGGGG + Intronic
1004564421 6:16782047-16782069 GGCTGCTTCCCCCTTCCCACTGG + Intergenic
1005243209 6:23854742-23854764 GGCTGCTTTCCCATTGCTACAGG - Intergenic
1005822561 6:29609545-29609567 GGCAGAATGCTCAGTGCCACTGG + Intronic
1006301472 6:33195627-33195649 GATGGCATCCTCCTTGCCACAGG - Exonic
1006694500 6:35920344-35920366 GGCTGCAGCCACATGGCCTCGGG - Intronic
1006839486 6:37019314-37019336 GACCGCCTCCTCATTGCCAAGGG + Intronic
1007931066 6:45690994-45691016 GGCTTCTGCCTCATAGCCACAGG - Intergenic
1008903249 6:56647403-56647425 GCTTTCATTCTCATTGCCACGGG - Intronic
1009398635 6:63229782-63229804 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1009797821 6:68494916-68494938 GGCTTCATCCTCCTTTCCAGGGG - Intergenic
1009844916 6:69122371-69122393 GGCTGCAGCCTCCCTGCCCCGGG - Intronic
1009896953 6:69763584-69763606 GGCTGCATCCTCATTTCAAAGGG + Intronic
1010761416 6:79727659-79727681 GTCTGGACCCTCATTGCCACTGG + Intergenic
1010953466 6:82064051-82064073 GCCTGCCTCCTCATTCCCAAGGG - Intergenic
1012464480 6:99502215-99502237 GAATGCATCCTCATTCCCTCTGG + Intronic
1019129402 6:169862670-169862692 GGCTGCACCCTCAGCACCACTGG + Intergenic
1022464682 7:30645654-30645676 GGCTGTATCCTCATTGCCTAGGG + Intergenic
1023051779 7:36258802-36258824 GGCTTCAGCCTTATTTCCACGGG + Intronic
1028378090 7:90168297-90168319 GGCTTCAGCCTCCTTTCCACAGG - Intronic
1029147620 7:98458043-98458065 GGCTGCCTCCTCATATACACTGG - Intergenic
1029455650 7:100670063-100670085 GGTTGCATCCTCATTGCCTAGGG + Intergenic
1031971166 7:128066135-128066157 GGCTGCTGCCTCACTGCCTCAGG + Intronic
1034659202 7:152754620-152754642 GTTTGCATCCTCATGGCAACAGG + Intergenic
1034739001 7:153456071-153456093 GGCTGCCTCACCACTGCCACGGG + Intergenic
1035034523 7:155886288-155886310 GGCTGCACCCTCCGTGACACAGG - Intergenic
1035796971 8:2366724-2366746 TGCTGCCTCCTCAGAGCCACCGG - Intergenic
1036436890 8:8743021-8743043 TGCTGAATCCTCATTCTCACTGG - Intergenic
1037430252 8:18804778-18804800 GGCTGCTTCCACATTGCTGCTGG + Exonic
1038373014 8:27011817-27011839 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1039638631 8:39194337-39194359 TGCTGCACCACCATTGCCACTGG - Intronic
1041798785 8:61775272-61775294 GGCTGCATCTTCAGTGGCTCTGG + Intergenic
1041839965 8:62257628-62257650 GTCTGCATCCTCAGTTCCATAGG + Intronic
1046123700 8:109877694-109877716 GGCAGCATCTTCAATGGCACAGG - Intergenic
1048987404 8:139742110-139742132 GGCTGCACCCCCATTCCCAGCGG + Intronic
1049106141 8:140614576-140614598 GGCTGCATTGTCACTGCAACAGG - Intronic
1049412773 8:142480868-142480890 GGCTGCATCCACAGGGCTACAGG - Intronic
1052413329 9:28148518-28148540 AGCTGCTTCCCCATTGCTACAGG - Intronic
1056020279 9:82432578-82432600 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1056576425 9:87858730-87858752 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1057028579 9:91756173-91756195 GGCTTCAGCCTGTTTGCCACTGG - Intronic
1057071618 9:92104733-92104755 AGCTGCTTCCCCATTGCTACAGG - Intronic
1058259794 9:102814525-102814547 GGCTTCATCCACCTTTCCACGGG - Intergenic
1060030360 9:120209721-120209743 AGTTCCAGCCTCATTGCCACAGG + Intergenic
1060205490 9:121680417-121680439 GGCTTCCTCCTCATTGCCCATGG - Intronic
1060900976 9:127258003-127258025 GCCTGTTTCCTCATTGCAACAGG - Intronic
1061060663 9:128248786-128248808 ACCTGCATCCCCAGTGCCACAGG - Intronic
1062702877 9:137917265-137917287 GGCTGGGGCCTCCTTGCCACAGG - Exonic
1185724787 X:2410979-2411001 TGCTGCCTCCTCAGTGCCAAAGG - Intronic
1194957478 X:100197870-100197892 GGCTGCCTCCAGATAGCCACGGG + Intergenic
1195799588 X:108692867-108692889 GGTTGCATGCTCATTGGCATGGG - Exonic
1197819217 X:130529150-130529172 GGCTGCCTTCTCATTTCCAGAGG - Intergenic
1199409874 X:147509129-147509151 TCCTCCATCCCCATTGCCACCGG + Intergenic
1199767968 X:150954207-150954229 GGCTTCCTCCTCATGCCCACTGG - Intergenic
1200102465 X:153694854-153694876 GGCTGCCTCCTCAGGGCCAAGGG + Exonic
1200225747 X:154416464-154416486 TGCTGCAGCCACATTGCAACTGG - Intronic
1201409140 Y:13680976-13680998 GGCTTCAGCCTCCTTACCACGGG - Intergenic
1202021096 Y:20466031-20466053 GCCTGCATCCTCATGGCCCCAGG - Intergenic
1202057353 Y:20848694-20848716 GGCTGCATCCACTTTCCAACCGG + Intergenic