ID: 1175965444

View in Genome Browser
Species Human (GRCh38)
Location 20:62658004-62658026
Sequence CGGCCATGTCGGACGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 33}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175965444_1175965448 -5 Left 1175965444 20:62658004-62658026 CCATGGCCCGTCCGACATGGCCG 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1175965448 20:62658022-62658044 GGCCGAGTTGACCCAGTGCACGG 0: 1
1: 0
2: 0
3: 3
4: 81
1175965444_1175965452 17 Left 1175965444 20:62658004-62658026 CCATGGCCCGTCCGACATGGCCG 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1175965452 20:62658044-62658066 GCCCGCCTGACCCCACTTCTCGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175965444 Original CRISPR CGGCCATGTCGGACGGGCCA TGG (reversed) Intronic
909635363 1:77811764-77811786 CGGCCATGTCGGAGGTGACCCGG - Intronic
912701768 1:111883099-111883121 CGGCCTTGTCTGCCAGGCCAAGG - Intronic
917617909 1:176765182-176765204 AGGCCATGTCTGAAGGGCCTAGG - Intronic
918601950 1:186375022-186375044 CCGCCATGTCGGTGGGGCCAGGG + Exonic
922124837 1:222712300-222712322 CGGCCATGTCGGAGGTGACCCGG - Exonic
924772632 1:247090100-247090122 GGGCCTTCTCGGAGGGGCCATGG - Intergenic
1067053531 10:43038603-43038625 GGGCCATGGAGGACTGGCCAGGG - Intergenic
1103363889 12:120368975-120368997 CGGCCATGTTGGCGGGGCCGGGG + Intronic
1104773570 12:131379588-131379610 CGGCCATGTCGCACGCCTCACGG - Intergenic
1112597422 13:100821112-100821134 GGGCCAGGTGGGAGGGGCCATGG + Intergenic
1121796180 14:96737327-96737349 CGACCATGTGGGACAGGCCTGGG - Intergenic
1132828831 16:1917881-1917903 CGGTCAGGGCGGACGGGCCAGGG + Intronic
1148683651 17:49488575-49488597 AGGCCAGGTTGGCCGGGCCAGGG - Intergenic
1151684964 17:75640889-75640911 CCACCATGACGGACGGGCGATGG + Exonic
1152805256 17:82352597-82352619 AGGCCATGTGGGTTGGGCCACGG + Intergenic
1152903050 17:82956353-82956375 GTGCCATGTCTGAGGGGCCAAGG - Intronic
1153236590 18:2994432-2994454 TGGCCATGGAGGCCGGGCCATGG + Intronic
1154374877 18:13800935-13800957 TGGCCATGCAGGGCGGGCCACGG + Intergenic
1158119177 18:54029389-54029411 CTGCCATGGTGGACGGGGCAAGG - Intergenic
1162395640 19:10416888-10416910 TGGCCATGTCGGCAGGGCCAGGG - Intronic
1163838747 19:19592847-19592869 CGGCCATGAGGGACAGGCCCTGG + Intronic
925123294 2:1436511-1436533 AGGCCATGTCGGGGAGGCCAAGG - Intronic
947731482 2:232433812-232433834 CGGCCATGGAGAACGGGCCATGG + Intergenic
948185949 2:236021441-236021463 CGGCCATGTTGGGCAGGCCTAGG - Intronic
1175965444 20:62658004-62658026 CGGCCATGTCGGACGGGCCATGG - Intronic
1183093642 22:35540154-35540176 CGGCCAGGTCGAGCGCGCCACGG - Intergenic
1185092605 22:48784434-48784456 GGGCCATGTGGGACGTCCCAAGG + Intronic
967846898 3:194051469-194051491 TGGCCATGTGGGAATGGCCATGG - Intergenic
968523232 4:1043906-1043928 CTTCCATGCCGGACGGGCCTGGG + Intergenic
979425769 4:120563656-120563678 AGGCCATGTGGGACAGGGCAGGG - Intergenic
982957587 4:161791959-161791981 CGGCCATCTTGGAAGGGCCCTGG - Intronic
1003519181 6:6843044-6843066 TGGCCATGAAGGAGGGGCCAAGG - Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1018762430 6:166903843-166903865 CGGCCAGGTCAGAGGTGCCAGGG - Intronic
1034386551 7:150745366-150745388 CAGCCATCCCGGACAGGCCATGG - Intronic
1035049146 7:155988505-155988527 AGGCCATGGCCGAGGGGCCAAGG - Intergenic
1035569117 8:660399-660421 CTGCCAGGTTGGAGGGGCCACGG + Intronic
1049156583 8:141070872-141070894 AGGCCATGGCGGAAGAGCCAAGG - Intergenic
1061924536 9:133799500-133799522 AGGCCATGTGGGACCGGCCATGG - Intronic