ID: 1175966963

View in Genome Browser
Species Human (GRCh38)
Location 20:62664627-62664649
Sequence CCACAGGCATAGGCTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175966956_1175966963 12 Left 1175966956 20:62664592-62664614 CCTAATCAGGGACTGCAGCTTTC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1175966963 20:62664627-62664649 CCACAGGCATAGGCTCAGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 196
1175966955_1175966963 13 Left 1175966955 20:62664591-62664613 CCCTAATCAGGGACTGCAGCTTT 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1175966963 20:62664627-62664649 CCACAGGCATAGGCTCAGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175966963 Original CRISPR CCACAGGCATAGGCTCAGCC TGG Intronic
900326836 1:2112407-2112429 CCTCAGGCGGAGGGTCAGCCTGG + Intronic
901018716 1:6245449-6245471 CCACACGCGCAGGCCCAGCCCGG - Exonic
901195642 1:7438476-7438498 CCAAGGGCCTGGGCTCAGCCAGG + Intronic
901470198 1:9450656-9450678 CTACAGGCACAGGCTCAGACAGG - Intergenic
901931651 1:12599752-12599774 CCCCAGTCCTAGGCACAGCCAGG + Intronic
902623776 1:17665081-17665103 GCACGGGCCTAGGCTGAGCCAGG - Intronic
903282459 1:22257746-22257768 CCACATGCAAAGGCAGAGCCTGG - Intergenic
904090222 1:27939915-27939937 CCACATGCATTGGCTCACACCGG - Intronic
906448086 1:45921282-45921304 CCACAGACATAGGCTGGGCACGG - Intronic
906781613 1:48577668-48577690 CAACAGGCAGCAGCTCAGCCGGG + Intronic
907938299 1:59062458-59062480 CCACAGGCATACCCTGAGCTAGG - Intergenic
908488034 1:64614606-64614628 ACACAGGCAGATGCACAGCCGGG - Intronic
912961192 1:114197231-114197253 CCACAGCTAGAGGTTCAGCCAGG + Intergenic
916900562 1:169218115-169218137 CCACCAGCAGAGGCTGAGCCTGG - Intronic
917556553 1:176096344-176096366 CCACAGGCTCAGGCTCAGGATGG + Intronic
918117756 1:181511295-181511317 ACACAGGCAAAAGCACAGCCTGG - Intronic
918142526 1:181731608-181731630 CCACAGGCACAGGCTCAGGGAGG + Intronic
919801653 1:201358043-201358065 CCACAGGGAGGGGCTTAGCCTGG - Intergenic
920388747 1:205585896-205585918 CCACTCCCAGAGGCTCAGCCAGG - Intronic
920805037 1:209224926-209224948 CCACAGGCCTTTGCTCAGGCTGG + Intergenic
922226535 1:223650397-223650419 CCACAGCCGTGGGCCCAGCCTGG - Intronic
923541417 1:234890949-234890971 CCACAGGGACAGACCCAGCCTGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063126955 10:3143945-3143967 CCACTGGCATCGACTCAGCTCGG + Intronic
1063391935 10:5655531-5655553 CCACTGACATAGGGTCACCCGGG - Intronic
1064218638 10:13420862-13420884 CCACAGGGAAAGGTCCAGCCAGG - Intergenic
1065250063 10:23801804-23801826 ACTCAGGCATGGGTTCAGCCTGG + Intronic
1067041192 10:42954111-42954133 CAACACGCACAGGCTCAGCAGGG + Intergenic
1069838779 10:71326429-71326451 CCACAGGCGCAGGCTTAGCCGGG + Intronic
1071507675 10:86242510-86242532 TCACAGGCCCTGGCTCAGCCTGG + Intronic
1073136062 10:101221104-101221126 CCAAAGACAAAGGTTCAGCCCGG + Intergenic
1075980561 10:126735271-126735293 GAACAAGCACAGGCTCAGCCAGG + Intergenic
1076734285 10:132451840-132451862 CCACAGCCAAAGTGTCAGCCAGG - Intergenic
1076763474 10:132617188-132617210 CCACAGGCTGAGGCAGAGCCAGG + Intronic
1077152000 11:1076809-1076831 CCTCAGGCATGGGCGCAGGCGGG + Intergenic
1079236713 11:18696310-18696332 CCACAGCCAGAATCTCAGCCTGG + Intronic
1079336953 11:19578355-19578377 CCACAGTCAGAGGTTAAGCCAGG + Intronic
1081540990 11:44034331-44034353 CCAGAGCAATATGCTCAGCCAGG - Intergenic
1082933947 11:58637568-58637590 CATCAGGCAAAGGCACAGCCAGG + Intergenic
1083870941 11:65488180-65488202 CCACAGGCTCAGTCTCAGCCTGG - Intergenic
1084611577 11:70206499-70206521 CCACAGGCATCTACACAGCCTGG + Exonic
1084662194 11:70552587-70552609 ACACAGGCAGAGGCTGATCCTGG + Intronic
1085277503 11:75309421-75309443 GCACAGGCTTAGGGTCAGGCAGG + Intronic
1089160325 11:116432337-116432359 ACACAGGCATATGCTTGGCCAGG - Intergenic
1089882973 11:121792537-121792559 ATACAGGCATAGCCTTAGCCTGG - Intergenic
1090400435 11:126445261-126445283 CCACAGGCATTGTCTGGGCCAGG - Intronic
1091456822 12:614204-614226 CCACAGGCACCTGCTCAGCTTGG + Intronic
1092038526 12:5362755-5362777 CCACAGGAAGAGCCTCAGCGAGG + Intergenic
1092095818 12:5841100-5841122 ACACAGGCACACGCTGAGCCAGG + Intronic
1092126846 12:6080570-6080592 CCAATGGCATAAGCTCAGGCAGG + Intronic
1099899407 12:88689544-88689566 CCACATACATATGCCCAGCCTGG + Intergenic
1100075531 12:90778259-90778281 CAGCTGGTATAGGCTCAGCCTGG - Intergenic
1100172045 12:91986189-91986211 CCAAAGGCTTAGGAGCAGCCTGG + Exonic
1101745411 12:107537930-107537952 CCCCAGCCATAGGCTCATGCAGG - Intronic
1104015192 12:124957235-124957257 CCACTGGCATGAGCTGAGCCCGG - Intronic
1104047750 12:125174933-125174955 CCAAGGGCATGGGCACAGCCGGG - Intergenic
1104858313 12:131912215-131912237 CCACCGGCATCGGCCCAGCTTGG + Intronic
1105859427 13:24395616-24395638 CCCCAGGCCCAGGCTCAGGCTGG + Intergenic
1112373672 13:98818874-98818896 GCACAGACATAGGCTCATGCAGG - Intronic
1112387965 13:98957936-98957958 GCACAGGCACAGGCACAGGCTGG + Intronic
1113616776 13:111685805-111685827 GCACAGGCACAGGCTCTACCTGG + Intergenic
1113622306 13:111771076-111771098 GCACAGGCACAGGCTCTACCTGG + Intergenic
1113927874 13:113951360-113951382 CCACAAGCAAAGGCCCCGCCCGG - Intergenic
1114652654 14:24296060-24296082 CCACAGGCAAGGGCACTGCCGGG - Intronic
1119621323 14:76134136-76134158 CCACAGGCAGAGGCTGGGCAGGG - Intergenic
1119879933 14:78092007-78092029 CCACATGCCCAGGCTCAGGCAGG + Intergenic
1121323783 14:93007983-93008005 CACCAGGCCCAGGCTCAGCCTGG + Intronic
1122062530 14:99146057-99146079 CCACAGGGACAGGAACAGCCTGG - Intergenic
1122578632 14:102757412-102757434 CCTCAGGCATAGGCTCTGATTGG - Intergenic
1122790436 14:104182043-104182065 GCACAGGGATAGGCCCAGCAGGG + Intergenic
1122996546 14:105268368-105268390 ACTCAGGCCTAGGGTCAGCCGGG + Intronic
1124612824 15:31220240-31220262 CCACAGACACAGGCTGAGCGGGG - Intergenic
1127809106 15:62548046-62548068 CCACAAGCATAGTCTCGGGCTGG - Intronic
1129208394 15:74051042-74051064 GCACAGGCACAGGCTGAGCCTGG + Intergenic
1129786753 15:78314706-78314728 CCAGAGGCCCAGGTTCAGCCAGG - Intergenic
1130062699 15:80581078-80581100 GCACAGGCCTGGGATCAGCCCGG - Intronic
1131408022 15:92182533-92182555 CCACAGGCACAAGCCCAGCTTGG + Intergenic
1131445583 15:92495830-92495852 ACTCAGGCAGAGGCTCAGTCAGG + Intronic
1132381371 15:101368969-101368991 CCACAGGCAGAGGCACAGCACGG + Intronic
1133597805 16:7310008-7310030 CCACGGGCCAACGCTCAGCCCGG - Intronic
1139491539 16:67288646-67288668 TCACAGTCACAGGCTCAGCTTGG - Intronic
1141623823 16:85251108-85251130 CCACAGGCATGCTCACAGCCGGG - Intergenic
1141669731 16:85485481-85485503 CCACAGGCAGAGCCTGAGCAGGG - Intergenic
1141963691 16:87426625-87426647 GCACAAGAAAAGGCTCAGCCAGG + Intronic
1142434092 16:90046386-90046408 CCCCAGGCACAGGCTCTGCGCGG - Intergenic
1146505713 17:33403091-33403113 CCATAAACATATGCTCAGCCTGG + Intronic
1147406152 17:40213787-40213809 CCACACACACAGGCTCAGCGGGG + Intergenic
1150289661 17:63973947-63973969 CCACAGGAATAGGCTCTGGAGGG - Intergenic
1151232582 17:72695325-72695347 CCACATGCATCTGCTCATCCAGG + Intronic
1151933334 17:77246998-77247020 CCACAGGCATCGGAGCGGCCGGG + Intergenic
1151933817 17:77249159-77249181 CCACTGGCCCAGGCTCAGCTTGG + Intergenic
1151939669 17:77284536-77284558 CCACAGGGAGAGGCGCAGCCTGG - Intronic
1152217730 17:79044167-79044189 CCCAAGGCCCAGGCTCAGCCTGG - Intronic
1152759205 17:82099273-82099295 CCACGGGCGGGGGCTCAGCCCGG + Intergenic
1153889196 18:9496807-9496829 CCACAGGCAGAGCAGCAGCCTGG - Intronic
1158538213 18:58327487-58327509 CCAAAGGGAGAGGCTGAGCCAGG + Intronic
1158564577 18:58543805-58543827 CCACAGTCAAAGGCAGAGCCAGG + Intronic
1158856774 18:61550659-61550681 CCAAAGTCAGAGGCACAGCCAGG + Intronic
1159598530 18:70406555-70406577 CCACCTTCATATGCTCAGCCTGG + Intergenic
1160426923 18:78783951-78783973 CCACACGCATAGGCACACACAGG + Intergenic
1160512231 18:79459057-79459079 CCACAGGCGCTGGCTCAGCCGGG + Intronic
1161052885 19:2174269-2174291 CTACAGACAGATGCTCAGCCAGG + Intronic
1161357271 19:3826064-3826086 CCACAGGCTGGGGCTCAGTCTGG - Intronic
1161574091 19:5046338-5046360 CCCCAGGCACAGGCTGAGCTGGG - Intronic
1164908875 19:31989478-31989500 CCACAGGGAAAGGCTAAGTCAGG - Intergenic
1168024008 19:53630520-53630542 ACAAAGGCCTAGGCCCAGCCTGG - Intergenic
1168051054 19:53830256-53830278 CCACAGGGAAAGTCACAGCCAGG - Intergenic
1168413922 19:56157056-56157078 CCACAGGCAGAGGCTGGGCAGGG - Intronic
925036375 2:690018-690040 CCACGGGGACAGCCTCAGCCAGG - Intergenic
925804632 2:7636109-7636131 CAAGAGGCATAGGCTGAGGCAGG + Intergenic
926913334 2:17871619-17871641 ATCCAGGCACAGGCTCAGCCAGG - Intergenic
926922950 2:17957575-17957597 CCCCAAGCATAGGCAGAGCCCGG - Intronic
934067243 2:88351178-88351200 CCACAGCCGCAGGCCCAGCCAGG - Intergenic
934565507 2:95338093-95338115 CCCGAGGCATCGGCACAGCCAGG + Intronic
935750848 2:106232642-106232664 GCACAGGCACTGGCTGAGCCTGG - Intergenic
936153483 2:110033970-110033992 CCCCAGGCAGTGGCTCTGCCCGG - Intergenic
936191198 2:110337445-110337467 CCCCAGGCAGTGGCTCTGCCCGG + Intergenic
940653529 2:156461082-156461104 CTATAGGCACAGGCACAGCCAGG - Intronic
945314860 2:208360475-208360497 GCACAAGCACAGTCTCAGCCGGG - Intronic
946116619 2:217468334-217468356 CCAAAGGCAGAGGCTAAGTCTGG + Intronic
946198636 2:218056498-218056520 CCACAGGGATGGGCTCATCCTGG + Intronic
946868967 2:224068759-224068781 CCACAGGCATAGCCTTTGCCAGG + Intergenic
947625791 2:231617662-231617684 ACACAGGCAGAGGCTCAGCTGGG + Intergenic
948301927 2:236914073-236914095 CACCAGGCACAGGCTCACCCAGG + Intergenic
948563446 2:238868626-238868648 CCACAGACACAGTCACAGCCAGG - Intronic
1169195348 20:3679701-3679723 CAACACGCGTGGGCTCAGCCTGG + Intronic
1170138742 20:13104021-13104043 GAACAGGCACAGGCTCAGGCTGG + Intronic
1172579224 20:36033705-36033727 CCACAGTCAGATGCTCAGCAAGG - Intergenic
1175265179 20:57698639-57698661 CTACAGACATCAGCTCAGCCCGG + Intronic
1175789273 20:61731409-61731431 CCACAGGGGTATGCTCAGTCAGG + Intronic
1175966963 20:62664627-62664649 CCACAGGCATAGGCTCAGCCTGG + Intronic
1179408042 21:41141346-41141368 CCACAGGCAGAGGCTGTGCAAGG + Intergenic
1180091055 21:45534017-45534039 CCACAGCCTTTGGGTCAGCCTGG - Intronic
1180699321 22:17773176-17773198 CCGCAGGCAGAGGCTTGGCCAGG + Intronic
1181047222 22:20220844-20220866 TGACAGGCAGAGGCACAGCCAGG - Intergenic
1182024670 22:27108813-27108835 CCACAAGCATAGTCTCCGCCAGG + Intergenic
1182661443 22:31928028-31928050 CCATAGCCCTAGTCTCAGCCAGG + Intergenic
1183284399 22:36953145-36953167 CCACAGGCAGAAGCTCACCCTGG - Intergenic
1183743896 22:39682507-39682529 CCACACGCATGGGCTCAGGTGGG - Exonic
1184648396 22:45908338-45908360 CCACAGGCAGAGCAGCAGCCAGG + Intergenic
1184651441 22:45921050-45921072 CCAAGGGCCTGGGCTCAGCCTGG - Exonic
950407884 3:12815977-12815999 GCACAGGCATATGCTCGGCCAGG - Exonic
950530771 3:13551177-13551199 CCTCAAGCATAGGCCCAGGCTGG + Intronic
952373713 3:32747657-32747679 CCACAGGCATGGGCTGGGCTCGG + Intronic
953413537 3:42702891-42702913 CCAGTAGCATAGGCTCAGACAGG + Intronic
953711250 3:45273021-45273043 GAACAGGAATAGCCTCAGCCAGG + Intergenic
954174297 3:48831570-48831592 CCAGAGGCCTAGGACCAGCCTGG - Intronic
954815241 3:53275093-53275115 CCCATGGCATAGGCTCAGCATGG + Intergenic
958554408 3:95655829-95655851 CCACAGCCATAGCCTATGCCTGG + Intergenic
962814384 3:138985162-138985184 TCACTGGCCTGGGCTCAGCCAGG + Intergenic
963074962 3:141337385-141337407 CCACAGGCAACGCCTCATCCAGG - Intronic
963506823 3:146196651-146196673 CCACAGCCATAGGTTGAGCATGG + Exonic
966706409 3:182920728-182920750 CAGCAGGCGTAGGCTCACCCTGG + Exonic
967359026 3:188609289-188609311 CCACAGGGATGGGTCCAGCCTGG - Exonic
968272999 3:197419052-197419074 GCACAGGCACAGGCTCAGCTTGG + Intergenic
968605113 4:1531784-1531806 CCCCAAGGATAGGCTCGGCCTGG + Intergenic
969050755 4:4371165-4371187 CAACTGGCATCGGCTCAGACAGG - Intronic
969428067 4:7137568-7137590 CCACTGGCAGAGACGCAGCCCGG - Intergenic
972075254 4:35079245-35079267 CCCCAGGCTTAGGCTCTCCCTGG - Intergenic
973973419 4:56238484-56238506 CCACAGTCACAGGCCCACCCAGG + Intronic
977430349 4:96924716-96924738 GCACAGGCATAGGCACAGGTAGG + Intergenic
979395191 4:120178875-120178897 ACACAAGCATCGGCTCATCCAGG + Intergenic
984946813 4:184975286-184975308 CCACAGGGCATGGCTCAGCCAGG + Intergenic
985318209 4:188680926-188680948 CAACAGGCACAGGCTCAGTGAGG - Intergenic
986441141 5:7782858-7782880 CCGCAGTCATAGGCTCAGAGAGG + Intronic
987079886 5:14417132-14417154 TCAAAGGCAGAGGCCCAGCCTGG - Intronic
987212045 5:15693335-15693357 CCACAGGCACAAGCTCCCCCGGG + Intronic
988961761 5:36378095-36378117 CCCAAGTCACAGGCTCAGCCTGG - Intergenic
991676328 5:69092968-69092990 CCACAGGCATATGCCACGCCTGG + Intergenic
992507820 5:77405618-77405640 CTGAAGGCATAGTCTCAGCCAGG + Intronic
993903167 5:93597705-93597727 CCACAGGCTTCCACTCAGCCTGG - Intergenic
997059734 5:130487452-130487474 CCACTGGCATTGCCTCTGCCAGG - Intergenic
997568097 5:134904967-134904989 CCGCGGGCACAGGCGCAGCCCGG - Intronic
1001424801 5:171616131-171616153 CCCCAGGCAGGGGCTGAGCCTGG + Intergenic
1002662051 5:180797835-180797857 CCACCTCCTTAGGCTCAGCCTGG + Intronic
1003938606 6:11001681-11001703 CCACAGGAATGGGGACAGCCCGG - Intronic
1006449580 6:34098491-34098513 CCACCAGCCTAGGCCCAGCCAGG + Intronic
1007112975 6:39324124-39324146 CCACAGTCCCAGCCTCAGCCTGG + Intergenic
1007292197 6:40796488-40796510 CCACTGGGATAGACTCAGCTGGG + Intergenic
1007620843 6:43213583-43213605 CCAGCAGCAGAGGCTCAGCCCGG - Intronic
1009723927 6:67511345-67511367 TCACAGGAACAGACTCAGCCAGG - Intergenic
1015755382 6:136600841-136600863 CCAAAGGAATAAGCCCAGCCAGG + Intronic
1018089314 6:160331933-160331955 CCTCAGGCATAGGCACAAGCAGG - Intergenic
1019192884 6:170263713-170263735 CCACAGGCAGAGACTCAGGTTGG + Intergenic
1020118197 7:5488037-5488059 CCTCAGGCACAAGCTGAGCCCGG - Intronic
1020947982 7:14639533-14639555 CCACAGAAATAGGCTGTGCCAGG + Intronic
1022603182 7:31781249-31781271 CAGCAGGCATAGGCTTGGCCAGG - Intronic
1027198485 7:76047783-76047805 CCCCAGGCAGAGGCTCCGACAGG - Exonic
1033472608 7:141663488-141663510 GCACAGCCATAGTCTCATCCAGG - Intronic
1034432842 7:151049653-151049675 CCTCAGGCCTAGGGCCAGCCGGG - Intronic
1034450988 7:151137218-151137240 CAGCAGGCAGAGGCCCAGCCAGG - Intronic
1034997812 7:155589451-155589473 CCAGAGGCACAAGCACAGCCAGG + Intergenic
1035414538 7:158672146-158672168 CCACAGGCCAAGGCTCAGTCTGG + Intronic
1036234457 8:7026262-7026284 ACACAGGCAGAGCCTCAGTCTGG + Intergenic
1036568690 8:9960519-9960541 CCACAGGGTTATGTTCAGCCAGG - Intergenic
1040098962 8:43480242-43480264 CCAAAGGCATTGCCTCAGCCAGG + Intergenic
1047294357 8:123558073-123558095 CCACAGGGATAGGCACACACTGG - Intergenic
1048553375 8:135454518-135454540 CCACAGCCAACGGCTCAGCCAGG + Intergenic
1048599076 8:135899770-135899792 CCACAGGCAGGTCCTCAGCCTGG - Intergenic
1049196485 8:141318460-141318482 CAACAGGGTCAGGCTCAGCCGGG + Intergenic
1049709970 8:144059061-144059083 CCTCAGGCATGGGCACGGCCTGG + Exonic
1049799405 8:144510800-144510822 CTGCAGACATAGGCTCAGCAAGG - Exonic
1050650122 9:7766963-7766985 ACACAGACATAGCTTCAGCCTGG + Intergenic
1052252310 9:26412700-26412722 CCACAGGCCTGAGTTCAGCCTGG + Intergenic
1052999605 9:34570581-34570603 CCACAGCCAGATGCTCAGTCAGG + Intronic
1053431268 9:38043273-38043295 CCCCAGGCATAGGCACAGTGGGG - Intronic
1059656810 9:116365106-116365128 CCTCAGGGAAGGGCTCAGCCTGG - Intronic
1060655128 9:125366875-125366897 CCACAGGCCTGAGCTCAGCAAGG + Intronic
1061161275 9:128895795-128895817 CCACAGGCGAAGGCTCAGCGGGG - Intronic
1061747911 9:132753586-132753608 CCCCTGGCACAGGCTCAGGCTGG + Intronic
1062158609 9:135067596-135067618 CCACAGGCCTAGGAACACCCAGG + Intergenic
1062358420 9:136176004-136176026 CCAGAGCCACAGGCTCAGCCGGG + Intergenic
1062424382 9:136499265-136499287 CAACAGGGAGAGGCTCAGGCGGG + Intronic
1062673088 9:137723176-137723198 CCACAGACACAGGCACACCCCGG - Intronic
1062673109 9:137723250-137723272 CCACAGACACAGGCACACCCCGG - Intronic
1190115277 X:47622227-47622249 CCCCAGGAAGAGGCGCAGCCTGG - Intergenic
1195610626 X:106863126-106863148 ACACATGCATTGGCTCAGGCTGG + Intronic