ID: 1175967005

View in Genome Browser
Species Human (GRCh38)
Location 20:62664786-62664808
Sequence GGTCAGAGTGGGCCAGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175967005 Original CRISPR GGTCAGAGTGGGCCAGACCC AGG (reversed) Intronic
900148039 1:1166862-1166884 GGTCGGAGTGGGGCTGACACGGG - Intergenic
900389125 1:2426503-2426525 GGTCAGAGTGGCGGAGTCCCCGG + Intronic
901657405 1:10777326-10777348 GGTCAGAGGTGGCCTGGCCCAGG - Intronic
902360929 1:15942271-15942293 AGTCAGAGTGGGAAGGACCCCGG + Intronic
902411167 1:16212386-16212408 GGCCATAGTGGGTCAGAGCCAGG + Intronic
902761507 1:18583807-18583829 GGCCAGAGTGGGTCAGCCCAGGG - Intergenic
903034935 1:20486912-20486934 GGGCAGAGGGCGGCAGACCCGGG - Intergenic
903653448 1:24934682-24934704 GGCTAGAGAGGGCCAGACCCGGG + Intronic
904376380 1:30085017-30085039 CGTCAGAGGGGTCCAGAGCCAGG + Intergenic
905794880 1:40810140-40810162 AACCAGAGAGGGCCAGACCCAGG - Intronic
906212658 1:44020806-44020828 CGTCAGGGTGGGGCAGCCCCTGG + Intronic
906517998 1:46450840-46450862 GGCCACAGTGGGCCAGGCCAGGG + Intergenic
907336487 1:53702995-53703017 CTTCAAAGTCGGCCAGACCCAGG + Intronic
915596337 1:156898377-156898399 GGCCAGAGTGCGCCAGAGGCTGG - Intronic
917232999 1:172857971-172857993 GGTGAGAGAGGACCAGAGCCAGG - Intergenic
918080937 1:181207157-181207179 GCTCAGAATGGCCCAGGCCCAGG - Intergenic
920204353 1:204280963-204280985 GGTCAAAGAGGGTCAGGCCCTGG + Intronic
920675319 1:208034231-208034253 AGTCGGAGTGGCCCAGAACCAGG - Intronic
920959193 1:210649405-210649427 GGCCTGAGTGGGTCAGACCAAGG + Intronic
924032423 1:239899905-239899927 GGTCAGATAGGGGCAGACCAGGG - Intronic
924088492 1:240478777-240478799 GGTCAGTGTGTGCCAGAAACTGG + Intergenic
1063364243 10:5480205-5480227 GCCCAGAGTGGCCCTGACCCAGG + Intergenic
1065960213 10:30727877-30727899 GGTCAGAAATGGCCAGGCCCAGG + Intergenic
1067848089 10:49738737-49738759 GGTGAGGGTGGGCGAGGCCCAGG - Intronic
1069905575 10:71730392-71730414 GGCCACAGTGGGCCAAGCCCTGG + Intronic
1070154680 10:73826062-73826084 GGACAGAGTAGGCCACACACAGG + Intronic
1071731055 10:88248999-88249021 GATCAGAGGGGACCAGGCCCAGG - Intergenic
1073344970 10:102776169-102776191 GGTGGGGGTGGGCCAGAGCCAGG + Intronic
1073771380 10:106739158-106739180 GGGAAGAGTGGGCCAAACTCTGG - Intronic
1074080293 10:110163088-110163110 GGCCAGAGTTGGCCAGAGCCGGG - Intergenic
1074491851 10:113945632-113945654 GGTCAGAGGGGAGCAGGCCCTGG - Intergenic
1074787792 10:116856635-116856657 GGTCAGAGGGTGCCATCCCCTGG - Exonic
1076869976 10:133188434-133188456 GGGCTGAGTGGGCCTCACCCTGG + Intronic
1077324227 11:1956805-1956827 GGCCAGAGAGGGCCACACACAGG + Intronic
1078532580 11:12148521-12148543 GGTCAGAGCTGGCCAGGTCCTGG + Intronic
1079124187 11:17707430-17707452 GCTCAGAGTGGGCTTGTCCCAGG - Intergenic
1080240924 11:30126313-30126335 GATCAGAGTGGGCCAGGACTAGG + Intergenic
1081541553 11:44038278-44038300 GGACAGAGTAGCCCAGACGCTGG + Intergenic
1081673013 11:44951924-44951946 GGTCACAGTGGGCCAGGAACCGG + Intergenic
1083292590 11:61698192-61698214 GGTCAGACTGGGCCAGCCAGAGG + Intronic
1083311717 11:61787191-61787213 GCTCAGAGTGGGCCAGAGCAGGG + Exonic
1083315191 11:61810647-61810669 TGTCAGTGTGGGCAAGACACTGG - Intronic
1083836287 11:65270673-65270695 GGTGAGAGGTGGCCAGATCCTGG - Intronic
1084175343 11:67419838-67419860 GGTGAGCGTGGCCCAGGCCCAGG + Exonic
1084180025 11:67441572-67441594 GGGCAGAGTGGGCCTCAGCCTGG - Intronic
1084268100 11:68015205-68015227 GGTCAGGGGTGCCCAGACCCTGG + Intronic
1085042218 11:73333304-73333326 GGTCAGCCTGAGCCAAACCCAGG - Intronic
1085694730 11:78694505-78694527 TGGCAGAGTGGGCCAGATCTTGG - Intronic
1089561687 11:119346325-119346347 GGGCAGGGTGGCCCAGACTCAGG + Exonic
1090279727 11:125445455-125445477 GGTCAGAGTGGGTGAGACGGGGG - Intergenic
1090614842 11:128505564-128505586 GGTCCGTGTGGGCGAGACTCTGG - Intronic
1202807213 11_KI270721v1_random:12000-12022 GGCCAGAGAGGGCCACACACAGG + Intergenic
1095048268 12:37533915-37533937 AGTCAGACTGAGCCAGACCTAGG - Intergenic
1096676183 12:53227386-53227408 GGTCAGGCTGGCCCAGGCCCCGG + Exonic
1099846108 12:88030833-88030855 GGTCAGAGTGCCCAAGACCATGG - Intronic
1101559068 12:105838636-105838658 GGACAGAGAGGGTCAGGCCCAGG - Intergenic
1101962377 12:109259656-109259678 GGTCAGGGAGGGGCAGCCCCAGG + Intronic
1103238738 12:119396588-119396610 GATCAAATTGGGCCAGACACAGG + Intronic
1103567911 12:121826336-121826358 AGTCAGAGAGGGTCAGACCCAGG + Intronic
1103704233 12:122862650-122862672 GGCTAGAGTGGGCTAGGCCCTGG + Exonic
1104725077 12:131070929-131070951 GGTCAGAGTGGGCCTGAGAAGGG + Intronic
1105608466 13:21946937-21946959 GTTCAGAGTGACCCAGAACCGGG + Intergenic
1105694303 13:22872723-22872745 GGTCACAGTGGCCCTGGCCCTGG - Intergenic
1106228075 13:27799986-27800008 GGTCAGAGTGGGCATGAGTCTGG + Intergenic
1106285628 13:28316225-28316247 GGTAAGGGTAGGTCAGACCCAGG - Intronic
1106411976 13:29516968-29516990 GCACAGAGAGGACCAGACCCTGG - Intronic
1106419874 13:29577311-29577333 GGTCAGGGTTAGCCAGAGCCAGG + Intronic
1108492459 13:50994855-50994877 TGTCTGTCTGGGCCAGACCCTGG + Intergenic
1112186570 13:97133606-97133628 GGACACTGTAGGCCAGACCCTGG + Intergenic
1113806966 13:113115597-113115619 GGTCAGCGAGAGCCAGCCCCCGG - Intronic
1114651181 14:24285434-24285456 GGCCAGAGTGGGCCTGAGACTGG + Intergenic
1115290139 14:31761474-31761496 GGTGAGAGTGGGCAAGGCCAGGG - Intronic
1118770623 14:68940365-68940387 GGCCAGAGTCTGCCAGACCCCGG - Intronic
1121025879 14:90615932-90615954 GGCCAGAGTGGGGAGGACCCTGG - Intronic
1121639543 14:95475908-95475930 GGTGGGAGTGGGCCTGTCCCAGG - Intergenic
1121648832 14:95540519-95540541 GGGCAGAGTGGGCAAGGCACAGG - Intronic
1121949214 14:98155755-98155777 CCTCATAGTGGGTCAGACCCGGG + Intergenic
1122263307 14:100535269-100535291 GATCTGGGGGGGCCAGACCCAGG - Intergenic
1122268369 14:100557152-100557174 AGTCAGGGCGGGCCAAACCCAGG + Intronic
1122480501 14:102044220-102044242 GGTCAGAGGCGGGCAGGCCCGGG - Intronic
1122856442 14:104562481-104562503 GCTCAGAGTGGGCTAGAATCCGG + Intronic
1124899288 15:33807619-33807641 GTGCAGAGGGGGCCAGAGCCCGG - Intronic
1127627706 15:60796360-60796382 GGTCAGGCTGGGCCAGCCCATGG + Intronic
1128560912 15:68667164-68667186 GGGCAGAGTGGGCCAAGCCATGG - Intronic
1130353348 15:83109639-83109661 GGTCAGAAAGGGCCAGTGCCAGG - Intronic
1131260538 15:90885207-90885229 GGACAGTGGGGGCCAGAGCCGGG + Exonic
1132498880 16:276002-276024 GGCCAGAGTCGCCCAGGCCCCGG + Intronic
1132581456 16:686552-686574 CTCCAGGGTGGGCCAGACCCAGG - Intronic
1132759787 16:1503028-1503050 GGGCAGCTTGGGCCAGACCAGGG - Intronic
1133316451 16:4887428-4887450 AGTCAGTGTGGCCAAGACCCTGG - Intronic
1134841378 16:17404644-17404666 AGTCAGAGTTGGCCAGGCACAGG + Intronic
1134849331 16:17468177-17468199 AGTCAGAGTAGGACAGACCCCGG + Intronic
1136382366 16:29901476-29901498 GCTCAGGGTGGCCCAGGCCCTGG + Exonic
1137576767 16:49605098-49605120 GGACCCAGTGGCCCAGACCCAGG - Intronic
1137716471 16:50601390-50601412 GGTTAGGGTGGGCCTGCCCCAGG + Intronic
1138430716 16:56966900-56966922 AGTCAGACTGGGCCAGGCCGTGG - Intronic
1138521212 16:57572052-57572074 GGGCAGAGTGAGGAAGACCCAGG - Intronic
1140249832 16:73286484-73286506 GGGAAGAGTGTTCCAGACCCCGG + Intergenic
1140626091 16:76796037-76796059 GGTCAGTGTTAGCCAGAACCGGG - Intergenic
1140644147 16:77011497-77011519 ACTCAGAGTGGGTCAGACACGGG - Intergenic
1140869077 16:79090208-79090230 GGTCTGAGTGGGCCAGGGTCGGG + Intronic
1141759099 16:86015562-86015584 GTTCACAGTGGGCCAGACTGTGG - Intergenic
1141992843 16:87620347-87620369 GGCCAGAGCGGGCCAGAGCGGGG + Intronic
1142214977 16:88825661-88825683 GGCAAGGCTGGGCCAGACCCTGG + Intronic
1142668018 17:1473491-1473513 GGGCACAGTGAGCCACACCCTGG + Intronic
1143123859 17:4628220-4628242 AGTCTGATTGGGCCAAACCCTGG - Intergenic
1143426286 17:6841669-6841691 AGTCTGATTGGGCCAAACCCTGG + Intergenic
1144673292 17:17145124-17145146 GGTCAGTCTTGGCCAGACCTAGG + Intronic
1144789022 17:17847346-17847368 GGGCAGAGTGGCCCAGCCCCAGG - Exonic
1144849158 17:18235387-18235409 GGTCAGAATGTGCCATACTCGGG + Intronic
1145058830 17:19719779-19719801 GGCCAGCCTGGGCCAGTCCCCGG - Intergenic
1145251469 17:21299024-21299046 GGTCAGAGAGGGTCAGGCTCTGG + Intronic
1146163009 17:30570048-30570070 GCTCAGGGTGGGGCAGTCCCAGG - Intergenic
1146810585 17:35899863-35899885 GAACACAGTGGGCCAGATCCTGG + Intergenic
1147141106 17:38461075-38461097 GCCCAGAGGGGGCCAGACCAGGG - Intronic
1147338359 17:39739980-39740002 GATCAGAGAGGGCCAGTCCAAGG - Intronic
1147358931 17:39919125-39919147 GGTGAGTGTGGGCCAGACAATGG + Intronic
1148087238 17:45001553-45001575 GGTCAGAGAGGGACAGGCCATGG + Intergenic
1148282974 17:46363243-46363265 TGTGGGAGTGGGACAGACCCAGG - Intergenic
1148305191 17:46581168-46581190 TGTGGGAGTGGGACAGACCCAGG - Intergenic
1149313976 17:55421827-55421849 GGTCGGAGTGGGCCAGGCCGGGG + Exonic
1151879445 17:76886325-76886347 CCTCAGAGTGGGGCAGACCTGGG + Intronic
1152846181 17:82601110-82601132 GGCCACCGTGGGCCAGTCCCTGG + Intronic
1153205849 18:2699627-2699649 GGTCAGAGATGGCCAGGCACAGG - Intronic
1153610231 18:6877404-6877426 GGGCAGAATGGGCAAGGCCCTGG + Intronic
1154204787 18:12327285-12327307 GGTCAGAGTGGGCTCTGCCCAGG - Intronic
1154355141 18:13619252-13619274 GGCCAGAGTGTCCCAGACACAGG + Intronic
1155052609 18:22161959-22161981 GGTCCAAGAGGGCCAGGCCCAGG - Intergenic
1156445715 18:37235374-37235396 GCAAAGAGTGGGCCAGGCCCAGG + Intergenic
1156518422 18:37700524-37700546 GGTCAAAGTGTGCCAGACGTGGG - Intergenic
1156536662 18:37870997-37871019 GGTCAGAGTGGACAAGGACCTGG + Intergenic
1157331953 18:46710675-46710697 GCTCTCAGAGGGCCAGACCCTGG - Intronic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1157860411 18:51136061-51136083 GCTCTGAGTAGGCAAGACCCAGG + Intergenic
1160110906 18:76029135-76029157 GGTGAGAGTTGGCCACACCAGGG - Intergenic
1160990673 19:1859096-1859118 GGTCGGAGTGGGGCAGTGCCAGG - Intronic
1161054163 19:2181577-2181599 GGCCAGGGTGGGCCTGACCCAGG + Intronic
1161872664 19:6882355-6882377 GGCCAGAGGAGGCCTGACCCAGG - Intergenic
1162050367 19:8029004-8029026 GGCCAGAGTGGGCCAGGCCTAGG + Intronic
1162308380 19:9889659-9889681 GGAGGCAGTGGGCCAGACCCAGG + Intronic
1163424691 19:17235076-17235098 GGCCTGAGGGGGCCAGAACCAGG + Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1164761931 19:30734773-30734795 GCTCACCCTGGGCCAGACCCGGG + Intergenic
1165828295 19:38718081-38718103 GGGCAGAGTGGGGCAGAGCTGGG - Intronic
1167314636 19:48756471-48756493 AGTGAGTGTGGGCCAGAGCCTGG + Exonic
1167509238 19:49887634-49887656 GGGCGGAGAGGGACAGACCCTGG + Intronic
1168294535 19:55372448-55372470 GCTCACAGTGGGCCAGCCCCAGG + Intergenic
1168691152 19:58378310-58378332 TGTCAGAGAGGTCCAGATCCTGG - Intronic
925287643 2:2726451-2726473 GGTCTGAGGGGTACAGACCCCGG - Intergenic
927813974 2:26197858-26197880 GGACAGAGTGGGCTGGGCCCAGG - Intronic
928167449 2:28981411-28981433 GGCCAGGGTGGGCCAGGCCTGGG + Exonic
930523919 2:52502192-52502214 GGTTAGAGTGGGCCAGAGTTGGG - Intergenic
932466838 2:71929481-71929503 GGGCAGAGGGGTCCAGAGCCTGG + Intergenic
932818233 2:74878638-74878660 GGCCACAGTGGGTCAGACACAGG + Intronic
935492270 2:103735345-103735367 GGGCTGAGTGGGCCAGTCCCTGG + Intergenic
935677659 2:105609701-105609723 GGGCAGCGTGGCCCAGCCCCTGG - Intergenic
936350207 2:111706804-111706826 GGTCAGAGGGTCCCAGTCCCTGG - Intergenic
937011310 2:118565259-118565281 GGTGAGAGTGGGCAGGAGCCTGG - Intergenic
937234920 2:120425025-120425047 GTTCAAAGTGGCCCCGACCCTGG + Intergenic
938140352 2:128790021-128790043 GGTCAGCGTGTGGCTGACCCGGG + Intergenic
939118566 2:138089246-138089268 CGGCACAGTGTGCCAGACCCGGG + Intergenic
945197586 2:207251639-207251661 AGTCACAGTGGGCCATATCCAGG - Intergenic
945336584 2:208599715-208599737 GGGCACAGTTGTCCAGACCCTGG - Intronic
946131395 2:217609768-217609790 GAGCAGAGTGGGCGAGACCCTGG - Intronic
946167434 2:217873554-217873576 GGTGAGAGAGAGCCAGCCCCTGG + Intronic
946402123 2:219473654-219473676 GGCCAGGCTGGGCCAGACCTGGG - Intronic
946423129 2:219576127-219576149 GTCCAGAGTTGGCCAGACCTTGG + Intergenic
947387801 2:229609293-229609315 GGTCAGAATTTGCCAGCCCCTGG - Intronic
948692301 2:239714277-239714299 GCTCAGAGTAGGGGAGACCCTGG + Intergenic
1169217266 20:3801029-3801051 TGGCAGAGTGGGCCAGCCGCAGG + Exonic
1171542808 20:25977392-25977414 AGTCAGACTGAGCCAGACCTAGG - Intergenic
1171845841 20:30274041-30274063 AGTCAGACTGAGCCAGACCTAGG - Intergenic
1172942755 20:38665920-38665942 GGGGTGAGTGGGCGAGACCCCGG - Intergenic
1173210717 20:41029339-41029361 GCGCAGGGTGAGCCAGACCCCGG + Intronic
1173706169 20:45111817-45111839 GGTCAGAGGGAGCCGGGCCCTGG - Intronic
1173805826 20:45924762-45924784 AGTCAGAGTGGCCAAGAGCCAGG - Intergenic
1174402510 20:50283530-50283552 GGACAGTGTGGGCCAGGGCCTGG + Intergenic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1176008615 20:62880194-62880216 GGTCAGAGAGGACCACCCCCTGG - Exonic
1176202597 20:63869186-63869208 GGTGGGAGTGGGTGAGACCCTGG - Intronic
1176365876 21:6032467-6032489 GGCAGGAGTGGGGCAGACCCGGG + Intergenic
1176717292 21:10364176-10364198 GGTCTGAGTGGACCAGACTAGGG - Intergenic
1179286934 21:39985451-39985473 GGTCAGAGTGACCCTGACCGTGG - Intergenic
1179400263 21:41076582-41076604 GGTCAGCGTGGGCCAGAGGAAGG - Intergenic
1179478059 21:41660341-41660363 GTACAGAGTGCGCCAGCCCCCGG + Intergenic
1179757640 21:43506078-43506100 GGCAGGAGTGGGGCAGACCCGGG - Intergenic
1179924976 21:44529363-44529385 GGCCAGAGTGGGCCCGACTGGGG + Intronic
1180298515 22:11017095-11017117 GGTCTGAGTGGACCAGACTAGGG - Intergenic
1180601050 22:17015818-17015840 GGTCTGAGTGGACCAGACTAGGG + Intergenic
1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG + Intergenic
1182951425 22:34379861-34379883 GGTGAGAGTGGGGCAAGCCCAGG - Intergenic
1183096231 22:35553913-35553935 GGTGAGAGCGGGCCACACACCGG - Exonic
1183530706 22:38351850-38351872 GGTCACAGAGGGCCAGAGGCGGG - Intronic
1183678630 22:39313791-39313813 GGTCAGGGAGGGCCTGAACCTGG - Intronic
1183828732 22:40406977-40406999 GGTCAGGGTGGTCCTGGCCCCGG - Intronic
1184107892 22:42379054-42379076 GGCCCAAGTGGGCCAGATCCTGG - Intergenic
1184503562 22:44888178-44888200 GGTCAGCCAGGGCCAGGCCCAGG + Intronic
1184727445 22:46355196-46355218 TGTCAGAGTGGGCAAGAGGCAGG - Intronic
949834995 3:8258328-8258350 GATCAGAGTGTTCCAGACCATGG - Intergenic
950264648 3:11564815-11564837 GGTCAGTGTGGGCGAGAGGCCGG + Exonic
950716842 3:14853742-14853764 GGTCAGAGTTGGACAGCACCAGG + Intronic
951865701 3:27304865-27304887 GGTCAGAGTGGAGCAGACTGAGG + Exonic
953131643 3:40145170-40145192 GGTGGAAGTGGCCCAGACCCTGG - Intronic
953735267 3:45488740-45488762 CTTCAGAGTAGGCCAGGCCCAGG - Exonic
954381904 3:50223675-50223697 GGTCAGAGTGGGCCTGAGAAAGG + Intergenic
954715236 3:52523618-52523640 GCTCACAGTGGGCCTGACTCTGG + Intronic
954882409 3:53845119-53845141 GCTCAGGGTGGCCCAGTCCCAGG + Intronic
955523352 3:59796270-59796292 GGTCTGGGTGGCCCAGAGCCAGG - Intronic
956075234 3:65498002-65498024 GGTCAGGTTGGCCCAGACCCAGG - Intronic
956335854 3:68162527-68162549 GAGCAGAGTGGTCCAGACCAGGG - Intronic
956640654 3:71412483-71412505 GGCCAAAGTGGGCCAGACTAGGG + Intronic
956654479 3:71535791-71535813 TCTCAGAGTGGGGCAGAACCAGG - Intronic
956938054 3:74126380-74126402 GGGCAGAGAAGGCAAGACCCTGG + Intergenic
959532554 3:107450301-107450323 GGACAGAGTGGTCCTGCCCCAGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961326515 3:126112378-126112400 GGTCAGCCTGGGCCTGACCATGG - Intronic
961684811 3:128622444-128622466 GGTCAGAGTGGACCCAAGCCTGG - Intronic
961780987 3:129319921-129319943 GGTCTGTGTTGGCCACACCCAGG - Intergenic
962363804 3:134763735-134763757 GGTCAGAGTGGGGGACACCAAGG - Intronic
968234817 3:197025306-197025328 GGTTGGCGGGGGCCAGACCCTGG - Intronic
968811485 4:2801408-2801430 AGAAGGAGTGGGCCAGACCCCGG - Intronic
969524801 4:7698905-7698927 GGGCAGAGTGGGACAGAGGCAGG + Intronic
969662396 4:8537924-8537946 GGTCATTGTGGATCAGACCCCGG + Intergenic
969802566 4:9580933-9580955 TGTCTGCGTGGGCCAAACCCTGG + Intergenic
970676552 4:18456826-18456848 GGTCACAGGGGGCCAGAGTCTGG - Intergenic
971817588 4:31508567-31508589 GGTTAGAGTGGGGCAGACATGGG - Intergenic
972379943 4:38510282-38510304 CTACAGAGTGGGCCAGGCCCAGG + Intergenic
974145639 4:57943926-57943948 GGCCAGAGTGCGCCAGAGGCTGG + Intergenic
974619829 4:64340700-64340722 GGGCAGAGGGGGCCAGTTCCTGG + Intronic
977265137 4:94844901-94844923 GATAATAGTGGGCCAGACCCTGG + Intronic
978850743 4:113332921-113332943 GGACATAGTGGGCCATCCCCTGG - Intronic
983380598 4:166987265-166987287 GGCAAGAGTGAGCCAGACACAGG - Intronic
985689287 5:1298316-1298338 GGTCAGAGGGGGGCAGCCTCAGG - Intergenic
985822367 5:2169032-2169054 GATCGGGGTGGGCCACACCCAGG + Intergenic
985837666 5:2282425-2282447 AGGCAGAGCGGGCCTGACCCAGG + Intergenic
986285869 5:6358573-6358595 GGTCAGAGGGGACCAGTCTCTGG + Intergenic
986775402 5:11009266-11009288 GGGCAGAGTGTACCAGAGCCAGG + Intronic
987080881 5:14424181-14424203 TGTCAGAGCTGGCAAGACCCTGG - Intronic
991460429 5:66852567-66852589 GGTAAGAAAGGGCCAGACCATGG - Intronic
997690135 5:135822772-135822794 CTTCAGAGTGGGTCAGACCTGGG + Intergenic
1001436119 5:171700937-171700959 TGTCAGTGTGGGCCAGGCCTTGG + Intergenic
1003925923 6:10877374-10877396 GGTCAAAGAGGGCCAGCTCCTGG + Exonic
1004082059 6:12404463-12404485 GGTCAGAGTGAGTCAGGCCTTGG + Intergenic
1004267924 6:14165487-14165509 GGCCAGAGTGGCCCAAACACTGG + Intergenic
1005203964 6:23379837-23379859 GCTGTGAGTGGGCCACACCCGGG + Intergenic
1006118985 6:31792605-31792627 GGTCAGCATGGGCAAGACCTCGG - Intronic
1006359712 6:33580318-33580340 GATCTGGGTGGGCCAGGCCCAGG + Intergenic
1006466230 6:34196444-34196466 GGCCCGCGTGGGCCTGACCCTGG - Intergenic
1006921801 6:37632467-37632489 GGGCAGAGTGGGCCAGGGTCGGG - Exonic
1007091823 6:39189586-39189608 GGACACAGTGGGCCAGCCCCAGG + Exonic
1008640435 6:53456886-53456908 GGTCAGAAAGGACCAGACACAGG - Intergenic
1010314736 6:74434738-74434760 GGTCAGAGTCAGCCAGATCATGG - Intergenic
1010333128 6:74647215-74647237 GGACAGGGTGGGCCAGACCTTGG - Intergenic
1010625764 6:78134972-78134994 AATCAGAGGGGGCCAGCCCCAGG + Intergenic
1011785345 6:90837389-90837411 TGTCAGATTGGGGCAGAGCCGGG - Intergenic
1013225857 6:108119062-108119084 GGTCAAAGTGGCCCCGACTCGGG + Intronic
1016814909 6:148294345-148294367 GGTCAGAGTGGTACAAATCCTGG + Intronic
1019404600 7:876966-876988 GGCCACACAGGGCCAGACCCCGG - Intronic
1021534848 7:21691473-21691495 GGCTAGAGTGGGCTAGGCCCTGG - Intronic
1021788965 7:24180722-24180744 GCTCAGAGTTGGCCAGAACTTGG + Intergenic
1024637152 7:51300502-51300524 GGTAAGAAGGGTCCAGACCCAGG - Intronic
1025294185 7:57762500-57762522 AGTCAGACTGAGCCAGACCTAGG - Intergenic
1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG + Exonic
1027779931 7:82508034-82508056 TGTCAGAGTGGGGCGGAGCCTGG - Intergenic
1028113874 7:86975625-86975647 GTTCTGAGTGGGCCAACCCCTGG + Intronic
1029324540 7:99794749-99794771 GCTCAGAGGAGACCAGACCCTGG + Intergenic
1030203164 7:106926226-106926248 GGTCAGGCTGGTCCTGACCCAGG - Intergenic
1031100940 7:117479536-117479558 CGTCAGGGTCCGCCAGACCCAGG - Intronic
1032026099 7:128443918-128443940 GGTCACAGTGGCCCAGCCTCCGG + Intergenic
1034317241 7:150143878-150143900 GGTGAGAGTGGGCTGGAACCTGG + Intergenic
1034775511 7:153823339-153823361 GGTGAGAGTGGGCTGGAACCTGG - Intergenic
1035295552 7:157865123-157865145 AGCCTGCGTGGGCCAGACCCAGG - Intronic
1035312204 7:157976497-157976519 GGGCAGAGTGGGCGAGAACCTGG - Intronic
1035736545 8:1891533-1891555 GGTCAGGCTGGGCCAGGCCCAGG + Intronic
1036765906 8:11549199-11549221 GGCCAGAGTGGGACTGACCAGGG + Intronic
1038456383 8:27674404-27674426 GGTCAGAGAGGGCCAGTGCTAGG - Intronic
1040725660 8:50378990-50379012 GGTGAAAGGGGGCAAGACCCTGG - Intronic
1040976380 8:53198327-53198349 TGCCAGAGTGGCCCAGAACCTGG - Intergenic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1049336548 8:142089697-142089719 GGTCAGAGGGGGCCCGAGTCAGG - Intergenic
1049571328 8:143371567-143371589 GGCCAGAGTGGGGCTGACCTGGG - Intronic
1050188805 9:3003283-3003305 GGGCTGAGTGTGCTAGACCCTGG - Intergenic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1054162233 9:61681803-61681825 AGTCAGACTGAGCCAGACCTAGG + Intergenic
1056731342 9:89169012-89169034 CTGCAGGGTGGGCCAGACCCAGG - Intronic
1057700124 9:97357976-97357998 GGTCAGAGGAAGCCAGACTCAGG - Intronic
1059305362 9:113349625-113349647 GGGCAGAGTGGCCCCGGCCCGGG - Exonic
1062034739 9:134377982-134378004 GCTCAGCGTCGGCCACACCCAGG + Intronic
1062338833 9:136084524-136084546 TGTCAAACTGGCCCAGACCCCGG + Intronic
1062361530 9:136190539-136190561 GGTCAGGGTGGGCCAGCCTGAGG + Intergenic
1062532530 9:137008169-137008191 GGGCAGAGGGGACCAGAGCCGGG - Intronic
1201248336 Y:12029591-12029613 TGTCAGCTTGAGCCAGACCCAGG + Intergenic