ID: 1175968655

View in Genome Browser
Species Human (GRCh38)
Location 20:62672914-62672936
Sequence GTGGTCCCCAGCACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175968641_1175968655 30 Left 1175968641 20:62672861-62672883 CCCAGGGCCTCTCTGAGGACTTA 0: 1
1: 0
2: 2
3: 17
4: 178
Right 1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 336
1175968643_1175968655 23 Left 1175968643 20:62672868-62672890 CCTCTCTGAGGACTTAGTTTCAG 0: 1
1: 0
2: 2
3: 21
4: 256
Right 1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 336
1175968642_1175968655 29 Left 1175968642 20:62672862-62672884 CCAGGGCCTCTCTGAGGACTTAG 0: 1
1: 0
2: 0
3: 28
4: 235
Right 1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175968655 Original CRISPR GTGGTCCCCAGCACTGAGGA TGG Intronic
900179660 1:1305635-1305657 TAGGTCCCCAGGACTGAGGAAGG - Intronic
900206130 1:1432644-1432666 TGTGTCCCCAGCACTGAGGCTGG + Intergenic
900294726 1:1943177-1943199 GTGGGGCCCAGCTCTGTGGATGG - Intronic
901127226 1:6938290-6938312 CTGGTCCCCAGAGCTGAGGGGGG - Intronic
901608906 1:10481394-10481416 GTGGCTCCCAGCACTGTGGGAGG - Intronic
902114872 1:14113140-14113162 GGGATCCCCAGTGCTGAGGAAGG - Intergenic
902227600 1:15006507-15006529 GTGGGCCTCAGCCCTGTGGATGG - Intronic
902776673 1:18679317-18679339 CAGGGCTCCAGCACTGAGGAGGG + Intronic
903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG + Exonic
903165975 1:21520715-21520737 GTGGCTCCCAGCACTTTGGAAGG - Intronic
903728696 1:25472791-25472813 GTGGTCGCCATCACTCAGGGAGG - Intronic
904333900 1:29784840-29784862 CTGCTGTCCAGCACTGAGGATGG + Intergenic
904393299 1:30199671-30199693 GTAGTCCACAGCCCTGAGCAGGG + Intergenic
906302658 1:44694754-44694776 TGGGATCCCAGCACTGAGGAGGG - Intronic
906436763 1:45803360-45803382 TGGGTCCCCAGCACTGAGCTTGG + Intronic
906945358 1:50290086-50290108 GTGGCACCCAGCTCTGAGGCAGG - Intergenic
907158544 1:52355444-52355466 CTGGTCCTAAGCAGTGAGGAGGG + Exonic
907427360 1:54388863-54388885 GTTTCCCCCAGGACTGAGGAAGG - Intronic
910213270 1:84815752-84815774 GTGGTACCCAACACTGTGGTGGG + Intronic
911105032 1:94122960-94122982 GTGGTGCTCATAACTGAGGAGGG + Intergenic
912382223 1:109253828-109253850 GTGGTCCCCAGCTCTGCCAAAGG - Intronic
913017457 1:114753659-114753681 GTAATCCCCAGCACTGTGGCAGG + Intronic
913965894 1:143377320-143377342 GTGGTCCTCGGCACAAAGGATGG - Intergenic
914060268 1:144202928-144202950 GTGGTCCTCGGCACAAAGGATGG - Intergenic
914118882 1:144763441-144763463 GTGGTCCTCGGCACAAAGGATGG + Intergenic
914507869 1:148304978-148305000 GTAATCCCCAGCACTTAGGGAGG - Intergenic
915315890 1:155029114-155029136 GCAGTCACCAGGACTGAGGATGG + Intronic
915347691 1:155206318-155206340 GATGTCCCCAGCAGTGAGCAAGG + Exonic
915934216 1:160081432-160081454 GTGGTACCCAGGACTGGGGAGGG + Intergenic
916665638 1:166964576-166964598 GTGGTCCCCAGCTCAGAGAATGG + Intronic
916713788 1:167433704-167433726 GTGGTCCTGAGCACTGAACACGG + Intronic
920263866 1:204707601-204707623 CTGGTCCCCACCACTGTGGGTGG + Intergenic
920840319 1:209548427-209548449 GCTGTCCCCAGCACCAAGGAGGG + Intergenic
922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG + Intronic
923508983 1:234633101-234633123 GTGGTCCCCAGCAGAGAGGCAGG - Intergenic
923907381 1:238400301-238400323 GTGCTCACCCGCACTGAGGGTGG + Intergenic
1062861243 10:812060-812082 GTGTTCCCCAGCACTCTGGTTGG - Exonic
1063093304 10:2887027-2887049 GTGCGCCCCAGAGCTGAGGATGG + Intergenic
1063205905 10:3830363-3830385 GTGGCCCCCAGCACTTTGGGAGG + Intergenic
1064059152 10:12122799-12122821 GAGGCCCCCAGCACTGAGTCAGG - Exonic
1065191504 10:23214764-23214786 GTAATCCCCAGCACTTAGGGAGG + Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1066212158 10:33251064-33251086 GTAATCCCCAGCATTGAGGGAGG + Intronic
1069905278 10:71728603-71728625 GTGGTGACCAGCACTAAGGGAGG - Intronic
1070022770 10:72603129-72603151 GTAATCCCCAGCACTTTGGAAGG + Intronic
1071517775 10:86310419-86310441 GTGGTCCCCAGCCCTGTGTGGGG + Intronic
1072537159 10:96372391-96372413 GTGGTCACCAGCTCTGACAAAGG + Intronic
1072956818 10:99894156-99894178 GTGGTCCCAGCCACTGAGGTGGG + Intronic
1073484374 10:103807373-103807395 GTGGTCCCATTTACTGAGGAAGG + Intronic
1073887310 10:108054568-108054590 GTAGTCCCCAGCACTTTGGGAGG - Intergenic
1074497959 10:113996405-113996427 GCTGTTCCCAGCACAGAGGAGGG + Intergenic
1074712957 10:116192745-116192767 GGGGTTTCCAGCACTGTGGAGGG - Intronic
1074989812 10:118694118-118694140 GTGATCCCCAGCACTTTGGGAGG - Intronic
1075222999 10:120600806-120600828 GTGGGCACCAGCACAGAGCAGGG - Intergenic
1076215493 10:128690071-128690093 GTGGTTTCCAGCAGTGAGAATGG + Intergenic
1076856231 10:133116675-133116697 GGCATCCCCACCACTGAGGAAGG - Intronic
1077097535 11:805310-805332 GTGGACCCCAGCCCGGCGGAGGG - Intronic
1077100691 11:821065-821087 GTGGTCGGGAGCACTGAGGGAGG - Intronic
1077187775 11:1243154-1243176 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077187838 11:1243412-1243434 GTGGTCCCTAGGGCAGAGGAGGG - Exonic
1077188196 11:1244825-1244847 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077188260 11:1245083-1245105 GTGGTCCCTAGGGCAGAGGAGGG - Exonic
1077188731 11:1246925-1246947 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077188793 11:1247183-1247205 GTGGTCCCTAGGGCAGAGGAGGG - Exonic
1077189151 11:1248596-1248618 GTGGTCCCCGGGACGGAGGAGGG - Exonic
1077189214 11:1248854-1248876 GTGGTCCCTAGGGCAGAGGAGGG - Exonic
1077189720 11:1250795-1250817 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077542793 11:3155388-3155410 GTGATCCCAAGCACCGAGGGGGG + Intronic
1079355257 11:19725315-19725337 GTGGGCGGCAGCACTGAGGGAGG - Intronic
1081849692 11:46266373-46266395 GTGGGCCTCAGCACTGAGCCTGG + Intergenic
1083359461 11:62096024-62096046 GGAGTCCCCAGCACTGTGGGAGG + Intergenic
1083359989 11:62099994-62100016 GGAGTCCCCAGCACTGTGGGAGG - Intergenic
1084964293 11:72736361-72736383 GTGGTCCCCGCTACTGGGGAGGG - Intronic
1086950972 11:92890114-92890136 GTGGTCCACAGCACAGCTGATGG + Intronic
1088830287 11:113530984-113531006 GTGTTGCCCAGCACAGAGCATGG + Intergenic
1088922865 11:114274066-114274088 ACAGTCCCCAGCACTGAGCAGGG - Intronic
1089011474 11:115135639-115135661 GTGGTCCCCAGTTATGTGGAAGG + Intergenic
1089100544 11:115958861-115958883 GCGGCACCCAGCACTGAGCAAGG - Intergenic
1089298178 11:117481931-117481953 GGGTCCCCCAGCACTGAGGTGGG + Intronic
1091406650 12:213576-213598 GTGGTGCCCAGCAAGGTGGAAGG - Intronic
1091800765 12:3323254-3323276 GAGGTCCCCAGCAAGGAAGAAGG - Intergenic
1092713244 12:11360177-11360199 ATGGCCCCAATCACTGAGGATGG - Intronic
1093732308 12:22579398-22579420 GTAATCCCCAGCACTTTGGAAGG - Intergenic
1094483497 12:30904785-30904807 GTTGTCCCCAGCACTTTGGGAGG + Intergenic
1095242473 12:39877866-39877888 GTAGTCCCCAGTGCTGAGGTAGG + Intronic
1095426459 12:42079618-42079640 GTAATCCCAAGCACTGAGGCAGG - Intergenic
1096370933 12:51068406-51068428 GTGGACCCCAGCACTTTGGGAGG - Intronic
1096576463 12:52555999-52556021 TGTGTCCCCAGCACTGAGCATGG - Intergenic
1096862755 12:54541858-54541880 AGGGTCCCCATCCCTGAGGAAGG - Intronic
1097020801 12:56019656-56019678 GTGTTCCCCAGCACTAAAGCAGG - Intronic
1098506333 12:71255623-71255645 GTAGTCCCAACCACTCAGGAGGG + Intronic
1100633633 12:96413256-96413278 GTGGTACCCAGCAATGGAGAAGG - Intergenic
1100781335 12:98029853-98029875 GAGGTACACAGCACTGAGAAGGG - Intergenic
1101448409 12:104754987-104755009 ATGGTCCCCAGGACAAAGGATGG - Intronic
1101994891 12:109518238-109518260 CTGCTCCCCAACACTGAGGCTGG - Intronic
1102014541 12:109639073-109639095 ATGGTGCCCAGCACTGAGCTGGG - Intergenic
1102458790 12:113087477-113087499 GTGTTCCCCAGGACTGTGGGGGG + Intronic
1102789677 12:115634436-115634458 GTGCTCACCCACACTGAGGATGG + Intergenic
1103722204 12:122980969-122980991 GGGGTCCCCAGCGCTGGGGGTGG + Exonic
1104223211 12:126806249-126806271 GTGGTCACCAGGAGTGAGGAAGG - Intergenic
1104388532 12:128372066-128372088 GTGGTTGCCTGGACTGAGGATGG - Intronic
1104949119 12:132431015-132431037 GTCGACCTCAGCACTGAGGTGGG + Intergenic
1105359195 13:19691409-19691431 GTGGTCCCTACTACTGAGGTGGG + Intronic
1105614392 13:21999194-21999216 GTGCTCACCAGCACACAGGAGGG + Intergenic
1106111067 13:26777335-26777357 GTGATCCCCAGCGTTGGGGATGG - Intergenic
1107630041 13:42333851-42333873 GTGGTCCTCAGCCATGAGTAGGG + Intergenic
1110930684 13:81212240-81212262 GTGGCCTCCAGCACTTGGGAGGG - Intergenic
1118647049 14:67850730-67850752 GTAGTCCCCAACCCTGATGAGGG + Intronic
1119654209 14:76405410-76405432 CTGGTTCCCAGAACTGAAGAAGG + Intronic
1120217707 14:81697832-81697854 GTGGTCACCAGAGGTGAGGAGGG - Intergenic
1122282711 14:100633548-100633570 GTGGTCCCCCGCACTGGAGTGGG - Intergenic
1122837093 14:104435693-104435715 CTGGTCACCAGCAGTGAGAAGGG + Intergenic
1123881530 15:24680680-24680702 GTGGTCTTCTGCACTGTGGAGGG + Exonic
1125563842 15:40660164-40660186 GTAATCCCCAGCACTTTGGAAGG - Intronic
1125659701 15:41384250-41384272 GTGATCCCCAGCACTTTGGGAGG - Intergenic
1125728552 15:41880442-41880464 GTGGGGCCCAGCAGTGAGGCAGG - Intronic
1126078775 15:44938460-44938482 GTGGTTCCCAGCACTTTGGGAGG + Intergenic
1129166118 15:73778962-73778984 GTGGTGCCCACCTCTGAGGTAGG - Intergenic
1129267480 15:74401703-74401725 CTGGTCCCCAGCTCTCAGGTGGG + Intergenic
1130576919 15:85101308-85101330 GTGATCCCCAGGAATGAGAAAGG + Intronic
1131279050 15:91006268-91006290 GTGGGCCCCAGCTCTGAGAGGGG - Intronic
1131484178 15:92806938-92806960 GTGGCTCCCAGCACTTCGGAAGG - Intronic
1132302480 15:100784538-100784560 ATGATCCCCAGCTCTGGGGAGGG + Intergenic
1132382738 15:101377968-101377990 AGTGTCCCCAGCACTGAGGTGGG + Intronic
1132523896 16:404882-404904 GTGGCTCCCAGCACTTTGGAAGG - Intronic
1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG + Intronic
1134550303 16:15135776-15135798 CTGGTGCCCATCACTGAGGGTGG - Intronic
1134718164 16:16367219-16367241 CTGGTGCCCATCACTGAGGGTGG + Intergenic
1134956588 16:18384940-18384962 CTGGTGCCCATCACTGAGGGTGG - Intergenic
1135016488 16:18928180-18928202 GTGGTCCCAGGAACTCAGGAGGG + Intergenic
1135088810 16:19495875-19495897 GTGATCCCCAGCACTTTGGGAGG + Intronic
1135322129 16:21504028-21504050 GTGGTCCCAGGAACTCAGGAGGG + Intergenic
1135826775 16:25735645-25735667 GTAATCCCCAGCACTTAGGGAGG - Intronic
1135937162 16:26791312-26791334 ATGGTCCACAGCACAGAGAAGGG - Intergenic
1136333606 16:29597160-29597182 GTGGTCCCAGGAACTCAGGAGGG + Intergenic
1136498125 16:30656201-30656223 GTGGCCCCCAGCCCTGATGTGGG + Exonic
1137790733 16:51172576-51172598 GTGCTCCCCAGCACTGAATAGGG + Intergenic
1138455653 16:57119261-57119283 CTGGTCCACAGGACTGAGGTGGG + Exonic
1141741321 16:85895046-85895068 ATGGCAGCCAGCACTGAGGAAGG - Intergenic
1142405057 16:89883978-89884000 GTGCTCCACAGCACAGAAGAGGG + Intronic
1142475636 17:187451-187473 GTGGTCCCCAGGCCTGTGGGAGG - Intergenic
1143357992 17:6345050-6345072 GTGTTCCCCGGCACTCAGAAGGG + Intergenic
1144749687 17:17639807-17639829 GTGGTCCCAGCCACTGGGGAGGG + Intergenic
1144843394 17:18202730-18202752 GTGTTCTCTTGCACTGAGGAGGG + Intronic
1146887338 17:36481393-36481415 GTAATCCCCAGCACTTTGGAAGG + Intergenic
1147906430 17:43825993-43826015 GAGGTGCCCAGCACTTAGCAGGG - Intronic
1148326802 17:46788003-46788025 CTGGTCACCTGCACTGAGGTGGG - Intronic
1148441037 17:47711690-47711712 GGGGTCCCCAGGGCTGAGGTGGG + Exonic
1149535794 17:57432407-57432429 GTGGTTCCCAGCATTGGGGTTGG + Intronic
1150119433 17:62587584-62587606 GTGGTGCTCAGCACTGGAGAAGG + Intronic
1150391450 17:64791927-64791949 GTGGGCTCCAACACTGAGCAGGG - Intergenic
1150410265 17:64936058-64936080 GTGGGCTCCAACACTGAGCAGGG - Intergenic
1150644234 17:66968279-66968301 GTGGAGCCCAGCTCTGAGGTTGG + Intronic
1151237718 17:72733618-72733640 GTGGTCCTCAGCATTGAATAAGG - Intronic
1151552333 17:74829368-74829390 GTGTGGCCCAGCACTGAGGTGGG - Intronic
1152421837 17:80197855-80197877 AAGGTCCCAAGCATTGAGGAAGG + Intronic
1152472551 17:80498500-80498522 CTGGTGCCCAGCTTTGAGGACGG - Intergenic
1152563316 17:81089394-81089416 GTGGACCACAGCACTGAGGCAGG - Intronic
1155490057 18:26392362-26392384 GTAATCCCCAGCACTTAGGGAGG + Intergenic
1155521792 18:26675784-26675806 GTGGTGCCAAGCACTTAGGATGG + Intergenic
1158323124 18:56285154-56285176 GTGTCTGCCAGCACTGAGGATGG - Intergenic
1158640181 18:59196892-59196914 GGGGTCCCGGGCACTGAGAAGGG + Intergenic
1160016073 18:75141704-75141726 GTGGCCTGGAGCACTGAGGAAGG - Intergenic
1160333780 18:78018637-78018659 GTTGTCCCCAGGCCAGAGGACGG + Intergenic
1160707571 19:536608-536630 GAAGGCCCCAGGACTGAGGATGG - Intronic
1161330965 19:3687701-3687723 GGGGACCCCAGCACGGTGGAGGG + Intronic
1161500222 19:4610367-4610389 GGGGTCCCCAGCAGAGAGGCTGG + Intergenic
1162311435 19:9909761-9909783 GTTCTCCCCAGTCCTGAGGAAGG + Intronic
1162570956 19:11472578-11472600 GTGGTCCCAGGTACTCAGGATGG + Intronic
1163425101 19:17236562-17236584 GGGGTTCCCAGAGCTGAGGATGG + Intronic
1163582681 19:18147677-18147699 GTGGGCCCCAGGAGGGAGGAAGG + Intronic
1163644216 19:18479156-18479178 CTGGTCCTCACCACTGAGGGCGG + Intronic
1164220760 19:23191442-23191464 GTAATCCCCAGCACTTTGGAAGG - Intergenic
1165301778 19:34974360-34974382 GTGAGCCCCATCACTGAGCATGG - Intergenic
1165374717 19:35433647-35433669 GAGTTCCCCAGCACAGAGGGAGG - Intergenic
1166544816 19:43627626-43627648 CTGGTCCCCAGCACTCACCACGG + Exonic
1166641406 19:44498023-44498045 GTGGACCCCAGAAGTGTGGAGGG - Intronic
1166643961 19:44517367-44517389 GTGGTCCACAACACTGGGGGTGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167858219 19:52260131-52260153 GTAATCCCCAGCACTCTGGAAGG - Intergenic
1168557910 19:57358832-57358854 GTACTCCCCAGCACTGTTGAGGG + Exonic
1168687733 19:58358536-58358558 CTGGTCCCCAGGACAGAGGAGGG - Exonic
1202699672 1_KI270712v1_random:154813-154835 GTGGTCCTCGGCACAAAGGATGG - Intergenic
925335823 2:3098498-3098520 GTGGCCCCCAGGACTCAGGGTGG - Intergenic
926027627 2:9558322-9558344 GTGGTCCCAGCTACTGAGGAGGG - Intergenic
927231309 2:20826684-20826706 GTGGTCCCCAGTATTGGAGATGG + Intergenic
927494464 2:23543299-23543321 GTGGTCCCCAAGAAAGAGGAGGG + Intronic
928445330 2:31329077-31329099 CTGGCCCCCAGCAGTGGGGATGG + Intergenic
928981105 2:37135886-37135908 GTGATCCCCAGCACTTTGGGAGG - Intronic
930823638 2:55673841-55673863 GTAATCCCCAGCACTTTGGAAGG - Intronic
931346608 2:61452625-61452647 GTAATCCCCAGCACTTTGGAAGG + Intronic
934170616 2:89538301-89538323 GTGGTCCTCGGCACAAAGGATGG - Intergenic
934280918 2:91612621-91612643 GTGGTCCTCGGCACAAAGGATGG - Intergenic
934900469 2:98155772-98155794 GGGGTTCCCAGCACTGTGCAGGG + Intronic
934922089 2:98352674-98352696 GTGGCCACCAACACTGGGGAGGG - Intronic
935028475 2:99299679-99299701 GTGGTTCCCAGCACTTTGGGAGG - Intronic
935029560 2:99309114-99309136 GTGGTTCCCAGCACTTTGGGAGG + Intronic
935698571 2:105790677-105790699 GGGGTGCCCAGAACAGAGGAAGG - Intronic
940828836 2:158444659-158444681 GTGGTCCCAGCCACTCAGGAGGG + Intronic
948185858 2:236020839-236020861 GTGCTGCTCATCACTGAGGAGGG - Intronic
949050152 2:241893459-241893481 GTGGTCTCCTGGACAGAGGAGGG - Intergenic
1168936961 20:1673900-1673922 GTTGTTCCCAACACTGAGGCTGG + Intergenic
1170916541 20:20631952-20631974 TTGGTCCCTAGTACTGTGGATGG - Intronic
1171030438 20:21671631-21671653 GTAATCCCCAGCACTGTGGGAGG - Intergenic
1171113974 20:22508646-22508668 TGAGTCCCCAGCACTGAGGCGGG - Intergenic
1172070556 20:32253696-32253718 GTGGTCACCAGCTTTGAAGATGG - Intergenic
1173589723 20:44215235-44215257 GTGGCCCCCTTCACTAAGGAAGG + Intergenic
1174479786 20:50822881-50822903 GTAATCCCCAGCACTTTGGATGG - Intronic
1175270062 20:57727537-57727559 CTGGTCCTCAGCGCTGAGCAGGG - Intergenic
1175380339 20:58558385-58558407 GTGGCACTCAGCAGTGAGGATGG + Intergenic
1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG + Intronic
1176196018 20:63836570-63836592 GTGGCCCCTGGCACTGAGGATGG - Intergenic
1176220850 20:63968862-63968884 CTGCTCCCCAGCTCTCAGGATGG - Intronic
1177168706 21:17632065-17632087 GTGGTCCCAAGCACTTTGGCAGG - Intergenic
1178365700 21:31987266-31987288 ATGGTCACCTGCACTGAGGGTGG + Intronic
1178955096 21:37014845-37014867 GTGGTCCCAGCCACTTAGGAGGG - Intronic
1179154382 21:38837015-38837037 CAGGTCCCCAGCAAGGAGGAGGG + Intergenic
1179197554 21:39179660-39179682 TTGGTCCTCAGCATTGAGGATGG - Intronic
1179507784 21:41853106-41853128 GTGGCCTCCAGCACTGCGGGAGG + Intronic
1179856512 21:44165067-44165089 GTGCTCCCCGGAACTGGGGAGGG - Intergenic
1180047168 21:45313079-45313101 GTGGTCGCCAGCGCTCAGGAAGG + Intergenic
1180933623 22:19610075-19610097 GTGGTTCCCAGCACTTTGGGAGG + Intergenic
1181349856 22:22247068-22247090 GTGGTCTCCAGCACTTTGGGAGG + Intergenic
1181715680 22:24725875-24725897 ATGTTCCCCCTCACTGAGGAAGG + Intronic
1181891157 22:26064857-26064879 CTGGACCCCAGCACAGAGGCTGG + Intergenic
1182260577 22:29071169-29071191 GCGGTCCCCAGGACCGAGGCTGG + Intergenic
1183251392 22:36732846-36732868 GTGTTTCCCAGGACTGAGGAGGG - Intergenic
1183280732 22:36930682-36930704 GTGCTCCCCAGTGCTGAGGGAGG + Exonic
1184972938 22:48040093-48040115 GTGGTGCCAGGCATTGAGGACGG - Intergenic
952029542 3:29124739-29124761 GTAATCCCCAGCACTTCGGAAGG - Intergenic
952529748 3:34251220-34251242 GTGGTTCCCAGCACTTTGGGAGG - Intergenic
953874468 3:46658308-46658330 GTGGTTCCCAGCAGTTAGGGAGG - Intergenic
954087359 3:48256082-48256104 CCTGTCCCCAGCACTGAGTATGG + Intronic
954289881 3:49644032-49644054 GTGGGCCACAGGACTGAGGGAGG - Intronic
954603842 3:51893663-51893685 GTGGTTCCCTGCACAGAGGGAGG - Intergenic
954704818 3:52473886-52473908 GTGGTCTCCACCACTAAGGATGG + Intronic
954837043 3:53479007-53479029 GTGGCCAGCAGCACAGAGGAGGG - Intergenic
955223200 3:57040056-57040078 GTGATTCCCAGCAATGAGAATGG + Intronic
955248948 3:57258276-57258298 GTGGTCCCAGGTACTCAGGAGGG - Intronic
955452370 3:59083161-59083183 GTAATCCCCAGCACTTTGGAAGG - Intergenic
960970538 3:123136368-123136390 GTGGTGACCAGCCCTGAGAAGGG - Intronic
961674344 3:128555642-128555664 GTCACCCCCAGCGCTGAGGATGG - Intergenic
962352000 3:134663211-134663233 GTGGTACCAAGCAATGAGCACGG - Intronic
962890767 3:139670833-139670855 CTGGTCCCCAGTACTGTGGGAGG - Intronic
966423496 3:179756936-179756958 GTGGTCCCCAGGAGTGGGGAGGG + Intronic
968083996 3:195866455-195866477 GTAATCCCCAGCACTGTGGGAGG - Intronic
968088971 3:195888360-195888382 GTGGTCCTGAGGACAGAGGACGG + Intronic
968250184 3:197203014-197203036 GTAATCCCCAGCACTTTGGAAGG + Intronic
968494978 4:910450-910472 GGGGACCCCTGCACTGAGCAGGG - Intronic
969029181 4:4197580-4197602 GTGGCCCTCAGCACAGAGGATGG + Exonic
969433594 4:7170626-7170648 CTGGTCTCCAGCACCGATGAGGG + Intergenic
969582082 4:8071484-8071506 GCGGGCGCCAGCACTTAGGATGG + Intronic
969707940 4:8821933-8821955 GTGCTGCCCAGCACTGAACATGG + Intergenic
970554356 4:17216171-17216193 GTGGCTCCCAGCACTTTGGAAGG - Intergenic
973285203 4:48408207-48408229 GTGGTCCCAGCCACTCAGGAGGG + Intronic
973999043 4:56492093-56492115 GTGGTGCCCAGCACTTTGGGAGG - Intronic
975289389 4:72659240-72659262 GTTTTCCCCAACACTGAGAAAGG + Intergenic
976643366 4:87362267-87362289 GTAATCCCCAGCACTGTGGGAGG + Intronic
977714035 4:100160704-100160726 TTGGTCACAAGCACTGAGAAAGG + Intergenic
978016175 4:103749320-103749342 GTGGTCAGCAGCACCGAGAAGGG - Intergenic
979284730 4:118909545-118909567 GTGGGACACAGCACTGTGGAAGG + Intronic
979726801 4:123972144-123972166 TTGTTCCCCAGCAATGAGGAGGG + Intergenic
980468740 4:133221426-133221448 GTGGATCCCAGCACTTAGGGAGG - Intergenic
982774856 4:159431083-159431105 GTAATCCCCAGCACTTAGGGAGG - Intergenic
984127414 4:175829184-175829206 GTGGCTCCCAGCACTTTGGAAGG - Intronic
985196591 4:187436904-187436926 CTGGTGCCCATCACAGAGGAAGG - Intergenic
985575538 5:671885-671907 GTGGTACCCAGCCCGGGGGAAGG - Intronic
985789227 5:1916320-1916342 GTGGTCCCCGACACACAGGAGGG + Intergenic
985838635 5:2289272-2289294 GTGGTCCCCAGCATTGGAGTGGG - Intergenic
985942892 5:3152534-3152556 GTGGCTCCCAGCACTTTGGAAGG - Intergenic
986657778 5:10031973-10031995 GTGTCCCCCAGCCCTGAGGGTGG - Intergenic
986738873 5:10688729-10688751 GAGATCCCCAGCAATGAGGGTGG + Intronic
988508318 5:31843520-31843542 GTAATCCCCAGCACTTAGGGAGG - Intronic
990026713 5:51200718-51200740 ATAGTACCCAGGACTGAGGAAGG - Intergenic
991676323 5:69092949-69092971 GTGGTCCCAGCCACTCAGGAGGG - Intergenic
992775359 5:80084301-80084323 GTGGTCCCAAGCACTTTGGGAGG + Intergenic
992891427 5:81207829-81207851 GTTCTCCCCAGCGCTCAGGAGGG - Intronic
995462584 5:112419351-112419373 GTCGTCCCCAGGACTGCGGGAGG - Intergenic
995965214 5:117898426-117898448 GTGGTTGCCAGCATTTAGGAGGG + Intergenic
996837807 5:127813175-127813197 CTGGGCCCCCGCAATGAGGAAGG - Intergenic
997379564 5:133425984-133426006 GGGGTCCCCAGCACTTAGACAGG - Intronic
997483316 5:134206607-134206629 GTGGTCCCCACTACTGAGGTGGG - Intronic
997694316 5:135849575-135849597 GTTGTGCCCAGCTCTGGGGATGG + Intronic
998579737 5:143359659-143359681 GTAATCCCCAGCACTTTGGAAGG + Intronic
1001066610 5:168539824-168539846 GTAGTCCCCAGCACTTTGGGAGG - Intergenic
1001281517 5:170389475-170389497 CAGGTACCCAGCCCTGAGGAAGG + Exonic
1002068749 5:176665871-176665893 ATGGTCCACACCACTTAGGAAGG - Intergenic
1002185292 5:177451716-177451738 GTGGTGCCCAGCCCTCAGGCAGG + Intronic
1002185304 5:177451771-177451793 GTGGTGCCCAGCCCTCAGGCAGG + Intronic
1002988097 6:2210842-2210864 GTAATTCCCAGCACTGAGGGAGG + Intronic
1003329546 6:5118482-5118504 CTGCTCACCTGCACTGAGGAAGG + Intronic
1004252181 6:14031880-14031902 GTGGTCCCCTTCACTCAGGATGG + Intergenic
1006460494 6:34155007-34155029 GAGGTGCCCAGCACTGTGGGAGG - Intronic
1006899002 6:37488094-37488116 GGGGTCCCCAGCACTGGGCCTGG + Intronic
1006959338 6:37912182-37912204 CCAGTCCCCAGCACTGAGGAGGG + Intronic
1007356173 6:41319373-41319395 GTGGTCCCCAATCCTGAGAAGGG + Intergenic
1007686715 6:43671497-43671519 CCTGTCCCCAGCACTGAGCATGG + Exonic
1008141122 6:47833583-47833605 GTGCTTCCCAGCACTTTGGAGGG + Intergenic
1009413377 6:63392221-63392243 CTGGTTGGCAGCACTGAGGAAGG - Intergenic
1009581594 6:65541883-65541905 GTGCTCACCATCACGGAGGATGG + Intronic
1009790147 6:68391591-68391613 GTGGTTCCCAGCACTTTGGGAGG - Intergenic
1011263276 6:85490349-85490371 GTGGTTCCTGACACTGAGGAAGG - Intronic
1013038702 6:106412197-106412219 GTGGTGCCCCACAGTGAGGAAGG - Intergenic
1017719659 6:157235918-157235940 CTGGTCCCAAGCAGTGGGGAGGG + Intergenic
1018153357 6:160961469-160961491 GTCTGCCCCAGCTCTGAGGATGG + Intergenic
1018915935 6:168132349-168132371 CTGGTGCCCACCACTGGGGAAGG - Intergenic
1022016171 7:26350319-26350341 GAGGACCCCACCACTGAGGGAGG + Intronic
1022124765 7:27345152-27345174 CTGGAGCCCAGCACTGAGGCTGG - Intergenic
1022959980 7:35417275-35417297 TTGGTCCTCAGAACTTAGGAAGG + Intergenic
1023044573 7:36199754-36199776 GTGGTTCCCAACAGTGAGGGAGG + Intronic
1023202625 7:37715384-37715406 GTGGTCCCCAGCACTTTGGGAGG - Intronic
1023822201 7:43986527-43986549 GGGGTCCTGAGGACTGAGGATGG - Intergenic
1024116919 7:46203279-46203301 GTGGGACCCAGCACTCAGGACGG + Intergenic
1024543712 7:50500018-50500040 CAGGACCCCAGCACTGAGTAGGG + Intronic
1026354094 7:69542279-69542301 GTGGTCCCAATTACTCAGGAAGG - Intergenic
1026946517 7:74319698-74319720 GTAGTCCCAAGTACTCAGGAGGG + Intronic
1027262201 7:76472581-76472603 GTAATCCCCAGCACTTTGGAAGG - Intronic
1027313581 7:76970676-76970698 GTAATCCCCAGCACTTTGGAAGG - Intergenic
1029750467 7:102539941-102539963 GGGGTCCTGAGGACTGAGGATGG - Intronic
1029768419 7:102639049-102639071 GGGGTCCTGAGGACTGAGGATGG - Intronic
1029819960 7:103137191-103137213 GTGATCCCCAGCACTTTGGGAGG - Intronic
1030695106 7:112576593-112576615 GTAATCCCCAGTATTGAGGAAGG - Intergenic
1032460235 7:132104838-132104860 GAGCTCCCCAGCACAGAGGTGGG + Intergenic
1032679761 7:134169362-134169384 CTGGTCTCCAGAACTGTGGAAGG + Intronic
1033224301 7:139548488-139548510 GTGCTGGCCAGCCCTGAGGATGG + Intergenic
1033351216 7:140563715-140563737 GTGGATCCCAGCACTTTGGAAGG + Intronic
1035057151 7:156043329-156043351 GAGGTCCCCAGTAAGGAGGAAGG + Intergenic
1035911896 8:3576431-3576453 GTGGTACACAGTGCTGAGGAGGG - Intronic
1036215654 8:6877747-6877769 ATTGTCCCCAGCCCTGGGGATGG + Intronic
1037770858 8:21798698-21798720 GTGGTCCCCAGAACTCACCATGG - Intronic
1039615613 8:38952578-38952600 GAGGTGCCCAGCATTGTGGAGGG - Intronic
1039618294 8:38974420-38974442 GTGGTCCCCAGCGCGCAGGTGGG - Exonic
1040520542 8:48172714-48172736 GTGGCCCCCACCACTAAGGAAGG - Intergenic
1043950843 8:86307629-86307651 GTAATCCCCAGCACTTTGGAAGG + Intronic
1047311872 8:123698767-123698789 GAGGTCTCCAGCCCTGAGCAGGG - Intronic
1049424712 8:142532935-142532957 GTGGACCCAAGGACTCAGGAGGG - Intronic
1050251604 9:3750453-3750475 GTGGTCCCAGCCACTGGGGAGGG - Intergenic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1053089363 9:35259943-35259965 ATGGTTCCCAGCACTTTGGAAGG + Intronic
1053251029 9:36573937-36573959 CAGGTCCCTAGCACTTAGGACGG + Intronic
1056383012 9:86072464-86072486 GAGGTCCTCAGCACTGAGACAGG - Intronic
1057858855 9:98624147-98624169 GTGGTCCTGGGCACTGTGGAGGG + Intronic
1057911314 9:99022426-99022448 GGGTTCCCCATCTCTGAGGATGG + Intronic
1058374322 9:104305322-104305344 GAAGCCCCCACCACTGAGGAAGG - Intergenic
1059409126 9:114121074-114121096 TGGGTCCCCAATACTGAGGATGG + Intergenic
1061153684 9:128844285-128844307 GTATTCCCCAGCACTTTGGAAGG + Intronic
1061186391 9:129056911-129056933 ATGGTCCCAAGTACTCAGGAGGG + Intronic
1061492916 9:130956195-130956217 GTGGCCGCCCCCACTGAGGAGGG + Intergenic
1062029776 9:134356964-134356986 GGGGTGCCCAGCACTGGGCATGG - Intronic
1062553345 9:137100738-137100760 GTGGTCCCAACTACTGGGGAGGG - Intronic
1186105087 X:6196900-6196922 GAAATCCCAAGCACTGAGGAGGG + Intronic
1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG + Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1186795629 X:13044362-13044384 GTGGTCCCCAGGACCCAGGAGGG - Intronic
1190936015 X:54999992-55000014 GCGGTCCGCCGCACTGAGGGCGG + Intergenic
1191115125 X:56844445-56844467 GTGGATCCCAAGACTGAGGAGGG + Intergenic
1191715948 X:64193642-64193664 GTGGTCCCCTGAGCTTAGGATGG - Intronic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192710633 X:73581193-73581215 GTGTTCCCCATGACTGAAGAAGG + Intronic
1192988802 X:76428492-76428514 GTGGTGCCCACCCCTGATGAGGG + Exonic
1195616046 X:106912670-106912692 GTGCTCCCCAGCACTTTGGGAGG - Intronic
1200248854 X:154541675-154541697 GTGGTCCTCAGGAAAGAGGAGGG - Intronic
1200968170 Y:9120404-9120426 GTGGCCCCCAGTACTGAGGAGGG + Intergenic
1201902216 Y:19055195-19055217 GTAGTCCCCAGCACTTTGGGAGG + Intergenic
1202142570 Y:21743670-21743692 GTGGCACCCAGTACTGAGGAGGG - Intergenic
1202144288 Y:21761948-21761970 GTGGCACCCAGTACTGAGGAGGG + Intergenic