ID: 1175973968

View in Genome Browser
Species Human (GRCh38)
Location 20:62701154-62701176
Sequence CTGATGTTTTGGAGGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175973968_1175973972 -2 Left 1175973968 20:62701154-62701176 CCCTGTTTCCTCCAAAACATCAG No data
Right 1175973972 20:62701175-62701197 AGCTTTCTTTGTGTGTCTCTTGG No data
1175973968_1175973974 24 Left 1175973968 20:62701154-62701176 CCCTGTTTCCTCCAAAACATCAG No data
Right 1175973974 20:62701201-62701223 ATTTCTTTAAAGTTGCTGATGGG No data
1175973968_1175973973 23 Left 1175973968 20:62701154-62701176 CCCTGTTTCCTCCAAAACATCAG No data
Right 1175973973 20:62701200-62701222 GATTTCTTTAAAGTTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175973968 Original CRISPR CTGATGTTTTGGAGGAAACA GGG (reversed) Intergenic
No off target data available for this crispr