ID: 1175976241

View in Genome Browser
Species Human (GRCh38)
Location 20:62711731-62711753
Sequence GAGAGCCCACGCACGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175976241_1175976253 7 Left 1175976241 20:62711731-62711753 CCTCCCCGCGTGCGTGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175976253 20:62711761-62711783 TACTTGGGATTGGGCACCTGGGG 0: 1
1: 0
2: 2
3: 26
4: 182
1175976241_1175976251 5 Left 1175976241 20:62711731-62711753 CCTCCCCGCGTGCGTGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175976251 20:62711759-62711781 GGTACTTGGGATTGGGCACCTGG 0: 1
1: 0
2: 1
3: 8
4: 94
1175976241_1175976252 6 Left 1175976241 20:62711731-62711753 CCTCCCCGCGTGCGTGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175976252 20:62711760-62711782 GTACTTGGGATTGGGCACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1175976241_1175976249 -2 Left 1175976241 20:62711731-62711753 CCTCCCCGCGTGCGTGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175976249 20:62711752-62711774 TCTGCCAGGTACTTGGGATTGGG 0: 1
1: 0
2: 2
3: 27
4: 247
1175976241_1175976246 -9 Left 1175976241 20:62711731-62711753 CCTCCCCGCGTGCGTGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175976246 20:62711745-62711767 TGGGCTCTCTGCCAGGTACTTGG 0: 1
1: 0
2: 5
3: 47
4: 401
1175976241_1175976248 -3 Left 1175976241 20:62711731-62711753 CCTCCCCGCGTGCGTGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175976248 20:62711751-62711773 CTCTGCCAGGTACTTGGGATTGG 0: 1
1: 0
2: 2
3: 26
4: 198
1175976241_1175976247 -8 Left 1175976241 20:62711731-62711753 CCTCCCCGCGTGCGTGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175976247 20:62711746-62711768 GGGCTCTCTGCCAGGTACTTGGG 0: 1
1: 0
2: 3
3: 34
4: 286
1175976241_1175976254 8 Left 1175976241 20:62711731-62711753 CCTCCCCGCGTGCGTGGGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175976254 20:62711762-62711784 ACTTGGGATTGGGCACCTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175976241 Original CRISPR GAGAGCCCACGCACGCGGGG AGG (reversed) Intronic
900149472 1:1171833-1171855 GAGAGCTCTCGGAAGCGGGGCGG - Intergenic
900270099 1:1782609-1782631 GTGCGCCCGCGCAAGCGGGGCGG + Intergenic
903134903 1:21302966-21302988 TAGAGCCCAGGCCCGGGGGGTGG - Intronic
906685025 1:47757656-47757678 GGGAGCCCATGCACTCTGGGAGG - Intergenic
912949988 1:114113947-114113969 GAGAGCCCTGGCACGGGGGGAGG - Intronic
922426115 1:225496279-225496301 GAGAGCACACACACGCAGAGTGG + Exonic
1066023132 10:31321112-31321134 GGGAGCCCAGGCGCGGGGGGTGG - Intronic
1068185378 10:53578490-53578512 GAGAACACACGGACACGGGGAGG + Intergenic
1070309335 10:75261951-75261973 GAGAGCCCACGGAGGCAGCGGGG + Intergenic
1071309506 10:84328976-84328998 GCGAGCCGCCGGACGCGGGGCGG + Intronic
1073424042 10:103445598-103445620 GAGTGCCCAGGCACTCGAGGCGG - Exonic
1073457931 10:103648829-103648851 GTGTGCACACGCACGCGAGGGGG - Intronic
1073789735 10:106928188-106928210 AGGAGCCCACGAAGGCGGGGAGG + Intronic
1075568221 10:123520076-123520098 GAGAGCTCCTGCACGCAGGGCGG + Intergenic
1077514143 11:2991844-2991866 CACAGCCCCCGCACGCGGGGCGG + Intronic
1081578270 11:44333319-44333341 GAGAGCACATGGACACGGGGAGG - Intergenic
1085863170 11:80257838-80257860 GGGAGCCCACGGATGGGGGGAGG - Intergenic
1087569299 11:99904331-99904353 GAGAACACACGGACACGGGGAGG - Intronic
1089603847 11:119630366-119630388 GAGGGCTCCCGCACGCCGGGAGG + Intronic
1092222442 12:6724199-6724221 GGGAGCCCACGGTCGCTGGGCGG + Intronic
1101144796 12:101830869-101830891 GGGAGCCCACGCCCTCGGCGCGG + Exonic
1101772134 12:107761180-107761202 GAGGGCGCACGCACGAGGGGCGG - Intronic
1103607306 12:122096868-122096890 GAGAGCTCACGCCAGCTGGGGGG - Intronic
1104489005 12:129177962-129177984 GAGAGCCCATGGACACAGGGAGG - Intronic
1108734371 13:53267250-53267272 GAGAACACACGGACACGGGGAGG - Intergenic
1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG + Intronic
1122665487 14:103326805-103326827 CAGAGCCCACGCACACCTGGAGG + Intergenic
1122665558 14:103327090-103327112 GAGAGCACACGCACACCTGGAGG + Intergenic
1126102881 15:45130121-45130143 GAGCGCCCAGGCCCGCGGGCCGG - Intronic
1127404186 15:58623764-58623786 GAGAGCACATGCACACAGGGAGG + Intronic
1127766027 15:62186647-62186669 AAGAGCCCACGGAAGCGGGGAGG + Intergenic
1129299038 15:74615163-74615185 GAGAGGCCACGCAGGCCGGCAGG + Exonic
1130397473 15:83515510-83515532 GGGAGCCCATGCAGGTGGGGGGG + Intronic
1132908597 16:2297169-2297191 GAGAGCCCAACCAGGCAGGGGGG - Intronic
1133176547 16:4019492-4019514 GAGTGCCCAAGCACGAGAGGAGG + Intronic
1137551546 16:49440834-49440856 AACAGCCCACGCACGGGGGTGGG + Intergenic
1139069724 16:63365261-63365283 GAGAGCTCATGCATACGGGGAGG + Intergenic
1140260905 16:73378731-73378753 GAGAGCCAAAGCATGGGGGGAGG - Intergenic
1141189229 16:81811559-81811581 GAGAACCCATGCACACAGGGAGG - Intronic
1141589079 16:85055871-85055893 GAGAGCCCACGCTTGTTGGGAGG - Intronic
1143321146 17:6070224-6070246 GCGAGAACACGCGCGCGGGGCGG - Intronic
1147455869 17:40537751-40537773 GAGAGCCCACGCAAAGGTGGAGG + Intergenic
1148725817 17:49789155-49789177 CACCGCCCCCGCACGCGGGGAGG - Intronic
1150108271 17:62478162-62478184 GGGAGCCCGCGAACGCGGGTGGG + Intronic
1151426440 17:74033819-74033841 CAGAGCCCACCCAAGCTGGGTGG + Intergenic
1161556217 19:4944288-4944310 GTGAGCCCTGGCAGGCGGGGAGG - Intronic
1161813120 19:6481964-6481986 GAGGGCCCAGGCACGATGGGGGG - Intronic
1162778787 19:12996008-12996030 GGGAGCCCAGGCACGCGTGCGGG + Intronic
1163639130 19:18451568-18451590 GAGCGCCCACGCTCGCCTGGGGG + Exonic
1164536105 19:29087609-29087631 GACAGGCCCCGCACCCGGGGAGG + Intergenic
1166732898 19:45068583-45068605 GAGAGGCCACGCAGGCACGGAGG + Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
930571155 2:53088618-53088640 GAGAACCCACGGACACAGGGAGG - Intergenic
937181176 2:119997265-119997287 AGGAGCCCACGGAAGCGGGGTGG - Intergenic
938364130 2:130720578-130720600 GAGAGCCTACGCACACTAGGAGG + Intergenic
940555893 2:155228004-155228026 GAGAACACACGCACACAGGGAGG - Intergenic
943136877 2:183924798-183924820 GAGAGCCCATGGACACAGGGAGG + Intergenic
948705810 2:239791933-239791955 GAGAGCCCAGGCAGACGAGGTGG + Intronic
1169330587 20:4713103-4713125 GAGAACCCACGGACACAGGGAGG - Intergenic
1170719927 20:18867614-18867636 GAGAACACACGGACGCAGGGAGG - Intergenic
1170935424 20:20805320-20805342 GAGAGCCCAAGAACCCGTGGTGG - Intergenic
1171414059 20:24965607-24965629 GAGAGCCCATGCAAGTGAGGAGG + Intronic
1174436373 20:50510123-50510145 GAGAGCCCACGCGCCGTGGGCGG + Intergenic
1175176722 20:57117003-57117025 GAGAGCAGATGCACGCGGAGGGG - Intergenic
1175852639 20:62101967-62101989 CAGAGCCCAGGCACACAGGGTGG - Intergenic
1175958216 20:62622126-62622148 GGGAGACCACGCACGGGAGGAGG + Intergenic
1175976241 20:62711731-62711753 GAGAGCCCACGCACGCGGGGAGG - Intronic
1177170743 21:17653088-17653110 GAGAGCACACGGACACAGGGAGG + Intergenic
1177244455 21:18504491-18504513 GAGAACACATGCACGCAGGGAGG + Intergenic
1180423406 22:12891875-12891897 GAGAACCCATGCACACAGGGAGG - Intergenic
1182586292 22:31345981-31346003 AAGGGCACGCGCACGCGGGGAGG + Exonic
1185340101 22:50287334-50287356 GTGCGCCCACACACGCAGGGAGG - Intronic
960550776 3:118973902-118973924 GAGAACACACGCACACAGGGAGG + Intronic
967554031 3:190833757-190833779 GAGTGCACACACACGCAGGGTGG - Intergenic
1202747534 3_GL000221v1_random:120641-120663 GAGAACCCATGCACACAGGGAGG + Intergenic
968418932 4:466228-466250 GAGTGCACACGCATGCAGGGTGG - Intronic
969066451 4:4485666-4485688 CAGAGCTCACACACGCTGGGTGG + Intronic
969304391 4:6317496-6317518 CAGAGCCCAAGCCCGCGGTGGGG - Intergenic
972321537 4:37977308-37977330 GAGAGGTCGCGCCCGCGGGGCGG - Intronic
975792904 4:77973967-77973989 GAGAGCACATGGACGCAGGGAGG + Intergenic
976532791 4:86174418-86174440 GAGAGCACATGGACGCAGGGAGG + Intronic
977908316 4:102501743-102501765 GAGAGCCCACCCGCGCCAGGAGG + Exonic
979876515 4:125898434-125898456 GAGAGCACATGGACGCAGGGAGG + Intergenic
982875291 4:160640584-160640606 GAGAACACACGGACACGGGGAGG + Intergenic
984790812 4:183612884-183612906 CAGAGCCCATGCACCCGGGGTGG - Intergenic
985638586 5:1052599-1052621 GAGAGACCCCCCAGGCGGGGAGG + Intronic
995136636 5:108686227-108686249 GCGAGCCCAAGCAAGCAGGGTGG - Intergenic
995500030 5:112794610-112794632 CACAGCACACGCACACGGGGTGG - Intronic
998018881 5:138753526-138753548 GAGAGACCGCGCCCGCGAGGAGG - Intronic
999564899 5:152847885-152847907 GAGAGCCCATGGACGCAGAGAGG - Intergenic
1015935707 6:138404416-138404438 GCGCGCACACGCAGGCGGGGCGG + Exonic
1018400688 6:163415803-163415825 GAGAGCTCCCGAACGCGGGGCGG - Intronic
1019203076 6:170335247-170335269 GAGAGCACACGGACACAGGGAGG - Intronic
1019340116 7:504884-504906 GGGAGCCCACGCGCCCGCGGTGG - Intronic
1020853802 7:13391533-13391555 GAGAGCACACGGACACAGGGAGG + Intergenic
1023316843 7:38946767-38946789 GAGAACACATGGACGCGGGGAGG - Intergenic
1024972019 7:55079225-55079247 GAGAGGCCAGGCACGGGGTGTGG + Intronic
1031027093 7:116691623-116691645 GAGAGCCCAGACACGGAGGGAGG - Intronic
1031409242 7:121422006-121422028 CGGAGCCCACGGAAGCGGGGAGG - Intergenic
1031513493 7:122675770-122675792 GAGAACACATGCACGCAGGGAGG + Intronic
1032032772 7:128498293-128498315 GAGAACACATGGACGCGGGGTGG + Intronic
1032037316 7:128530696-128530718 GGGAGCCCGCGAACGCGGGTGGG + Intergenic
1038633470 8:29266910-29266932 GAGAGCCCAGCCAGGCGCGGTGG + Intergenic
1040014514 8:42689791-42689813 AGGAGCCCACGGAGGCGGGGTGG - Intergenic
1049164094 8:141116114-141116136 GAGAGCCCTCGGAAGCTGGGAGG - Intergenic
1050517374 9:6459018-6459040 GAGAACCCATGGACGCAGGGAGG + Intronic
1051241545 9:15062132-15062154 GAGAGCCCATGGACACAGGGAGG - Intergenic
1059208376 9:112487125-112487147 GAGAGCCCGCGCGCGGGGCGGGG + Exonic
1059950890 9:119461459-119461481 GAGAGCCAAGGCCCGAGGGGAGG - Intergenic
1203716170 Un_KI270742v1:150732-150754 GAGAACCCATGCACACAGGGAGG + Intergenic
1185736514 X:2500540-2500562 GGGAGGCCACACGCGCGGGGAGG + Intronic
1185749955 X:2603019-2603041 GAGAGCACATGGACACGGGGAGG + Intergenic
1193479660 X:82011286-82011308 GAGAACCCACGGACACAGGGAGG - Intergenic
1194355126 X:92873689-92873711 TAGAGCCCACTCACACCGGGAGG - Intergenic
1198123190 X:133615555-133615577 GAGAGCACATGGACGCAGGGAGG + Intronic