ID: 1175976431

View in Genome Browser
Species Human (GRCh38)
Location 20:62712645-62712667
Sequence GTGCCAGCAGGGTGACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 352}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175976422_1175976431 -7 Left 1175976422 20:62712629-62712651 CCCAGACCTGGCCCTGGTGCCAG 0: 1
1: 0
2: 2
3: 57
4: 443
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976411_1175976431 20 Left 1175976411 20:62712602-62712624 CCTGGTGCCCAGGACCCTCCCAA 0: 1
1: 0
2: 3
3: 30
4: 329
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976413_1175976431 13 Left 1175976413 20:62712609-62712631 CCCAGGACCCTCCCAAAGGCCCC 0: 1
1: 0
2: 6
3: 183
4: 2964
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976423_1175976431 -8 Left 1175976423 20:62712630-62712652 CCAGACCTGGCCCTGGTGCCAGC 0: 1
1: 0
2: 1
3: 40
4: 540
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976416_1175976431 5 Left 1175976416 20:62712617-62712639 CCTCCCAAAGGCCCCAGACCTGG 0: 1
1: 0
2: 2
3: 34
4: 355
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976414_1175976431 12 Left 1175976414 20:62712610-62712632 CCAGGACCCTCCCAAAGGCCCCA 0: 1
1: 0
2: 6
3: 191
4: 1111
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976415_1175976431 6 Left 1175976415 20:62712616-62712638 CCCTCCCAAAGGCCCCAGACCTG 0: 1
1: 0
2: 2
3: 50
4: 429
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976419_1175976431 1 Left 1175976419 20:62712621-62712643 CCAAAGGCCCCAGACCTGGCCCT 0: 1
1: 0
2: 6
3: 48
4: 451
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976421_1175976431 -6 Left 1175976421 20:62712628-62712650 CCCCAGACCTGGCCCTGGTGCCA 0: 1
1: 0
2: 5
3: 48
4: 426
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352
1175976418_1175976431 2 Left 1175976418 20:62712620-62712642 CCCAAAGGCCCCAGACCTGGCCC 0: 1
1: 0
2: 3
3: 24
4: 323
Right 1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175976431 Original CRISPR GTGCCAGCAGGGTGACTGGG AGG Intronic
900009937 1:96874-96896 GTTCCAGCAGGCTAACTGGGTGG + Intergenic
900026049 1:273458-273480 GTTCCAGCAGGCTAACTGGGTGG + Intergenic
900035832 1:407313-407335 GTTCCAGCAGGATAACTGGGTGG + Intergenic
900057454 1:643063-643085 GTTCCAGCAGGATAACTGGGTGG + Intergenic
900342464 1:2195369-2195391 GTGGCACCAGGGTGCCTGGGCGG - Intronic
900922713 1:5683734-5683756 GTGCCACCAGGGTCTCTGGCAGG - Intergenic
901321940 1:8345365-8345387 GCGACAGCAGCGTGTCTGGGTGG + Intergenic
902468684 1:16633125-16633147 GTGCCAGGAGGGTCCCTGGTGGG - Intergenic
902538568 1:17136294-17136316 GTGGATGCAGGGGGACTGGGAGG - Intergenic
902658079 1:17883183-17883205 GTGCCAGCTGACTGTCTGGGAGG + Intergenic
902938842 1:19785107-19785129 GTCCCAGCAGGGAGAATGGCAGG - Intronic
903347330 1:22695091-22695113 GTTCCAGCAGGGTGCCCAGGAGG + Intergenic
903487390 1:23700619-23700641 GTTCAAGCAGGGTAACTGAGAGG - Intergenic
904318255 1:29680011-29680033 GACCCTGCAGGGTGAGTGGGTGG + Intergenic
904352260 1:29916253-29916275 GTGCCAGCAGGATCAGTGTGTGG + Intergenic
905301402 1:36988458-36988480 CTGCCAGCAGGGCCTCTGGGCGG - Intronic
905310028 1:37042737-37042759 GAGGCAGCAGGGGGACTGTGCGG + Intergenic
905923155 1:41732440-41732462 TCCCCAGCAGGGTGACTGAGGGG + Intronic
906052386 1:42886500-42886522 GTCCCAGCGGGGTCACTGGGAGG + Intergenic
906270335 1:44472838-44472860 GGGCCAGCAGGGTGACGGGATGG + Intronic
907193521 1:52668064-52668086 ATGGCAGCAGGGTGGCTGGGAGG + Intronic
908754981 1:67461258-67461280 ATGCCAACAGGGTAACGGGGAGG + Intergenic
909608911 1:77532790-77532812 GTGCCAGCAGGGTGATGTTGGGG + Intronic
911105295 1:94125857-94125879 CTGCCAGCAGGTTGACTGCCTGG + Intergenic
911950711 1:104170659-104170681 GTGCCAGCAGGTTGGGTGGTGGG + Intergenic
912519403 1:110234873-110234895 TTGCTAGCTGGGTGACTTGGGGG + Intronic
917291433 1:173476275-173476297 GTGCCTAGAGGGTGACTGGGGGG - Intergenic
920298105 1:204971975-204971997 GTGTAAGGAGAGTGACTGGGGGG + Intronic
920323193 1:205140415-205140437 GTGCCAGCAGGGTCACTATCTGG - Intergenic
922258367 1:223912881-223912903 GTTCCAGCAGGCTAACTGGGTGG + Intergenic
922776126 1:228214956-228214978 GTGCCACGAGGCTGAATGGGTGG + Exonic
1063220568 10:3963473-3963495 GTGGCAGCTGGGTGACTAAGTGG + Intergenic
1063871777 10:10424931-10424953 GTGACCTCAGGGTGACGGGGTGG + Intergenic
1065158252 10:22893310-22893332 GGGTCAGGAGTGTGACTGGGAGG - Intergenic
1065859457 10:29859342-29859364 CTGCCAGCAGGGCAGCTGGGAGG - Intergenic
1067380142 10:45765373-45765395 TTGCCCACAGGGTGACTGGATGG + Intronic
1067569464 10:47360807-47360829 GTGCCTGCAGGGAGAATGGGAGG - Intergenic
1067881367 10:50048617-50048639 TTGCCCACAGGGTGACTGGATGG - Intergenic
1067887843 10:50106028-50106050 TTGCCCACAGGGTGACTGGATGG + Intronic
1068209859 10:53907418-53907440 GAGCCAGAAGGGAGACTGGAGGG - Intronic
1068848341 10:61706720-61706742 ATGCTGGCAGGGTGCCTGGGTGG + Intronic
1069275477 10:66586443-66586465 AGGTCAGCAGTGTGACTGGGAGG - Intronic
1069626604 10:69871701-69871723 GTGACAGCAGGGTCTCTGGAGGG + Intronic
1069704279 10:70447981-70448003 ATGCCAGCAGAGTCACTGGATGG - Intergenic
1069727887 10:70592925-70592947 GTGGCTGCAGGGTGAGTGAGGGG + Intergenic
1069740062 10:70681768-70681790 AAGCCAGCTGGGTGTCTGGGAGG - Intronic
1071882189 10:89911361-89911383 GTGCCAGCAAGGTGATGTGGGGG + Intergenic
1072248749 10:93565590-93565612 GTGGCAGGAGGGTGGCTGGTTGG + Intergenic
1072440307 10:95448356-95448378 GTGCCAGCACAGTGGCTGGAGGG - Intronic
1072641529 10:97214687-97214709 GTGCCGCCAGGGTTACTGTGAGG - Intronic
1075405634 10:122193871-122193893 GTGGAAGCAGGGTGATGGGGAGG + Intronic
1076081000 10:127580587-127580609 ATGCCAGCGGGGTAGCTGGGAGG - Intergenic
1076342292 10:129757917-129757939 GTGGCAGGAGGGTGACTTTGGGG - Intronic
1076723209 10:132401718-132401740 GTGCCTCCAGGCTGAGTGGGTGG - Intronic
1076794297 10:132791269-132791291 AAGCCAGCAGGGAGACTGGAAGG - Intergenic
1077066797 11:644675-644697 ATGTCAGCAGGGTCAGTGGGTGG + Intronic
1077183709 11:1227403-1227425 GTGCCACCTGGGTGAGGGGGCGG + Intronic
1077219774 11:1410794-1410816 GTGCCTGCCGGGTGGCGGGGGGG - Intronic
1077332088 11:1988255-1988277 GAGCCAGCAGGGGGGCTGTGGGG - Intergenic
1078930130 11:15906222-15906244 GTGTCAGCAAGGTGTCTTGGAGG - Intergenic
1079513943 11:21244773-21244795 CTGCAAGCAAGGTGACTGAGTGG + Intronic
1079974534 11:27075593-27075615 GGGTCAGGAGTGTGACTGGGAGG - Intronic
1083944358 11:65915845-65915867 ATGCCACCGGGCTGACTGGGTGG - Intergenic
1084032710 11:66490509-66490531 GAGACAAGAGGGTGACTGGGAGG - Intronic
1084412834 11:69014020-69014042 GAGCCAGCAGGGTGGCCAGGAGG + Intergenic
1084679918 11:70660966-70660988 GCGCGTGCAGGGTGACTGGCAGG + Intronic
1084781693 11:71413960-71413982 GTGCCTGCAGAGGGAGTGGGAGG + Intergenic
1085083424 11:73651559-73651581 GTTCTAACAGGGTAACTGGGAGG + Intronic
1085305966 11:75486287-75486309 GTCCCAGGAGGGTGACTGTCAGG - Intronic
1085696374 11:78708283-78708305 TGGCCAGCAGGCTGGCTGGGTGG + Intronic
1085984775 11:81772326-81772348 GGGCCTGCAGGGAGAGTGGGTGG + Intergenic
1086838361 11:91653778-91653800 GTTCCTGCAGGGTGGGTGGGGGG + Intergenic
1087757728 11:102073125-102073147 GTGCCAGCAGTGTTAGTGGTGGG + Intronic
1088009392 11:104981017-104981039 ATGCCAACAGGGAGGCTGGGGGG - Intergenic
1088626383 11:111733311-111733333 GAGCCAGCACAGTGTCTGGGAGG + Intronic
1089065054 11:115656428-115656450 CTCCCAGGAGGGGGACTGGGAGG - Intergenic
1089297777 11:117480411-117480433 GGGCCAGGAGGGTGACAGCGTGG - Intronic
1089325852 11:117656307-117656329 GTGACAGCAGGGTTACCTGGTGG - Intronic
1089387396 11:118077295-118077317 GAGCCAGCATGGTGAGTGTGGGG + Exonic
1091271102 11:134312493-134312515 GGGCCAGCAGGCTGTCTGTGTGG + Intronic
1202815069 11_KI270721v1_random:43431-43453 GAGCCAGCAGGGGGGCTGTGGGG - Intergenic
1091432010 12:444213-444235 GTTTCAGCAGAGTGACTGTGAGG + Intergenic
1091613480 12:2031397-2031419 GTGGCAGCACGGTGAATGGGGGG + Intronic
1091796868 12:3302337-3302359 GTGGCAGCAGGGGGACTGGGTGG + Intergenic
1092052983 12:5486102-5486124 GTGGCAGCAGGGAGACAGGAGGG + Intronic
1092529383 12:9331887-9331909 GTGGCTGCAGGGAGGCTGGGGGG + Intergenic
1092878939 12:12872855-12872877 GAGTCAGCAGGGTGACTGCTGGG + Intergenic
1094564622 12:31589147-31589169 GTGGCACCAGGGTCACTTGGAGG - Intronic
1096897581 12:54839598-54839620 TGGTCAGCAGTGTGACTGGGAGG - Intronic
1096909291 12:54966073-54966095 CTTCCAGCAGCATGACTGGGGGG - Exonic
1096995064 12:55833235-55833257 GTGCCAGCTGGGGGGCTGGTGGG + Intergenic
1103012950 12:117471398-117471420 GTGCCAGGAGACTGGCTGGGTGG - Intronic
1104047448 12:125173319-125173341 GCCCCAGGTGGGTGACTGGGTGG + Intergenic
1104741424 12:131177610-131177632 GTGTCAGGAGTATGACTGGGAGG + Intergenic
1104974655 12:132546964-132546986 GTGCCAGCCGGATGTGTGGGCGG - Intronic
1105844018 13:24279467-24279489 GTGGCAGCAGGGAGACCAGGAGG + Intronic
1106565751 13:30883201-30883223 GAGCCAGCAGGGTCCATGGGAGG - Intergenic
1107696238 13:43002880-43002902 GTGGAAGCAGGGAGACTGGTTGG + Intergenic
1109395530 13:61753595-61753617 GTTCCAGAAGCATGACTGGGAGG - Intergenic
1113075972 13:106468419-106468441 GTGCCAGCTGGCAGACTGGCCGG - Intergenic
1113552452 13:111203881-111203903 GTGCCTGCAGGGTGGGTGGCTGG + Intronic
1113931147 13:113969660-113969682 ATGGCAGGAGGGTGAGTGGGTGG + Intergenic
1113962424 13:114133130-114133152 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962443 13:114133172-114133194 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962461 13:114133213-114133235 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962478 13:114133251-114133273 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962496 13:114133290-114133312 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962514 13:114133329-114133351 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962533 13:114133371-114133393 GGGTCTGCAGGGGGACTGGGTGG - Intergenic
1113962546 13:114133410-114133432 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962596 13:114133528-114133550 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962650 13:114133647-114133669 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962666 13:114133686-114133708 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1113962735 13:114133846-114133868 GGGTCTGCAGGGGGACTGGGGGG - Intergenic
1114365975 14:22027369-22027391 GGGCCAGCAGTATGACTGGGAGG + Intergenic
1115213937 14:30996250-30996272 TTGTCAGCTGGGTGACTAGGTGG - Intronic
1118329109 14:64802020-64802042 TTGCCTGCAGGCAGACTGGGGGG - Intronic
1118771192 14:68943807-68943829 TTGCCAGCTGTGTGACTGTGGGG - Intronic
1119253560 14:73178900-73178922 GTCCCAGACTGGTGACTGGGTGG - Intronic
1119704228 14:76774084-76774106 GAGCCAAGAGGGTGACGGGGAGG + Intronic
1120328323 14:83056198-83056220 GTGGCAGCATGGTGTCTGGTTGG - Intergenic
1121690046 14:95871713-95871735 AAGCCAGAAGGGTGACTGGCTGG - Intergenic
1122264365 14:100539757-100539779 GCTCCAGCAGCATGACTGGGGGG - Intronic
1122724208 14:103739831-103739853 GTGGCAGGAGGGTGGCTGGCAGG + Exonic
1123424194 15:20155950-20155972 GTGAGTGCAGAGTGACTGGGAGG + Intergenic
1123533415 15:21162479-21162501 GTGAGTGCAGAGTGACTGGGAGG + Intergenic
1124929140 15:34101878-34101900 GTGGCGGCCGGGAGACTGGGAGG - Exonic
1125726221 15:41869614-41869636 GTGCCAGCAAGGTGAGTGGCAGG - Intronic
1126660010 15:51023691-51023713 GTGGCAGCAGGTTGGCTGTGGGG + Intergenic
1127585780 15:60376584-60376606 GTGCCAGGAGGCAGACTGGCTGG + Intronic
1127854468 15:62943145-62943167 GTGCTAGCAGGCTGAGTGGGAGG + Intergenic
1128327416 15:66734051-66734073 AACCCAGCATGGTGACTGGGAGG + Intronic
1128629830 15:69253320-69253342 GTTCCCACAGGGTGAGTGGGTGG - Intronic
1129393881 15:75234032-75234054 CTGCCACCCGGGGGACTGGGGGG + Intergenic
1131059539 15:89396042-89396064 GGGCCCACAGGGGGACTGGGTGG - Intergenic
1131254477 15:90852954-90852976 GGGCCAGCAAGGTGACTCGAAGG + Intergenic
1132323117 15:100941901-100941923 TCACCAGCAGGGCGACTGGGAGG - Intronic
1132744835 16:1432261-1432283 GGCCCAGGATGGTGACTGGGTGG - Intergenic
1132958352 16:2608602-2608624 GTGGCAGCAGGGGGACTGGCAGG - Intergenic
1132970964 16:2688698-2688720 GTGGCAGCAGGGGGACTGGCAGG - Intronic
1133890848 16:9877476-9877498 GTGCCACCAGGGTCTCTGGGTGG - Intronic
1134849533 16:17469563-17469585 GGGCCATCTGGGTGGCTGGGTGG - Intronic
1136121298 16:28136955-28136977 CTGCCAGCAGGGACACTGGAGGG + Intronic
1136860672 16:33699936-33699958 GTGAGTGCAGAGTGACTGGGAGG - Intergenic
1137578907 16:49621624-49621646 GTGGCACCAGGGGGACTTGGTGG - Intronic
1137757675 16:50915386-50915408 GGGCCAGCAGGGTCCATGGGGGG + Intergenic
1138482201 16:57310936-57310958 GTGCCAGCAGGGGCACAGGTGGG + Intergenic
1140067628 16:71625165-71625187 GTGGAAGGTGGGTGACTGGGTGG + Intergenic
1140480677 16:75261375-75261397 CAGCCAGGAGGGTGAGTGGGGGG - Intronic
1141562539 16:84879055-84879077 GGCCCAGGAGGGTGACTGGTTGG + Intronic
1142175899 16:88645176-88645198 GTGGCAGCAGGGAGACGGGGGGG + Intronic
1142303765 16:89274360-89274382 GGGACAGCAGGGACACTGGGTGG - Intronic
1142454393 16:90210030-90210052 GTTCCAGCAGGCTAACTGGGTGG - Intergenic
1203122171 16_KI270728v1_random:1548119-1548141 GTGAGTGCAGAGTGACTGGGAGG - Intergenic
1142808497 17:2384443-2384465 ATGCCTGGAGGGTAACTGGGGGG - Exonic
1143767837 17:9149265-9149287 GTGGCAGCAGGGTGTGTGTGGGG - Intronic
1143849890 17:9802959-9802981 CTGCCACCAGGGTGGCTGTGAGG + Intronic
1145253167 17:21307511-21307533 GTGCCTGCTGTGTGCCTGGGTGG + Intronic
1145323404 17:21780407-21780429 GTGCCTGCTGTGTGCCTGGGTGG - Intergenic
1146479470 17:33193374-33193396 CTGCCATCAGGCTGCCTGGGTGG + Intronic
1146756712 17:35439042-35439064 GTGCCAGCAGGGTGGGGGGGGGG + Exonic
1147217260 17:38908169-38908191 GTGCCAGCAGGGGGCCTGCAGGG - Intronic
1147626810 17:41905708-41905730 GTGGCAGCCTGGTGCCTGGGAGG + Intronic
1147945380 17:44077573-44077595 GTGCCAGCAGAGGGGCAGGGAGG + Exonic
1148079029 17:44957369-44957391 GTGCGTGCAGGCTGACTGGCTGG - Intergenic
1148465024 17:47859815-47859837 TTCCAAGCAGGGTGACAGGGTGG - Intergenic
1148875234 17:50683375-50683397 GGGCAAGCAGGGAGACTGGGAGG + Intronic
1150343428 17:64386840-64386862 GGGCCAGTAGGAGGACTGGGAGG + Intronic
1150644441 17:66969271-66969293 ATGGCAGCACGGGGACTGGGTGG - Intronic
1151596152 17:75079045-75079067 GTGCCAGGAGGAAGACTGTGGGG - Intergenic
1151743044 17:75996947-75996969 TTGGCAGCAGGGAGACAGGGAGG - Intronic
1152066052 17:78113071-78113093 GTCCCAGCAGGGTCACTGGGAGG + Exonic
1152235774 17:79137612-79137634 GCGCCAGCAGCTTGGCTGGGAGG - Intronic
1152292489 17:79448067-79448089 GTACCAGAAGCGTGGCTGGGAGG - Intronic
1152351089 17:79784438-79784460 GTGCCAGCAGGGTGCCTGCTGGG + Exonic
1155680614 18:28481751-28481773 GTGGCAGCATGGTGTCTGGTTGG - Intergenic
1159592683 18:70352041-70352063 GTGCCAGCAGGGTCAGTGTCTGG - Exonic
1159713123 18:71788205-71788227 GTGCTACCATGGTGACTGGCTGG - Intergenic
1160540862 18:79621703-79621725 GTGGCAGCAGGATGATGGGGTGG - Intergenic
1160777597 19:863082-863104 GTTCCGGCAGGGTGACTCCGGGG + Exonic
1160899675 19:1421456-1421478 GTCCCAGTAGGGTGGTTGGGCGG + Intronic
1161067957 19:2247809-2247831 GGGCCAGCAGGGAGGCTGGGTGG - Exonic
1161331834 19:3692300-3692322 GAGCCGGCAGTGGGACTGGGTGG - Intronic
1161596289 19:5152606-5152628 GTGACAGCAGCGTGGGTGGGTGG - Exonic
1162986564 19:14274166-14274188 TTGCCAGGAGGGTTACAGGGTGG + Intergenic
1163544324 19:17932083-17932105 GTCCCAGCAAGGTCGCTGGGGGG + Intergenic
1163655837 19:18544166-18544188 GAGCCAGCAGGGCCACTGGGAGG + Intergenic
1164913860 19:32034074-32034096 CTGGCTGCAGGGTGGCTGGGAGG - Intergenic
1165837364 19:38767372-38767394 GTGCCAGGGGTGTGGCTGGGAGG + Intronic
1167605969 19:50481377-50481399 GGGGCAGCAGGGTGCCTGGGAGG + Intronic
1167900984 19:52622110-52622132 GTGACAGCAGGGTTACAGGGTGG - Intronic
1168469603 19:56629609-56629631 GTGCCAGCAGAGTCAGTGTGTGG - Intergenic
1168646757 19:58064109-58064131 GTGCCTGTAGGGTGATTGGTAGG + Intronic
1168659570 19:58155243-58155265 GTGGCAGCAGGGAGGCTGTGGGG + Intergenic
925374926 2:3377632-3377654 GTTCCAGGTGGGTCACTGGGAGG - Exonic
925834220 2:7928521-7928543 GGGCCAGCAGGGTGCCTGTGAGG + Intergenic
926118127 2:10225997-10226019 GTGTCAGCAGGGGCATTGGGAGG - Intergenic
926252150 2:11160907-11160929 GTGCCAGCAGGCCGAGTGGAAGG + Intronic
926750897 2:16197689-16197711 TCTCCAGCAGGGTGACTGGCTGG - Intergenic
927942376 2:27113047-27113069 CTGCCTACAGGGTGCCTGGGAGG + Intronic
928270178 2:29848698-29848720 GTGCCAGGAGGGTGAGGTGGGGG + Intronic
931286403 2:60835547-60835569 GTGCCTGCATTGTGACTTGGAGG + Intergenic
931286407 2:60835575-60835597 GTGCCTGCATTGTGACTTGGAGG + Intergenic
932472823 2:71973751-71973773 GTCCCAGGAGGCTGACTTGGAGG - Intergenic
932735612 2:74252142-74252164 AGGACAGCAGGGTCACTGGGAGG + Intronic
933750569 2:85600171-85600193 CAGCCAGCAGGGTGGCTGTGTGG + Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
933779101 2:85789026-85789048 GTGCCATCAGGGTTACTCAGAGG - Intergenic
934459052 2:94201089-94201111 GTGAGTGCAGAGTGACTGGGAGG - Intergenic
934567894 2:95350655-95350677 GTGTCATCAGGGTAAGTGGGTGG + Intronic
935067363 2:99661234-99661256 CTGCCAGCAGGGTTGCTGGTTGG - Intronic
935123813 2:100205182-100205204 GTGTCAGCATGAAGACTGGGAGG + Intergenic
935800980 2:106696015-106696037 AAGTCACCAGGGTGACTGGGAGG + Intergenic
935920370 2:108006251-108006273 GGGACAGAAGGGTGTCTGGGTGG - Intronic
936885688 2:117308321-117308343 GAGTCAGGAGTGTGACTGGGAGG - Intergenic
938102268 2:128505166-128505188 GTCCCAGGGGGGTGACTGGAGGG - Intergenic
940140473 2:150486458-150486480 GTGCCCGCAGGGTGACCCCGCGG - Intronic
942276518 2:174327449-174327471 GTGGCAGCAGGGCGAGGGGGAGG + Intergenic
944573776 2:201071605-201071627 GAGACAGCAGGGTGACAGGTAGG - Exonic
947727859 2:232410886-232410908 GTGTCAGCAGGCTGTCTGGGAGG + Intergenic
948484565 2:238272277-238272299 GTCCAGGCTGGGTGACTGGGAGG + Intronic
949085851 2:242154685-242154707 GTTCCAGCAGGCTAACTGGGTGG - Intergenic
1169090702 20:2859905-2859927 ATCTCAGCAGGGTGAGTGGGGGG - Intronic
1169217748 20:3803264-3803286 TTGCCAAGAGGGTGAATGGGTGG + Intronic
1170565799 20:17603584-17603606 GTGCAAGCAGTCTGAGTGGGAGG + Intronic
1170762458 20:19262928-19262950 ATGGCAGCAGGATGAGTGGGTGG - Intronic
1171317256 20:24206075-24206097 GTGGCAGCAGGGTAGCTGGGAGG + Intergenic
1171393709 20:24817542-24817564 GAGCCAGCAGGGCGCCTGTGGGG - Intergenic
1172161293 20:32870253-32870275 GTGCCACCACTGTGTCTGGGAGG + Intronic
1173670090 20:44792960-44792982 GTGCCAGCAGGGTGCACGGCTGG - Intronic
1173999273 20:47362551-47362573 GTGCCAGCCGGGAGGCTGGTGGG - Intergenic
1175457477 20:59126392-59126414 GTCCCAGCAGTGTCACTGTGGGG + Intergenic
1175952336 20:62590217-62590239 GTATCAGCATGGTGACTGGTTGG + Intergenic
1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG + Intronic
1176367678 21:6043747-6043769 GTGGCTGCTGGGTGACTGGCAGG - Intergenic
1176428531 21:6562909-6562931 GGGGCATCAGGGTGACTGTGGGG - Intergenic
1179704021 21:43171225-43171247 GGGGCATCAGGGTGACTGTGGGG - Intronic
1179755841 21:43494795-43494817 GTGGCTGCTGGGTGACTGGCAGG + Intergenic
1179979301 21:44888095-44888117 GTGCCACCAAGGTCACTGTGGGG + Intronic
1179979315 21:44888158-44888180 GTGCCACCAAGGTCACTGTGGGG + Intronic
1180070150 21:45431855-45431877 GTACCAGGCGGGTGAGTGGGTGG + Intronic
1180074744 21:45456738-45456760 CTGGCAGCAGGGTGGCGGGGCGG - Intronic
1180712280 22:17847472-17847494 GCGCCTGCAGGGTGTCTGGCTGG - Intronic
1181162324 22:20966077-20966099 GGGCCAGGAAGGAGACTGGGTGG - Intronic
1181357164 22:22305380-22305402 GTGAGTGCAGAGTGACTGGGAGG + Intergenic
1181581943 22:23833459-23833481 GTGCCAGCAGTGCTGCTGGGAGG + Intronic
1183357820 22:37368890-37368912 GAGCCAGAAGGGTGGGTGGGTGG - Exonic
1183511629 22:38238756-38238778 GTGCCAGCATGGTGAAAGAGAGG - Intronic
1184254996 22:43281558-43281580 GTGACAGGAGGGTGGCTGAGGGG - Intronic
1184671643 22:46014931-46014953 ATGTCAGCAGGGTGACCCGGTGG - Intergenic
1185171349 22:49296386-49296408 CTGCTAGGAGGGTGCCTGGGAGG - Intergenic
950135910 3:10580639-10580661 GTGGGAGCAGGGAGACAGGGAGG - Intronic
950147717 3:10663780-10663802 ATGCCAGGAAGGTGTCTGGGAGG - Intronic
950275946 3:11660980-11661002 GTGTCATCAGGGTGGCTGTGGGG + Intronic
950553250 3:13680329-13680351 GTGGCAGCGGGAAGACTGGGTGG - Intergenic
953878684 3:46680592-46680614 GTGCCAGCAGAGTGCCCAGGAGG - Intronic
954375359 3:50191631-50191653 GGGCCAGAAGGGTGCCTGGGAGG + Exonic
954639403 3:52089103-52089125 GTGTTTGCAGGGGGACTGGGTGG - Intronic
954855823 3:53642695-53642717 TGGCCAGCAGGGTGACCTGGTGG - Intronic
957555658 3:81761788-81761810 GTGCCAGCCGCGTGAGTGGGCGG - Exonic
957687771 3:83525018-83525040 GAGCCAGCAGGGTGACACTGAGG + Intergenic
958078220 3:88711826-88711848 GTCCCTGCAGGGTGAGGGGGAGG - Intergenic
958595610 3:96217759-96217781 GTGGCAGCATGGTGTCTGGTTGG + Intergenic
961201994 3:125052744-125052766 CAGCCAGCAGGGTGACGGGTGGG + Intronic
961483281 3:127197368-127197390 GGCCCTGCAGGGTGACCGGGAGG - Exonic
961486523 3:127221213-127221235 GGCCCTGCAGGGTGACAGGGAGG + Intergenic
961567887 3:127776515-127776537 GGGCCAGAAGGGTGGCTGGCAGG - Intronic
961683001 3:128611451-128611473 GTGCCAGCTGGGTAACTTTGAGG - Intergenic
961904746 3:130251291-130251313 ATACCAGCAGGGTGTCCGGGAGG - Intergenic
962342667 3:134598281-134598303 GTGACACGAGGCTGACTGGGTGG + Intronic
963118308 3:141752940-141752962 GTGCCAGCAGGGTTGATGGCTGG - Intergenic
965372401 3:167879766-167879788 GTGCCAGCAGGGTGGGTGCCTGG - Intergenic
967420195 3:189263888-189263910 GAGGCAGCAGGGTTATTGGGAGG + Intronic
969223002 4:5773587-5773609 GTGCCGGGAGAGAGACTGGGAGG + Intronic
969266206 4:6065731-6065753 GTGCCAGCAGGGCAACTCAGAGG - Intronic
969288847 4:6225859-6225881 GGCCCAGCAGGCTGGCTGGGTGG - Intergenic
969428831 4:7141113-7141135 GTGGCAGGCGGGTGAGTGGGAGG - Intergenic
969818616 4:9704461-9704483 TTGCCAACAGAGTGACTGGGAGG - Intergenic
970333379 4:15005028-15005050 CTGCCAGCAGGTTGATCGGGCGG - Intronic
971051649 4:22869041-22869063 CTGCCACCAGGCTGGCTGGGTGG + Intergenic
974856447 4:67466586-67466608 GGGTCAGCAGTGTGACTAGGAGG + Intergenic
978618959 4:110621137-110621159 GAGCCAGCACGGAGTCTGGGAGG - Intronic
978717139 4:111858467-111858489 GTGCCAGCTGCTTTACTGGGTGG - Intergenic
979237552 4:118419583-118419605 GTTCCAGCAGGCTAACTGGGTGG - Intergenic
981178238 4:141707873-141707895 CTGCCAGCAAGGTGGCTGTGTGG + Intronic
981455428 4:144947997-144948019 GTGGCAGGAGGGTGACTTGCAGG - Intergenic
981755238 4:148135454-148135476 GTGCCAGCAGGTTCAATGTGTGG - Intronic
982183998 4:152778330-152778352 GTTTCAGAAGGGTGACTTGGAGG - Intronic
982323137 4:154101200-154101222 GTGCCTGCAGGGATACAGGGAGG - Intergenic
985007348 4:185546982-185547004 GTGCCAGCAGGGTTGATGGCCGG + Intergenic
985806263 5:2045748-2045770 GTGCCAGCAGTTTGCATGGGAGG - Intergenic
985950576 5:3219084-3219106 GTGGCAGCAGGTAGACTGTGAGG - Intergenic
985991959 5:3569688-3569710 GTGCCGGGAGTGTGACAGGGTGG - Intergenic
986300860 5:6477239-6477261 ATGGTGGCAGGGTGACTGGGAGG - Intronic
986717595 5:10535224-10535246 GTGACAGCAGAGTCACAGGGTGG + Intergenic
994997604 5:107083820-107083842 GTGATAGGAGAGTGACTGGGTGG - Intergenic
995115463 5:108473153-108473175 GGGTCAGGAGTGTGACTGGGAGG + Intergenic
995829236 5:116334946-116334968 GTGCCAGCAGGCTGTGTGGCAGG - Intronic
995857566 5:116609414-116609436 CCGCCAGCTGGGTGCCTGGGTGG - Intergenic
997978956 5:138457382-138457404 GTGGCAGCAGGGTGGTTGGGAGG - Intergenic
1001945071 5:175771965-175771987 GTGCCAGGAGGGTGGCATGGTGG - Intergenic
1002443046 5:179274144-179274166 GTGCCAGCAGGCTGGATGGCAGG - Intronic
1002488802 5:179559453-179559475 GTGCCAGCCGGGTGCCTGCAGGG - Intronic
1002737989 5:181411551-181411573 GTTCCAGCAGGATAACTGGGTGG - Intergenic
1003051127 6:2782178-2782200 GGGCCAGCAGGGTGAGGGAGTGG + Intronic
1003228714 6:4229719-4229741 GTGTCTGCAGCCTGACTGGGAGG - Intergenic
1003494946 6:6655516-6655538 GGGCCAGCAGGGACACTGGAAGG - Intergenic
1004176019 6:13340815-13340837 GTGGCAGAAGGGTTACAGGGTGG + Intergenic
1005369956 6:25122153-25122175 CTGGCAGCAGGGTCAGTGGGAGG - Intergenic
1005379744 6:25221324-25221346 GTGTCAGCAGGTTGACATGGAGG + Intergenic
1005381132 6:25235541-25235563 GTGCCTGCAGCGTTACTGGTTGG - Intergenic
1006437695 6:34034868-34034890 GTGCTGGCTGGGTGACTCGGGGG - Intronic
1007293097 6:40801816-40801838 GTGGCAGGAGGGAGACTGGGAGG + Intergenic
1007409714 6:41654645-41654667 GTGCCAGAGGGGTGCCTGGGAGG + Intergenic
1007498031 6:42274973-42274995 GTCCCAGAAGGGGTACTGGGTGG - Intronic
1008232034 6:48994916-48994938 TTGGCAACAGGGTGAGTGGGTGG + Intergenic
1013010759 6:106117912-106117934 GAGCCAGCAGGGGGTCCGGGTGG + Intergenic
1013158396 6:107517331-107517353 GTGCCAGCAGGGTCAATGTCTGG + Intronic
1015692422 6:135939752-135939774 GTTTCAGCTGGGTGGCTGGGGGG + Intronic
1016107026 6:140175558-140175580 ATGCCATCATGGTGACTGTGAGG + Intergenic
1017965328 6:159259467-159259489 GTGGCAGAAGGGTGACTGACGGG - Intronic
1018908583 6:168089097-168089119 GGGCCAGCAGCCTGCCTGGGGGG + Intergenic
1018916472 6:168135446-168135468 GTGCCAGCAGGTTCAGTGTGGGG + Intergenic
1019243090 6:170687110-170687132 GTTCCAGCAGGATAACTGGGTGG - Intergenic
1019433263 7:1009447-1009469 GTGCCTGCGGCGTGGCTGGGTGG - Intronic
1019673276 7:2294553-2294575 GAGCCAGCAAGGTGGCTGGGGGG + Intronic
1020282139 7:6655024-6655046 GGGCCAGCGGGATGCCTGGGAGG + Exonic
1022499340 7:30872811-30872833 GTGTCACCTGGGTGACTGAGAGG - Intronic
1023837949 7:44079535-44079557 ATCCTAGCAGGGTGAGTGGGTGG - Intronic
1023845826 7:44119715-44119737 GTGCCAGCACATTGCCTGGGTGG - Intronic
1024248780 7:47490737-47490759 GTGCTGACAGGGGGACTGGGTGG - Intronic
1026837191 7:73647138-73647160 GTGGGGGCAGGGTGGCTGGGAGG + Intergenic
1027636463 7:80681451-80681473 TTGCCAGCAGGGGGACTAGTGGG - Intergenic
1029107852 7:98193188-98193210 TTGCCAGCAGGGTGAGTGTAGGG + Exonic
1029882632 7:103832599-103832621 GTGACTGCAGGGTGAATGAGGGG + Intronic
1030084705 7:105806349-105806371 GTGCCCGCATGGTGAGTGGACGG - Intronic
1031483929 7:122306650-122306672 GTGGCAGCTGGGTGAGTGGTGGG + Intronic
1031608635 7:123798833-123798855 GTGGCAGCTGAGTGACTGTGTGG + Intergenic
1033594375 7:142845752-142845774 GAGCCAGCAGAGAGAATGGGAGG - Intergenic
1033621980 7:143069913-143069935 GTGCCTGCAGGGAGTCTGAGAGG - Intergenic
1034552175 7:151828086-151828108 GTGCTTGCTGGGTGAATGGGTGG - Intronic
1035013604 7:155743382-155743404 GTGCCAGCAGGATGCCTGAAAGG - Intronic
1035277870 7:157758700-157758722 GAGCCAGTAGGGTGGATGGGCGG - Intronic
1035505032 8:121053-121075 GTTCCAGCAGGATAACTGGGTGG + Intergenic
1035766015 8:2105992-2106014 GTGCCAGCAGGGGGAATGCCAGG + Intronic
1037363690 8:18100234-18100256 GAGACAGCAGGGTGTCTTGGAGG - Intergenic
1037402656 8:18508450-18508472 GTCCCAGCAGGAGGGCTGGGCGG - Intergenic
1037805757 8:22057216-22057238 GTGGCAGCAGGGTATCTGGGGGG + Intronic
1037829465 8:22179254-22179276 GTGCCAGCAGGGTGAGGAGCTGG + Intronic
1038439864 8:27564289-27564311 TAGCCAGGAGGGTGAGTGGGTGG + Intergenic
1038647431 8:29373227-29373249 GAGACAGAAGGGGGACTGGGGGG - Intergenic
1040305679 8:46210585-46210607 GAGACAACAGGGTGGCTGGGTGG + Intergenic
1040657329 8:49526728-49526750 GGGCCTGCAGGATGAATGGGTGG - Intergenic
1042875682 8:73438306-73438328 GTCCCAGCAGGGAGACAGGCAGG + Intronic
1047581667 8:126223219-126223241 GTGTCAGCAGAGTGGCTGGCTGG - Intergenic
1049031879 8:140044047-140044069 GTGCCAGCAGGGTGTCAGCCAGG + Intronic
1049260693 8:141637557-141637579 GGGCTAGCACAGTGACTGGGTGG + Intergenic
1049692106 8:143965989-143966011 GGTCCAGCAGGGTGGCAGGGAGG - Intronic
1049726728 8:144150007-144150029 GTGTGTGCAGGGAGACTGGGAGG - Intronic
1050359925 9:4820224-4820246 GAGTCAGCAGGGTGTGTGGGAGG + Intronic
1051080207 9:13285302-13285324 GTGCCAGCACAGTGCCTGGCAGG + Intergenic
1051991876 9:23161686-23161708 GTGGCAGCAGTGGAACTGGGTGG - Intergenic
1052860875 9:33437045-33437067 GGGCCACCAGGGAGACTGGAAGG - Intergenic
1053689545 9:40576878-40576900 GTGAGTGCAGAGTGACTGGGAGG - Intergenic
1054274485 9:63054179-63054201 GTGAGTGCAGAGTGACTGGGAGG + Intergenic
1054300791 9:63377817-63377839 GTGAGTGCAGAGTGACTGGGAGG - Intergenic
1054400339 9:64710750-64710772 GTGAGTGCAGAGTGACTGGGAGG - Intergenic
1054433930 9:65195008-65195030 GTGAGTGCAGAGTGACTGGGAGG - Intergenic
1054496457 9:65826662-65826684 GTGAGTGCAGAGTGACTGGGAGG + Intergenic
1056622827 9:88228554-88228576 GTGCCAGAAAGGTGCCTGGAGGG - Intergenic
1057323088 9:94032158-94032180 GAGCCAACAGGATGAGTGGGTGG - Intronic
1057448018 9:95132239-95132261 GTGTCTGCAGGGTGTCAGGGTGG - Intronic
1057954462 9:99396507-99396529 GTGTCAGGAGGGTGGCTTGGGGG + Intergenic
1058877509 9:109257365-109257387 GTGCCTGCAGGGGGAATGGAGGG + Intronic
1059385634 9:113962090-113962112 TTCCCTGCAGGGTTACTGGGAGG + Intronic
1059428664 9:114236899-114236921 GGACCAGCAGGAGGACTGGGCGG + Intronic
1060591590 9:124820471-124820493 GTGCCAGGAGGGTGATGGGCAGG - Intergenic
1060866975 9:127008245-127008267 GTACCAGCAGCATGACTGTGTGG + Intronic
1062385917 9:136311500-136311522 GAGCCAGCAGGGTTGATGGGTGG - Intergenic
1062451375 9:136617149-136617171 GTGCCTGCAGGGCGACCTGGGGG + Intergenic
1062462055 9:136666188-136666210 GAGCCAGCAGCGCGGCTGGGAGG + Intronic
1203603279 Un_KI270748v1:36334-36356 GTTCCAGCAGGATAACTGGGTGG - Intergenic
1186066772 X:5774977-5774999 CTGCCAGCAGGCTAACTGGTTGG - Intergenic
1190067200 X:47249428-47249450 GTGTCAGCAGAGTGACTGGGAGG - Intergenic
1191055213 X:56233402-56233424 GGGGGAGCAGGGGGACTGGGAGG - Intronic
1192161259 X:68789667-68789689 CTTCCATCAGGGTGACTGGTAGG + Intergenic
1192457923 X:71293117-71293139 GTGACAGCAGGATCACTGGATGG + Intronic
1192582814 X:72299182-72299204 GTGACAGGAGTGTGGCTGGGAGG - Intronic
1192682774 X:73268778-73268800 GTGACAGGAGTGTAACTGGGAGG + Intergenic
1192727130 X:73765337-73765359 GTGTCAGGAGTGTGACTGGGAGG - Intergenic
1194614903 X:96088097-96088119 GAGTCAGGAGGGTGACTGGAAGG + Intergenic
1196760669 X:119198119-119198141 ATTCCAGGAGGCTGACTGGGGGG - Intergenic
1197404001 X:126027897-126027919 TTCCCAGCAGGGTGGCTGGGGGG + Intergenic
1198272448 X:135067344-135067366 GTGGCAGCATGGTGTCTGGTTGG - Intergenic
1199159019 X:144586226-144586248 GGGTCAGGAGTGTGACTGGGAGG - Intergenic
1199546629 X:149013220-149013242 GTGACAAGAGGATGACTGGGAGG + Intergenic
1199945443 X:152662364-152662386 GTGCCAGCACAGTGTCTGGTGGG + Intergenic
1200139058 X:153888602-153888624 GTGCCAGCAGGCAGGCGGGGTGG + Intronic
1201438507 Y:13985212-13985234 GTGTCAGGAGGGAGACAGGGGGG - Intergenic
1201446066 Y:14057496-14057518 GTGTCAGGAGGGAGACAGGGGGG + Intergenic
1201860833 Y:18595813-18595835 GTGCCTGCAGAGGTACTGGGAGG - Intergenic
1201872490 Y:18724567-18724589 GTGCCTGCAGAGGTACTGGGAGG + Intergenic
1202385345 Y:24321386-24321408 GTTCCAGCAGGCTAACTGGGTGG - Intergenic
1202485441 Y:25348742-25348764 GTTCCAGCAGGCTAACTGGGTGG + Intergenic