ID: 1175977929

View in Genome Browser
Species Human (GRCh38)
Location 20:62722434-62722456
Sequence AAGGCTTATCAGAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 441}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175977929_1175977938 23 Left 1175977929 20:62722434-62722456 CCAGCCACCCTCTGATAAGCCTT 0: 1
1: 0
2: 4
3: 45
4: 441
Right 1175977938 20:62722480-62722502 TGGGCCAGCACAGATCCCACAGG 0: 1
1: 0
2: 1
3: 15
4: 197
1175977929_1175977935 3 Left 1175977929 20:62722434-62722456 CCAGCCACCCTCTGATAAGCCTT 0: 1
1: 0
2: 4
3: 45
4: 441
Right 1175977935 20:62722460-62722482 TGGCCTTGTTCTGTACACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1175977929_1175977936 4 Left 1175977929 20:62722434-62722456 CCAGCCACCCTCTGATAAGCCTT 0: 1
1: 0
2: 4
3: 45
4: 441
Right 1175977936 20:62722461-62722483 GGCCTTGTTCTGTACACGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175977929 Original CRISPR AAGGCTTATCAGAGGGTGGC TGG (reversed) Intronic
903566321 1:24268596-24268618 AGGGCCTGTCAGAGGGTGGGGGG - Intergenic
904956832 1:34291639-34291661 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
905004147 1:34696842-34696864 AGGGCATGTCAGAAGGTGGCTGG - Intergenic
906870873 1:49479458-49479480 GGGGCCTATCAGAGGGTGGAGGG - Intronic
908472490 1:64457707-64457729 AGGGCATATGGGAGGGTGGCAGG + Intergenic
909252685 1:73379202-73379224 AGGGCCTGTCAGAGGGTGGGGGG - Intergenic
910683169 1:89888753-89888775 AAGGTTTATCAGAGGGACACAGG + Intronic
911667422 1:100569194-100569216 AGGGCCTATCAGGGGGTGGGGGG + Intergenic
912188098 1:107304888-107304910 AGGGCCTGTCAGGGGGTGGCAGG - Intronic
915024581 1:152815592-152815614 AGGGCCTGTCAGAGGGTGGAGGG + Intergenic
915382959 1:155459872-155459894 AGGGTTTATCAGAGGTTGGCTGG + Exonic
915526882 1:156481332-156481354 AGGGCTTACCACAGGGTGGTCGG - Intronic
916394294 1:164368628-164368650 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
917148510 1:171919308-171919330 AGGGCCTGTCAGAGGGTGGGGGG - Intronic
917929026 1:179811257-179811279 AAGGCTTAACAGCTGGTGGCAGG + Intronic
918491368 1:185084843-185084865 AATGCTTATAAAATGGTGGCTGG + Intronic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
918808683 1:189086196-189086218 AGGGCCTGTCAGAGGGTGGAAGG - Intergenic
919291630 1:195640988-195641010 AAGGCAGATCAGAGGATGCCTGG + Intergenic
919356996 1:196536888-196536910 CAGGCTCATGAGAGTGTGGCAGG - Intronic
919500762 1:198335710-198335732 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
919576700 1:199319046-199319068 GAGGCTTTTCGGAGGGTGGAAGG - Intergenic
919732544 1:200922500-200922522 AAGGAAGATCAGAGTGTGGCTGG + Intergenic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
920900173 1:210102254-210102276 GGGGCCTATCAGAGGGTGGCAGG - Intronic
921242587 1:213200958-213200980 GGGGCCTGTCAGAGGGTGGCGGG + Intronic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
923017229 1:230136335-230136357 CAGGGTTATCAGAGGATGGCTGG - Intronic
923140719 1:231160282-231160304 AAGGCTTATCTGAGAGTTGCAGG + Intergenic
924037022 1:239948280-239948302 GAGGCCTATCAGAGGGTGGCAGG + Intergenic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
924578969 1:245306745-245306767 AAGGCTTATAAGAGGGATGAAGG - Intronic
924630993 1:245740703-245740725 GGGACTTATCAGAGGGTGGTGGG + Intergenic
924837073 1:247660957-247660979 AGGGCTTGTCAGGGGGTGGGGGG - Intergenic
1063027502 10:2195273-2195295 AAGGCTTCTCAGATGATGACAGG - Intergenic
1063465187 10:6238721-6238743 GGGGCCTATCAGAGGGTGGTGGG - Intergenic
1063561813 10:7135202-7135224 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1063736547 10:8761947-8761969 AAGTCTTATAAGAAGGGGGCAGG - Intergenic
1063745265 10:8872179-8872201 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1064171560 10:13038195-13038217 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1064649986 10:17499366-17499388 GGGGCCTTTCAGAGGGTGGCAGG + Intergenic
1064800137 10:19061107-19061129 GGGGCCTGTCAGAGGGTGGCGGG + Intronic
1065818988 10:29507852-29507874 AAGATTTATCAGAGCGGGGCCGG + Intronic
1065953832 10:30676070-30676092 AAGATTTATCAGAGCGGGGCCGG - Intergenic
1066288191 10:33988974-33988996 GGGGCTTGTCAGAGGGTGGGGGG - Intergenic
1068225947 10:54107519-54107541 AAGGCATCTGAGAGGGTGGGAGG + Intronic
1068631649 10:59304587-59304609 GGGGCCTTTCAGAGGGTGGCAGG + Intronic
1069150793 10:64956669-64956691 AGGACCTATCAGAGGGTGGCAGG + Intergenic
1070115984 10:73529285-73529307 CAGGCCTATCGGAGGGTGGAGGG + Intronic
1070473426 10:76808351-76808373 AAGGCTTATAAGAGAGTGGTTGG - Intergenic
1071010517 10:80934951-80934973 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1071408808 10:85366155-85366177 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
1071736705 10:88309110-88309132 AGGGCCTATCAGAGGGTGGAGGG + Intronic
1072119793 10:92396275-92396297 AAAGCTGAACAGAGGGTGTCAGG + Intergenic
1072271065 10:93777171-93777193 AAGGCTCATCAAGGGGTGCCTGG - Intronic
1072492555 10:95921786-95921808 AGGGCCTGTCAGAGGGTGGGGGG + Intronic
1072871117 10:99121280-99121302 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1073129605 10:101178801-101178823 AAGGCTAATGGGAGGCTGGCAGG - Intergenic
1073438666 10:103538600-103538622 AATGCTCATCAGTGGGTAGCAGG - Intronic
1073539025 10:104303107-104303129 GAGGCCTATCAGAGGGTGCAGGG - Intronic
1073955580 10:108867593-108867615 AGGACCTATCAGAGGGTGGAAGG + Intergenic
1075236193 10:120731563-120731585 AAGGCTTTGCACATGGTGGCAGG + Intergenic
1075528975 10:123210981-123211003 GGGGCCTATCAGAGGGTGGGGGG - Intergenic
1077705182 11:4478407-4478429 AAGGTTGTTCAGAGGTTGGCAGG + Intergenic
1077776204 11:5274532-5274554 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1078972468 11:16429665-16429687 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1079778228 11:24561661-24561683 GGGGCCTATCGGAGGGTGGCGGG + Intronic
1080631317 11:34079577-34079599 AAGACTTATCTGAGGATGCCTGG - Intronic
1081211940 11:40346538-40346560 GAGGCCTATCAGAGGCTGGAAGG + Intronic
1083089019 11:60180648-60180670 GAGGCCTTTCAGAGGGTGGAGGG - Intronic
1083789670 11:64976431-64976453 AAGGCTTCTCAGAGGGGCCCTGG + Intergenic
1084120931 11:67068513-67068535 AAGGATTCTCTGATGGTGGCCGG + Intronic
1085317771 11:75555676-75555698 GGGGCTTGTCCGAGGGTGGCTGG - Intergenic
1086030845 11:82353278-82353300 AAGGCCTGTCAGAGGGTTGGGGG + Intergenic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1087184134 11:95168772-95168794 GTGACTTATCAGCGGGTGGCTGG + Exonic
1087241301 11:95784276-95784298 AGGGCCTATCAGATGGTGGAGGG + Intronic
1087332629 11:96800163-96800185 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1087553793 11:99688759-99688781 GGGGCCTGTCAGAGGGTGGCGGG - Intronic
1087557886 11:99745688-99745710 AAGGCTTAACTAAGGTTGGCAGG - Intronic
1087955571 11:104282804-104282826 AATGGTTACCAGAGGATGGCAGG - Intergenic
1088534284 11:110843080-110843102 GAGGCCTATCAGAAGGTGGAGGG - Intergenic
1090260431 11:125315103-125315125 AAGCCTGCTCAGAGGGAGGCAGG + Intronic
1092173273 12:6386186-6386208 GAGGCTTCTCAGAGGGTGGAAGG - Intronic
1092645312 12:10564638-10564660 AGGGCCTGTCAGAGGGTGGGGGG - Intergenic
1094299302 12:28943819-28943841 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1094448193 12:30555771-30555793 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1096165269 12:49417491-49417513 AAGCCTTATCAGATGGGGTCAGG - Intronic
1096967609 12:55640794-55640816 AAGGTTTCTCAGTGGGTGGGGGG + Intergenic
1096978933 12:55717371-55717393 CAGGCTTGCCAGAGGGTGGGAGG - Intronic
1097466741 12:59935468-59935490 GATGCTTATCAGAGGTTGGAAGG + Intergenic
1099036229 12:77590500-77590522 TGGGGTTATCAGAGGGTGGAGGG + Intergenic
1099859994 12:88214595-88214617 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1102940398 12:116936493-116936515 AAGTCTTGTAAGAGGGAGGCAGG + Intronic
1102971292 12:117169309-117169331 GGGGCCTATCAGAGGGTGGGCGG + Intronic
1104255687 12:127135452-127135474 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1105072549 12:133243819-133243841 TGTGCTTATCAGAGGGTGGAGGG - Intergenic
1105274868 13:18911277-18911299 AGGGCCTATCAGAGAGTGGAGGG - Intergenic
1105530553 13:21215316-21215338 AACGCCTATCAGAGAGTGGAGGG + Intergenic
1108771951 13:53713622-53713644 GAGGCTTATAAGACAGTGGCAGG - Intergenic
1108813046 13:54253578-54253600 GAGGCCCATCAGAGGGTGGAAGG + Intergenic
1109311911 13:60705116-60705138 AAGGCCTATCAGAGGGTAGAAGG + Intergenic
1111796607 13:92928613-92928635 AGGGCCTGTCAGAGGGTGGGGGG + Intergenic
1113098381 13:106690548-106690570 GGGGTTTATCAGAGGGTGGTGGG + Intergenic
1114056418 14:18971558-18971580 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1114066709 14:19066102-19066124 AAGGCTTACCAGAGGCTGCTGGG - Intergenic
1114095557 14:19333925-19333947 AAGGCTTACCAGAGGCTGCTGGG + Intergenic
1114106132 14:19430169-19430191 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1114586635 14:23820563-23820585 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
1114854397 14:26420578-26420600 AGGGCCTATCAGAGGGTGGAGGG + Intergenic
1114941810 14:27622526-27622548 GATGCTTATAAGAGGGAGGCAGG - Intergenic
1115885236 14:37964048-37964070 GGGGCTTATCAGAAGGTGGATGG - Intronic
1115936154 14:38555056-38555078 AATCCTTATAAGAGGGAGGCAGG + Intergenic
1116049024 14:39781130-39781152 AAGGCCCATCAGATGGGGGCAGG + Intergenic
1116297099 14:43126089-43126111 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1116506497 14:45688714-45688736 GGGGCTTATCAGAGGGTGGAAGG + Intergenic
1117165646 14:53029937-53029959 GAGGCCTAGCAGAGGGTGGAGGG - Intergenic
1117487305 14:56211366-56211388 AAGGCTTCACAGAAGGTGACAGG - Intronic
1117534608 14:56691806-56691828 GAGGCTTATAAGAAGGTGGTAGG - Intronic
1118095053 14:62527026-62527048 TGGGCTTATCAGAGGATGGAGGG + Intergenic
1119266838 14:73267746-73267768 CAGGCTGATCAGGGGATGGCTGG - Intronic
1120085398 14:80266759-80266781 GAGCCATATCAGAGTGTGGCTGG + Intronic
1120138864 14:80904316-80904338 AATGGTTACCAGAGGGTGGCGGG + Intronic
1123498994 15:20862684-20862706 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1123556230 15:21436303-21436325 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1123592468 15:21873649-21873671 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1123829680 15:24121720-24121742 GAGGCCTATCAGATGGTGGAGGG - Intergenic
1124053111 15:26217400-26217422 AGGGCCTATCAGGGGGTGGGGGG + Intergenic
1124850639 15:33335517-33335539 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1126564900 15:50084839-50084861 GATCCTTATCAGAGGGAGGCAGG - Intronic
1126951122 15:53882884-53882906 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1128226551 15:66005618-66005640 AAACCTTTTCAGATGGTGGCTGG + Intronic
1128254001 15:66184047-66184069 AAGGCAGATCAGTGGGTGCCTGG + Intronic
1128414438 15:67431473-67431495 GAGGCCTATCAAAGGGTGGAGGG + Intronic
1129707507 15:77803080-77803102 GAGGCTTCTTAGAGGGTGGTGGG - Intronic
1129879425 15:78997020-78997042 CAGGCTGTTCAGTGGGTGGCGGG - Intronic
1129923946 15:79345303-79345325 ATGGCCTATCAGAGGGTGAAGGG - Intronic
1130102399 15:80903887-80903909 AAGGTTTTTCTGTGGGTGGCCGG + Intronic
1130754714 15:86750792-86750814 GGGGCCTATCAGAGGGTGGAAGG - Intronic
1131314813 15:91326014-91326036 AAGGCCTACCTGAGGGTGGAGGG - Intergenic
1131549551 15:93345301-93345323 AGGGCCTATCAGAGGATGGAGGG + Intergenic
1202964569 15_KI270727v1_random:163506-163528 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1132944259 16:2523870-2523892 AAGGCTTAGCAGAGGAGGCCTGG - Intronic
1133231864 16:4370790-4370812 AAGGCTTATCCCTGGGAGGCTGG - Intronic
1133591412 16:7247877-7247899 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1135865552 16:26098573-26098595 AGGGCCTGTCAGGGGGTGGCAGG + Intronic
1136513175 16:30751615-30751637 GAGGCTTCTCAGATGGTGGCAGG - Intronic
1138254767 16:55546109-55546131 AAGGCTCATCTGACAGTGGCGGG - Intronic
1138755168 16:59475696-59475718 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1140648835 16:77064832-77064854 AGGGCCTATCAGAGGGTAGAGGG + Intergenic
1141031188 16:80590350-80590372 AGGGCCTGTCAGGGGGTGGCGGG + Intergenic
1141866735 16:86755508-86755530 CTGGCTTAGCAGAGTGTGGCTGG + Intergenic
1143734088 17:8898252-8898274 TTTGCTTATCAGCGGGTGGCAGG - Intronic
1144395205 17:14836617-14836639 GAGCCTTATAAGAGGGAGGCAGG + Intergenic
1144580902 17:16458773-16458795 AAGGCTTAACAGAAGTTGGCAGG - Intronic
1144902101 17:18604655-18604677 ATGCCTTAGCAGAGGGTGGGAGG + Intergenic
1145114038 17:20191650-20191672 AGGGCTTGTCAGTGGGTGGGGGG - Intronic
1146396058 17:32467955-32467977 AAGGCCTATCAGAGGGTGGGAGG - Intronic
1146433413 17:32821030-32821052 GAGGCCTATCAGCGGGTGGAAGG - Intronic
1146526433 17:33570848-33570870 TAGGCTTCTCAGAATGTGGCAGG + Intronic
1146528160 17:33584647-33584669 ATGGATGATCAGAGAGTGGCAGG + Intronic
1147012087 17:37458079-37458101 AGGGCCTATCAGAGGGTGGAGGG - Intronic
1147421663 17:40324904-40324926 AAGGATCACCTGAGGGTGGCTGG - Intronic
1147656623 17:42094846-42094868 CTGGCTTACTAGAGGGTGGCTGG - Intergenic
1150005248 17:61465070-61465092 AAGGCTTATCAGTGGGGTCCAGG + Intronic
1150364961 17:64573966-64573988 ATGGCCTATCAGAGGGTGGAAGG + Intronic
1150921704 17:69490871-69490893 GGGGCCTATCAGAGGGTGGAAGG - Intronic
1151020793 17:70615152-70615174 AGGACCTATCAGAGGGTGGAGGG - Intergenic
1151049191 17:70957468-70957490 AGGGCCTATCAGAGGGTGGAGGG - Intergenic
1152009783 17:77705278-77705300 AAGGCTTATCACAGAGTGTCAGG + Intergenic
1154457037 18:14539430-14539452 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1155157746 18:23171677-23171699 GAGGGTTATCAGAGGGTGGCAGG - Intronic
1155254066 18:23979357-23979379 AAGGCTTCCCAGTGAGTGGCAGG + Intergenic
1155350309 18:24899760-24899782 GAGGCCTGTCAGAGGGTGGGGGG + Intergenic
1155881066 18:31149429-31149451 AAGGCTTATGAGAGAGAGGGAGG - Intronic
1156257196 18:35409730-35409752 AAGGTTTTTGAGAGGGTTGCTGG + Intergenic
1156566102 18:38192867-38192889 AGGGCCTATCAGAAGGTGGAGGG + Intergenic
1157269809 18:46264227-46264249 AAGGATTAGCAAAGGGTAGCAGG + Exonic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157842095 18:50968126-50968148 AGGGCATACCAGAGGGGGGCGGG + Intronic
1158031854 18:52975513-52975535 GGGGCCTATCAGAGGGTGGAAGG - Intronic
1158085275 18:53643620-53643642 AAGGCCTGTCAGGGGGTGGTGGG + Intergenic
1159464031 18:68757061-68757083 AAGGCTTTTCTGATGGAGGCGGG - Intronic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161518695 19:4711470-4711492 AGTCCTTATCAGAGGGAGGCAGG + Intronic
1165291602 19:34890328-34890350 AAGGGTTTTCAGGGGCTGGCAGG - Intergenic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1167520560 19:49952039-49952061 ATGGCTTAGCAGAGGCTGGAAGG + Intronic
1167594999 19:50422858-50422880 AAGGCTTCATAGGGGGTGGCTGG - Exonic
925461623 2:4068085-4068107 AGGGCCTATCAGGGGGTCGCGGG - Intergenic
925957038 2:8977006-8977028 AAAGCTTATCAGTGGTTGCCTGG + Intronic
926477738 2:13348492-13348514 GGGGCTTATCAGAGGGTGGAGGG - Intergenic
927129479 2:20046188-20046210 AGGGCCTGTCAGCGGGTGGCGGG + Intronic
930154915 2:48096690-48096712 AGGGCCTATCAGAGGGTGAAGGG - Intergenic
930458545 2:51638842-51638864 AAGGCTTAAAAGAAGGTGGGGGG + Intergenic
931203225 2:60121432-60121454 AGGGCTTGTCAGTGGGTGGAGGG + Intergenic
931380795 2:61751432-61751454 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
931557904 2:63525233-63525255 AAGGCCTACCTGAGGGTGGAGGG + Intronic
931933381 2:67166885-67166907 GAGGCTTATCAGAGGGTGGAGGG + Intergenic
932144087 2:69304007-69304029 AAGGCTCATCTGAGGGAGGAGGG + Intergenic
932920880 2:75914224-75914246 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
932984481 2:76708786-76708808 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
933477381 2:82808326-82808348 GGGGCTTATCGGAGGGTGGAGGG + Intergenic
933545484 2:83706070-83706092 AAGGCCTACCAGAGGGTGGAGGG - Intergenic
934974113 2:98788353-98788375 AAGGCTTGACAGGGGCTGGCAGG + Intergenic
935084346 2:99830111-99830133 AGGGCCTATCAGAGGGTGGAGGG + Intronic
935501716 2:103849116-103849138 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
936003001 2:108852739-108852761 GGGGCCTATCAGAGGGTGGGAGG + Intronic
937587123 2:123566432-123566454 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
938336527 2:130505069-130505091 GGGGCCTATCAGAGGGTGGAGGG - Intronic
938353292 2:130615593-130615615 GGGGCCTATCAGAGGGTGGAGGG + Intronic
938474538 2:131595583-131595605 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
938503188 2:131846409-131846431 GGAGCTTATCAGAGGGTGGAGGG - Intergenic
938565717 2:132516601-132516623 GAAGGTTATCAGAGTGTGGCCGG - Intronic
939192854 2:138937064-138937086 AAGGCTTGTCTGGGGGTGGGGGG - Intergenic
939421034 2:141969425-141969447 AATGGTTACAAGAGGGTGGCGGG - Intronic
939855486 2:147353886-147353908 GAGGCTTATCAGCGGGTGGAGGG + Intergenic
940406838 2:153313534-153313556 GGGGCCTATCAGAGGGTGGCGGG + Intergenic
940503205 2:154520561-154520583 AATGGTTATCAGAGGCTGGGAGG - Intergenic
942483752 2:176418067-176418089 AAGGCCTGTCAGGGGGTGGGGGG - Intergenic
943012917 2:182473643-182473665 GGGGCCTATCAGAGGGTGGAAGG - Intronic
943731366 2:191306602-191306624 AAGGCTCATCTGAGGATGGGAGG + Intronic
944292591 2:198024236-198024258 AGGGCCTATCAGGGGTTGGCAGG + Intronic
944312059 2:198244437-198244459 AATCCTTATAAGAGGGTGGTAGG + Intronic
944474265 2:200087764-200087786 AAGCCTTATCAGAGGGCACCAGG + Intergenic
944494001 2:200288076-200288098 AGGGCCTATCAGAGGGTGGAGGG - Intergenic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945715380 2:213352067-213352089 AAACCTCTTCAGAGGGTGGCAGG - Intronic
945909313 2:215629657-215629679 AAGGCTTATTCGAGGGTGGAGGG - Intergenic
946148165 2:217746520-217746542 GAGACTTATCAGGAGGTGGCTGG - Intronic
946873825 2:224108569-224108591 AAGGCTTCTCTGAGTGTGTCAGG - Intergenic
947297716 2:228651096-228651118 GAGACCTATCAAAGGGTGGCAGG + Intergenic
947309478 2:228784779-228784801 AGGGCCTGTCAGAGGGTGGGAGG + Intergenic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
947776452 2:232714938-232714960 GAGGCCTCTCAGAGGGTGGAGGG - Intronic
1169302616 20:4457378-4457400 AGGGCCTATCAGAAGGTGGAGGG + Intergenic
1169498986 20:6141245-6141267 AAGGCTTCTCACAGCCTGGCTGG + Intergenic
1169918589 20:10708757-10708779 AAGACTGATCAAAGGATGGCTGG + Intergenic
1171373006 20:24673761-24673783 AAGGCCTATCAGAGGCTGTAGGG + Intergenic
1171392893 20:24812373-24812395 AAGGCTCATTAGAGGGTGATTGG + Intergenic
1175975129 20:62707307-62707329 AAGGCTTCTGAGCCGGTGGCTGG - Intergenic
1175977929 20:62722434-62722456 AAGGCTTATCAGAGGGTGGCTGG - Intronic
1176097957 20:63352901-63352923 AAGGCTCCCCAGAGGGCGGCTGG - Intronic
1176817121 21:13613907-13613929 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1177358541 21:20039340-20039362 GGGGCCTATCAGAGGGTGGATGG - Intergenic
1177509137 21:22060701-22060723 AGGGCCTGTCAGAGGGTGGGAGG + Intergenic
1178216428 21:30604467-30604489 ACTGCTTATCAGAGAGTGGAAGG + Intergenic
1180474904 22:15694169-15694191 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1180485191 22:15788686-15788708 AAGGCTTACCAGAGGCTGCTGGG - Intergenic
1181466835 22:23114938-23114960 AAGGCATCTCAGAAGCTGGCAGG + Intronic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1182004652 22:26949896-26949918 AAGGCTTCCCAGAAGGTGGTGGG - Intergenic
1182992226 22:34778921-34778943 GGGGCTTATCAGAGGATGGAGGG + Intergenic
1183322378 22:37172934-37172956 ATGACTTCTCAGAGGATGGCTGG - Intronic
1183432478 22:37774188-37774210 AAGCCCAAGCAGAGGGTGGCTGG - Exonic
949129761 3:485875-485897 GAGGCCTATCAGAGGCTGGAAGG - Intergenic
949962206 3:9321803-9321825 GGGGCCTATCAGAGGGTGGAGGG + Intronic
950852361 3:16074661-16074683 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
951682699 3:25311109-25311131 AAGGCTTCATAGAGGGTGTCGGG + Intronic
951761201 3:26148825-26148847 AAGGCCTATCAGGCGGGGGCAGG - Intergenic
951973748 3:28479677-28479699 GGGGTTTATCAGAGGGTGGAAGG - Intronic
952194168 3:31055572-31055594 AGGGCCTGTCAGAGGGTGGGGGG - Intergenic
953747405 3:45585639-45585661 AAGGCATCTGAGAGGGAGGCTGG - Intronic
955207282 3:56907855-56907877 GGGGCCTATCAGAGGGTGGAGGG + Intronic
955546080 3:60031768-60031790 GAGGCTTAGCAGAGGGTGCATGG + Intronic
956746828 3:72317181-72317203 AGGTCCTGTCAGAGGGTGGCTGG - Intergenic
956995680 3:74824451-74824473 AAGGATTATCAGCGGGGGGCAGG + Intergenic
957771862 3:84704432-84704454 GGGGCTTATCAGAGGGCGGAGGG + Intergenic
958497753 3:94866034-94866056 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
958661919 3:97079436-97079458 TGGGCCTATCAGAGGGTGGAAGG + Intronic
959206323 3:103311688-103311710 AGGGCCTGTCAGAGGGTGGGGGG - Intergenic
959794959 3:110415395-110415417 AGTCCTTATAAGAGGGTGGCAGG + Intergenic
960405831 3:117258274-117258296 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
962464494 3:135644593-135644615 AGGGCCTATCGGAGGGTGGGAGG - Intergenic
962760473 3:138508624-138508646 AAGGCTGTTGGGAGGGTGGCTGG - Intronic
963377731 3:144491548-144491570 AAGGCCTATCTGGGGGAGGCTGG + Intergenic
963587102 3:147205824-147205846 GAGGCCTATCAGGGGGTGTCGGG - Intergenic
965308981 3:167104611-167104633 AGGGCCTATCAGAGGGTGGGGGG + Intergenic
965312355 3:167145832-167145854 GAGGCCTATCAGAGGTTGGAGGG - Intergenic
965385034 3:168035635-168035657 ACGGCCTATCAGAAGGTGGAGGG + Intronic
965747262 3:171938450-171938472 GAGACATATCAGAAGGTGGCAGG + Intronic
965808417 3:172566787-172566809 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
966145702 3:176809291-176809313 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
966594176 3:181711708-181711730 AAGGTTTCTCAGTGGCTGGCAGG + Intergenic
966833200 3:184028863-184028885 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
967221829 3:187253827-187253849 AGGGCCTGTCAGGGGGTGGCGGG + Intronic
967548225 3:190758133-190758155 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
970016630 4:11519439-11519461 CAGGCTTGTCAGAGGGTTGGGGG - Intergenic
970956376 4:21816648-21816670 AATCCTCATCAGAGGATGGCAGG - Intronic
971490239 4:27204475-27204497 AAGGTCCATCAGTGGGTGGCAGG + Intergenic
971658279 4:29378607-29378629 AAGGCCTGTCAGGGGGTGGTGGG + Intergenic
972470916 4:39403696-39403718 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
973160683 4:47012350-47012372 GTGGCCTATCAGAGGGTGGAGGG - Intronic
973167416 4:47094597-47094619 GGGGCCTATCAGAGGGTGGAGGG + Intronic
974523955 4:63023831-63023853 GGGGCCTATCAGAGGGTGGATGG + Intergenic
974730535 4:65858899-65858921 AAGGCCTGTTAGAGGGTGGGGGG + Intergenic
974749723 4:66121729-66121751 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
974806872 4:66891953-66891975 GAGGCCTTTCAGAGGGTGGGAGG + Intergenic
974989413 4:69066309-69066331 GAGGCTTTTTAGAGGGTGGAGGG - Intronic
975231013 4:71933016-71933038 GGGACTTATCAGAGGGTGGAGGG + Intergenic
976332280 4:83846370-83846392 AAGGATGAACACAGGGTGGCAGG - Intergenic
976346266 4:84005218-84005240 CAGGCCTTTCAGAGGGTGGAGGG + Intergenic
976849420 4:89528072-89528094 AGGGCTTGTCAGAGGATGGTGGG + Intergenic
977112232 4:92972759-92972781 AGGGCCTTTCAGAGGGTGGAAGG - Intronic
977595289 4:98872870-98872892 GGGGCCTATCAGAGGGTGGAGGG + Intronic
977991945 4:103454403-103454425 TGGTCTTATCAGAGGGTGGAGGG - Intergenic
978052023 4:104212821-104212843 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
978091478 4:104722035-104722057 AGGGCTTTTCAGAGGGTGGTGGG + Intergenic
978131174 4:105199695-105199717 GGGGCCTATCAGAGGGTGGAGGG - Intronic
978932276 4:114329651-114329673 AGGGCCTGTCAGAGGGTGGGGGG - Intergenic
978944911 4:114483597-114483619 AGAGCCTATCAGAGGGTGGATGG + Intergenic
979104000 4:116661198-116661220 AGGGCTTTTCAGGGGGTGGAAGG + Intergenic
983283327 4:165708521-165708543 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
985071939 4:186174236-186174258 AGGGCCTATCAAAGGGTGGAGGG - Intergenic
985851949 5:2395154-2395176 AAGGCTTACCAGAGGCGGCCAGG + Intergenic
986272117 5:6242467-6242489 GAGGCATATCAGAGGGTGGAGGG + Intergenic
986628555 5:9746755-9746777 AAGGCCCATCAGTGGGTGGGAGG + Intergenic
987227332 5:15856386-15856408 GGGGCCTATCAGAGGGTGGAAGG + Intronic
987638967 5:20586492-20586514 AAGGCCTGTCGGAGGCTGGCGGG + Intergenic
987830713 5:23091060-23091082 AAGGCCTGTCAGGGGGTGGAGGG + Intergenic
988332155 5:29856089-29856111 AGGGCTTGTCGGAGGGTGGAGGG - Intergenic
988410580 5:30880746-30880768 ATGGCTTGTCAGAGGGTTGGTGG - Intergenic
988612286 5:32738289-32738311 AGGGCCTATCAGGGGGTGGGGGG - Intronic
989070310 5:37503421-37503443 GGGGCCTATCAGAGGGTGGAGGG - Intronic
989558857 5:42828229-42828251 GAGGCTTATTGGAGGGTGGAGGG - Intronic
989992412 5:50782873-50782895 GAGGCTCATCAGAGAGTGGTAGG + Intronic
990223748 5:53626038-53626060 AGGGCCCATCAGAGGGTGGGGGG - Intronic
991907447 5:71526244-71526266 AAGATTAATCAGAGGTTGGCTGG - Intronic
993023171 5:82616373-82616395 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
993283395 5:85958129-85958151 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
993772348 5:91945089-91945111 AGGGCCTGTCAGAGGGTGGGGGG + Intergenic
994227379 5:97268526-97268548 GAGGCCTATCAGAGGATGGAGGG - Intergenic
996192895 5:120567303-120567325 AAGTCCTATCAGAGGTAGGCAGG - Intronic
996345512 5:122484267-122484289 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
996850450 5:127945780-127945802 AAGGCTTACTTGAGGGTGGAGGG - Intergenic
999029154 5:148270785-148270807 GATTCTTATCAGAGGGAGGCAGG + Intronic
999142458 5:149371505-149371527 AAGGCATAATAGAGGGAGGCAGG + Intronic
999612025 5:153380267-153380289 GAGGCTTATGAGAGTGTGGGAGG + Intergenic
999943547 5:156570801-156570823 GGGGCCTATCAGAGGGTGGAGGG - Intronic
999983724 5:156983147-156983169 GGGGCTTATCAGAGGGTGGAGGG + Intergenic
1000072092 5:157750356-157750378 AAGGATTCTCAGAGCGTGGGAGG - Intronic
1000658220 5:163907654-163907676 AATGCCTATCAGAGGTAGGCCGG - Intergenic
1001163246 5:169340037-169340059 AATGATTGTCAGATGGTGGCTGG - Intergenic
1001660396 5:173387299-173387321 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1002579141 5:180197094-180197116 GAGGCTCATCAGAGGCAGGCTGG - Intronic
1002916365 6:1531090-1531112 AATGCCCATCAGTGGGTGGCAGG - Intergenic
1003384611 6:5655627-5655649 AATTCTTATAAGAGGGAGGCAGG - Intronic
1004103589 6:12641789-12641811 AGGGCTTGTCAGGGGGTGGGGGG - Intergenic
1004204711 6:13581701-13581723 AAGGCCTATCAGATAGTGCCAGG - Intronic
1005028369 6:21485903-21485925 AAGGATTATCTCAGGGTGGTGGG - Intergenic
1005783216 6:29215715-29215737 AAGGGTAACCGGAGGGTGGCAGG - Intergenic
1006004979 6:30994432-30994454 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1006805134 6:36783209-36783231 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1007144695 6:39616665-39616687 AAGGATTTTCAGTGGGAGGCAGG - Intronic
1007367029 6:41401704-41401726 TAGGCTTCTTACAGGGTGGCTGG + Intergenic
1008207912 6:48685919-48685941 AGGGCTTGTCAGGGGGTGGAGGG + Intergenic
1009455813 6:63854442-63854464 GAGGCCTATCAGGGGGTGGGTGG + Intronic
1009533536 6:64851785-64851807 GTGGCTTTTCAGAGGGTGGAGGG + Intronic
1009730955 6:67605842-67605864 GGGGCATATCAGAGGGTGGAGGG + Intergenic
1009734440 6:67658837-67658859 AGGGCCTATCTGAGGGTGGGAGG - Intergenic
1009747797 6:67841512-67841534 GAGCCTTTTCAGAGGGTGGAGGG - Intergenic
1010096854 6:72057007-72057029 AGAGCCTATCAGAGGGTGGAGGG + Intronic
1010371360 6:75112201-75112223 GCGGCCTATCAGAGGGTGTCAGG + Intronic
1011967234 6:93174165-93174187 AAGGGATCTCAGAGGCTGGCGGG + Intergenic
1012008153 6:93743104-93743126 GAGGCCTATTAGAGGGTGGAGGG + Intergenic
1012299926 6:97573628-97573650 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1012814008 6:103999101-103999123 AGGGCCTATCAGAGGGTGGAGGG - Intergenic
1013452019 6:110291696-110291718 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1014315193 6:119855786-119855808 GGGGCTTTTCAGAGGGTGGAGGG + Intergenic
1014940761 6:127436062-127436084 AAGGATTATCTCAGTGTGGCAGG - Intergenic
1015385764 6:132621417-132621439 AGGGCTTGTCAGGGGGTGGGGGG - Intronic
1015592766 6:134838388-134838410 GGGACTTATCAGAGGGTGGAGGG - Intergenic
1016024512 6:139272415-139272437 AATGCTTATTTTAGGGTGGCAGG - Intronic
1016894185 6:149036407-149036429 AAGGATTATCAGTGGAAGGCAGG - Intronic
1017204326 6:151788941-151788963 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1017327030 6:153151660-153151682 CAGGCTCATAAGAGTGTGGCGGG + Intergenic
1018597874 6:165502806-165502828 AAGGCAGATCAGAGGTTGCCAGG + Intronic
1018867300 6:167756128-167756150 AGGGCTCATCTGAAGGTGGCCGG - Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019642021 7:2108652-2108674 AAGGCTTTTCACAGGGAGCCAGG + Intronic
1020404640 7:7818142-7818164 GGGTCTTATCAGAGGGTGGAAGG - Intronic
1020478723 7:8630928-8630950 GAGGCCTTTCAGAGGGTGGAGGG - Intronic
1020973391 7:14976278-14976300 AAGGTGTATCAGAGGCTGTCTGG + Intergenic
1024338444 7:48233233-48233255 ATGGCTTATTAGTGGCTGGCAGG + Intronic
1024528084 7:50366096-50366118 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1026068476 7:67096735-67096757 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1026668261 7:72363177-72363199 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1026708437 7:72715577-72715599 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1027350445 7:77306294-77306316 AAGGACTATCAGATGGGGGCAGG + Intronic
1027571037 7:79867394-79867416 GAGGCCTGTCAGAGGGTGGAGGG + Intergenic
1027862622 7:83604786-83604808 AGGGCCTATCAGCGGGTGGGGGG - Intronic
1027963454 7:84976361-84976383 AGGGCATTTCAGAGGGTGGAGGG + Intergenic
1028858435 7:95618824-95618846 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1028913392 7:96232423-96232445 ACGGCCTACCAGAGGGTGGAGGG + Intronic
1029022193 7:97376453-97376475 AGGGCCTATCAGAGGGTGGAGGG + Intergenic
1029801213 7:102949426-102949448 AGGGCTTACCAGAGGGTGGAGGG - Intronic
1029907634 7:104107538-104107560 GGGGCCTATCAGAGGGTGGGGGG - Intergenic
1030969134 7:116032670-116032692 GGGGCCTATCAGAGGGTGGAAGG + Intronic
1031894428 7:127332069-127332091 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1032301604 7:130692407-130692429 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
1032675516 7:134126790-134126812 AAGGCTTATCATTGGGGGGTGGG + Intergenic
1033717172 7:144014519-144014541 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1033847530 7:145452610-145452632 AAGGCTTACCAAAGGATGTCAGG + Intergenic
1034101391 7:148453689-148453711 AGGGCCTATCAGAGAGTGGAGGG + Intergenic
1034693517 7:153033531-153033553 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1034749686 7:153557218-153557240 ATGGCAGATCAGAGGGTGGTGGG + Intergenic
1035493139 7:159297266-159297288 TGTGCTTATCAGAGGGTGGAGGG - Intergenic
1037255922 8:16953525-16953547 GATGGTTATCAGAGGCTGGCTGG + Intergenic
1038347508 8:26745799-26745821 AATCCTTATCATAGAGTGGCAGG + Intergenic
1040539555 8:48340051-48340073 GGGGCTTTTCAGAGGGTGACAGG - Intergenic
1041116808 8:54547949-54547971 GTGGCCTATCAGAGGGTGGAGGG + Intergenic
1042132582 8:65602250-65602272 AGGGCATATCAGGGGGTGGGGGG + Intergenic
1042405734 8:68403536-68403558 AAGGCCTGTCAGGGGGTGGGGGG - Intronic
1043258906 8:78172776-78172798 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
1043282796 8:78489338-78489360 AAGGCCTATTGGAGGGTGGAGGG - Intergenic
1043397115 8:79849212-79849234 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1043514395 8:80982617-80982639 AGAGCTTATCAGATGGTAGCTGG - Intronic
1044109488 8:88254296-88254318 CAGGCCTATCAGAGAGTGGAGGG + Intronic
1044128396 8:88488044-88488066 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1044804512 8:95991477-95991499 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
1045148940 8:99381057-99381079 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1045736588 8:105303039-105303061 AGGGCTTATCAGAAGGTGGAGGG + Intronic
1045811042 8:106220416-106220438 GGGGCATATCAGAGGGTGGAGGG + Intergenic
1048545455 8:135382473-135382495 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1049416876 8:142499382-142499404 ACGGCTTCTGAGAGGATGGCAGG + Intronic
1049731691 8:144181479-144181501 AGGGCTGAGGAGAGGGTGGCAGG - Intronic
1050159923 9:2707608-2707630 ATGGCCTATCAGGGGGTGGGGGG + Intergenic
1050196801 9:3093387-3093409 GGGGCCTATCAGAGGGTGGACGG - Intergenic
1050323093 9:4473629-4473651 GGGGCTTATCAGAGAGTGGAGGG + Intergenic
1050797096 9:9559107-9559129 TAGGCTCATAAGAGTGTGGCAGG - Intronic
1051236518 9:15005940-15005962 AGGGCTTGTCAGGGGGTGGGGGG - Intergenic
1052180753 9:25524511-25524533 GGGGCATATCAGAGGGTGGAGGG - Intergenic
1053187584 9:36031446-36031468 AGGGCTTATTGGAGGCTGGCAGG + Intergenic
1053193731 9:36098003-36098025 AGTGGTTACCAGAGGGTGGCTGG + Intronic
1054330888 9:63754798-63754820 AGGGCCTATCAGGGGGTGGGGGG - Intergenic
1056108972 9:83375706-83375728 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1056853439 9:90103840-90103862 ATTGCTTATAAGAGGGAGGCAGG + Intergenic
1057593172 9:96391513-96391535 TTGCCTTATCAGAGGGAGGCAGG + Intronic
1058567554 9:106302682-106302704 GGGGCTTAGCAGAGGGTGTCTGG + Intergenic
1059258391 9:112952081-112952103 AGAGCCTATCAGAGGGTGGAGGG + Intergenic
1059915930 9:119100160-119100182 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
1059972512 9:119682178-119682200 GAGGCCTTTCAGAGGGTGGAGGG - Intergenic
1060342647 9:122790504-122790526 GGGGCTTATCGGAGGGTGGAGGG + Intergenic
1061018999 9:128001849-128001871 GATGCTAATCAGAGGCTGGCTGG - Intergenic
1061464004 9:130763559-130763581 AAGGCTTAACTGGGGCTGGCAGG + Intronic
1061824749 9:133251213-133251235 AACGCTTCTCAGAAGGCGGCGGG + Intronic
1203530240 Un_GL000213v1:135584-135606 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1185718132 X:2359913-2359935 GAGGCCTATCAGAAGGTGGGAGG + Intronic
1186122263 X:6375936-6375958 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1187563246 X:20422424-20422446 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1188012167 X:25068792-25068814 AAGGGTTCTTAGAGGGAGGCAGG - Intergenic
1188036341 X:25321607-25321629 AGGGCCTATCTGAGGGTAGCGGG - Intergenic
1188184799 X:27100525-27100547 AGGGCCTATCTGAGGGTGGAGGG - Intergenic
1188534962 X:31186489-31186511 GTGGCTTATCAGAGGATGGAGGG + Intronic
1188667159 X:32838398-32838420 ATGGCCTGTCAGAGGGTGGGGGG - Intronic
1191163140 X:57356941-57356963 AGGGCTTGTCAGAGGGTGGAGGG - Intronic
1191700419 X:64036099-64036121 GAGGCCTATCAGAGGCTGGACGG + Intergenic
1191777525 X:64832414-64832436 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192003192 X:67178966-67178988 AGAGCCTGTCAGAGGGTGGCAGG + Intergenic
1192022768 X:67411727-67411749 GAGGCCTTTCAGAGGGTGGAAGG - Intergenic
1192145441 X:68679341-68679363 AAAGCCTATCATAGGGAGGCTGG - Intronic
1192526918 X:71854708-71854730 AGGGCCTATCAGATGGTGGAGGG - Intergenic
1192595626 X:72405132-72405154 GGGGCTTATCAGAGGATGGAGGG - Intronic
1192717085 X:73655059-73655081 GGGGCTTGTCAGAGGGTGGGAGG - Intronic
1192758662 X:74072153-74072175 AGGGCTTGTCAGCGGGTGGGGGG - Intergenic
1192832671 X:74767161-74767183 TAGGCCCAGCAGAGGGTGGCTGG + Intronic
1192857697 X:75031392-75031414 CAGGCCTGTCAGAGGGTGGGGGG - Intergenic
1192867226 X:75147658-75147680 GGGGCCTATCAGAGGGTGGAAGG + Intronic
1193615435 X:83682704-83682726 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1193634529 X:83931985-83932007 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1194549572 X:95279803-95279825 AATGCTTATCAGTGGTAGGCTGG + Intergenic
1194563632 X:95454071-95454093 AAGTCCTATCAGAGGGTGAAGGG - Intergenic
1194924998 X:99814474-99814496 AGGGCCTATCAGGGGGTGGGGGG - Intergenic
1195567299 X:106357434-106357456 GAAGCCTATCAGAGGGTGGAGGG - Intergenic
1195795469 X:108642271-108642293 AAGGCTCATCAGGTGGGGGCAGG - Intronic
1196239234 X:113321659-113321681 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1196672649 X:118385492-118385514 GAGGCCTATCAGAGGGTGAAGGG + Intronic
1196804493 X:119572546-119572568 AAGGCTTATCAGATTATGTCAGG - Intergenic
1196943750 X:120803645-120803667 TTGGCCTATCAGAGGGTGGAGGG - Intergenic
1196994553 X:121367399-121367421 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1197192487 X:123663385-123663407 AAAGCCTATCAGAGGTTGCCAGG + Intronic
1197359917 X:125488515-125488537 GGGGCTTATCAGAGGGTGGAGGG - Intergenic
1198268104 X:135029836-135029858 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1198501187 X:137248815-137248837 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
1198910885 X:141612972-141612994 AAAGCATATCAGTGGTTGGCGGG - Intronic
1199088126 X:143652861-143652883 AGGGCCTGTCAGGGGGTGGCGGG + Intergenic
1199218699 X:145291656-145291678 GGGGCTTATCAGAGGGTGGAAGG + Intergenic
1199783283 X:151082528-151082550 TAGGCTGACCACAGGGTGGCGGG - Intergenic