ID: 1175978651

View in Genome Browser
Species Human (GRCh38)
Location 20:62726108-62726130
Sequence TCGGGCTGGAATGGAGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175978651_1175978663 20 Left 1175978651 20:62726108-62726130 CCGGCAGCTCCATTCCAGCCCGA 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1175978663 20:62726151-62726173 ACCGGTCTCAACCCTTTCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1175978651_1175978659 2 Left 1175978651 20:62726108-62726130 CCGGCAGCTCCATTCCAGCCCGA 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1175978659 20:62726133-62726155 GGTGAGCAGCCCTTCCGAACCGG 0: 1
1: 0
2: 1
3: 4
4: 44
1175978651_1175978665 21 Left 1175978651 20:62726108-62726130 CCGGCAGCTCCATTCCAGCCCGA 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1175978665 20:62726152-62726174 CCGGTCTCAACCCTTTCTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 54
1175978651_1175978666 22 Left 1175978651 20:62726108-62726130 CCGGCAGCTCCATTCCAGCCCGA 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1175978666 20:62726153-62726175 CGGTCTCAACCCTTTCTGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175978651 Original CRISPR TCGGGCTGGAATGGAGCTGC CGG (reversed) Intronic
900212546 1:1463203-1463225 TGGGGCAGCCATGGAGCTGCAGG - Intronic
900227256 1:1539231-1539253 CCGGGCTGGAGAGGAGCTGAGGG - Intronic
901260244 1:7865721-7865743 TCGGGCTGGTCTGGAACTCCTGG - Intergenic
901518376 1:9764591-9764613 CCAGGCTGGAATGCAGCAGCGGG - Intronic
902303309 1:15518500-15518522 GTGGGCAGCAATGGAGCTGCAGG + Intronic
902646788 1:17805114-17805136 TGTGGCTGGAAGGGAGCTGGAGG - Intronic
902944728 1:19826695-19826717 TCGGGCTGGTCTCGAACTGCTGG + Intergenic
904966024 1:34373294-34373316 CCCGGCTGGAGTGGAGCTGGAGG + Intergenic
906677174 1:47701626-47701648 TCAGGCTGGATTCCAGCTGCTGG - Intergenic
909390481 1:75114656-75114678 TCAGGCTGGACTTGAGCTCCTGG - Intergenic
910237482 1:85049899-85049921 TCTGTCTGTAATGGAGCAGCCGG - Intronic
911316981 1:96367664-96367686 TCAGGCTGGTATGGAACTCCTGG + Intergenic
911454964 1:98111097-98111119 TGGGGCTGGAAAGGGGCTGTAGG + Intergenic
913691667 1:121285453-121285475 TAGAGCTGGAATTGGGCTGCAGG + Intronic
914145879 1:144994502-144994524 TAGAGCTGGAATTGGGCTGCAGG - Intronic
915938170 1:160101001-160101023 TGGGGCTGGGAAGGAGCTGGGGG + Intergenic
918011047 1:180586825-180586847 TCCTGCTGAAATGGAGATGCTGG - Intergenic
918991590 1:191703643-191703665 CCAGGCTGGAATGCAGCGGCGGG + Intergenic
920196452 1:204230448-204230470 CCGGGCTGGCCGGGAGCTGCAGG + Exonic
920235980 1:204505408-204505430 CCAGGCTGGAATGGAGTGGCAGG - Intergenic
921259421 1:213372354-213372376 TCAGGCAGGAATGCAGGTGCAGG + Intergenic
922229215 1:223671182-223671204 TCAGGCTGGTCTGGAACTGCTGG - Intergenic
922572463 1:226642176-226642198 CCAGGCAGGAAAGGAGCTGCTGG - Intronic
1063160287 10:3413668-3413690 TGGGCCTGGCATGGAGCAGCTGG - Intergenic
1063867414 10:10380930-10380952 TCAGGGTGGAATGGAGCTGGCGG - Intergenic
1066266618 10:33782395-33782417 TCTGGCTGTAATGAAGCTGGAGG - Intergenic
1066703832 10:38156920-38156942 TCGGCCTGGAATGGGGCTCGGGG + Intergenic
1067741454 10:48898669-48898691 GAGGGCTAGAGTGGAGCTGCTGG - Intronic
1067853066 10:49768065-49768087 GCCGGCTGCAATGGAGCTGGAGG - Intergenic
1069697449 10:70397303-70397325 TAGGGCTGGAGAGGAGCAGCAGG - Intergenic
1069863655 10:71486850-71486872 TGGAGCTGCAATGCAGCTGCTGG + Intronic
1069962710 10:72087898-72087920 TCGGGCAGGTGTGGAGCTGGGGG + Intronic
1071452495 10:85810569-85810591 TCTGCCTGGAATGGGTCTGCTGG - Intronic
1072281642 10:93871000-93871022 TCAGGCTGGGGTGCAGCTGCAGG - Intergenic
1073180756 10:101581485-101581507 GTGGCCTGGAATGGAGCTGGGGG + Intronic
1073425031 10:103451160-103451182 GCGGGGTGGAGCGGAGCTGCTGG - Exonic
1073959588 10:108911648-108911670 TGGGGCTGGATGGGAGCTTCTGG - Intergenic
1074974942 10:118572572-118572594 TCTGGCTGGAATGGAAGTCCTGG - Intergenic
1075155726 10:119974532-119974554 AAGGGCTGGAAAGGAGCAGCAGG + Intergenic
1075245569 10:120819063-120819085 ACGGGCTGGAAGGGAGCCGGGGG + Intergenic
1076408094 10:130226708-130226730 TCTGGATGGATTGGAGGTGCAGG + Intergenic
1077021765 11:420162-420184 TGGGGCTGGAACAGAGCAGCCGG - Intronic
1077277498 11:1721049-1721071 TGGGGCTGGAAGGGAGTGGCGGG + Intergenic
1078759555 11:14241513-14241535 TCGGGGGTGAAGGGAGCTGCTGG + Intronic
1082857801 11:57824631-57824653 TAGGGCTGGACTGAAGCTGGAGG + Intergenic
1083223110 11:61266328-61266350 TCAGGCTGGTATGGAACTTCTGG - Intronic
1084037127 11:66518799-66518821 TCAGGCTGGAATGCAGTGGCAGG + Intronic
1088744382 11:112793324-112793346 GAGGGCTGGAATGGAGCAGAAGG + Intergenic
1091286858 11:134412559-134412581 GCGGGGTGGAATGGGGGTGCAGG - Intergenic
1091896307 12:4108011-4108033 CCGGGCTGGTCTGGAGCTCCTGG - Intergenic
1092137826 12:6161810-6161832 GCGTGCGGGGATGGAGCTGCGGG + Intergenic
1096018294 12:48298555-48298577 TCAGGCTGGTCTGGAGCTCCTGG - Intergenic
1096192733 12:49630969-49630991 TCGGGCTGGAATGGCATTGGTGG + Intronic
1097163540 12:57068139-57068161 TTGGGCTGGAGTGGGGTTGCTGG - Intronic
1099710115 12:86212846-86212868 CCAGGCTGGAGTGCAGCTGCGGG - Intronic
1101936288 12:109060696-109060718 TCAGGCTGGAATGCAGTGGCGGG + Intronic
1102988395 12:117297248-117297270 TGGGGTTGGAATGCAGCTGCAGG + Intronic
1104682532 12:130761492-130761514 CCTGCCTGGAACGGAGCTGCAGG + Intergenic
1105781187 13:23706294-23706316 GAGGCCTGGAGTGGAGCTGCTGG + Intergenic
1106504947 13:30363049-30363071 GCGGGCTGGAAGGGAACAGCTGG - Intergenic
1107562991 13:41573829-41573851 CCGGGCTGGTATCGAGCTCCTGG + Intronic
1113545880 13:111149906-111149928 TCTTACTGTAATGGAGCTGCAGG + Intronic
1113554110 13:111217496-111217518 TGGGGCTGGAGTGGTGCTGGTGG + Intronic
1113719900 13:112547304-112547326 TCGGGCTGGCATTGAGATGGAGG - Intronic
1115603876 14:34981411-34981433 TCAGGCTGGAGTGAAGCAGCGGG + Intergenic
1115650992 14:35403168-35403190 TCAGGATGGAGTGGAGGTGCGGG + Exonic
1116653275 14:47621397-47621419 CCAGGCTGGACTGGAGCTCCTGG + Intronic
1116969978 14:51054134-51054156 TCAGGCTGGCCTGGAGCTCCTGG + Intronic
1121675250 14:95747110-95747132 TCAGCCTGGAATTGAACTGCAGG + Intergenic
1123011504 14:105351946-105351968 TCAGGCTGGACTTGAGCTCCCGG - Intronic
1123876656 15:24630219-24630241 CCAGGCTGGAGTGCAGCTGCAGG - Intergenic
1126129040 15:45323033-45323055 TCAGGCTGGAATGCAGTGGCAGG + Intergenic
1127207868 15:56739200-56739222 TCAGGCTGGAATGTAGTGGCAGG - Intronic
1128434263 15:67630026-67630048 TCAGGCTGGCCTGGAACTGCTGG - Intronic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1130605978 15:85317354-85317376 CCGGGCTGGAATGCAGTGGCAGG + Intergenic
1131481548 15:92786507-92786529 TCAGGCTGGAGTGCAGCGGCAGG - Intronic
1131809579 15:96158747-96158769 CCGGGCTGGAGTGCAGCGGCAGG - Intergenic
1132890091 16:2199529-2199551 TCAGCCTGGAATGGAGCTGGCGG + Intergenic
1133039897 16:3055104-3055126 TGGGCCTGGAATGGGGCTGAGGG + Intronic
1134233483 16:12447676-12447698 CCTGGCTGGAATTGAGATGCAGG + Intronic
1134279616 16:12805901-12805923 TCAGGCTGGAGTGCAGCGGCGGG - Intergenic
1135357130 16:21778662-21778684 TCAGGCTGGAATGCAGTGGCAGG - Intergenic
1135455634 16:22594778-22594800 TCAGGCTGGAATGCAGTGGCAGG - Intergenic
1135765539 16:25174955-25174977 CCTGGATGAAATGGAGCTGCTGG + Exonic
1135802716 16:25513257-25513279 TCAGGCTGGTCTGGAGCTCCTGG - Intergenic
1136168780 16:28474891-28474913 TCAGGCTGGACTGGAACTCCTGG - Intergenic
1138972583 16:62163578-62163600 CCGGGCTGGAATGCAGTGGCAGG - Intergenic
1139427830 16:66894219-66894241 TGGGTCTGGGATGGGGCTGCAGG + Intronic
1141902234 16:86998464-86998486 TCGGGCAGGAATGGGGCAGGAGG - Intergenic
1142544073 17:686674-686696 TGGGGCTGGAGAGGAGCTGATGG + Intronic
1142977606 17:3655203-3655225 TCGGGCTGGAAAGGAGTTTGGGG - Exonic
1144471035 17:15541458-15541480 TCGGGCTGGATTTGGTCTGCAGG + Intronic
1144804143 17:17952976-17952998 TAGGGCTGCAATGGGGCTTCTGG + Intronic
1144925433 17:18803219-18803241 TCGGGCTGGATTTGGTCTGCAGG - Intronic
1145061699 17:19738108-19738130 TGGGGCTGGGCTGGGGCTGCAGG + Exonic
1145832593 17:27928915-27928937 CCAGGCTGGAGTGCAGCTGCAGG + Intergenic
1146908254 17:36631713-36631735 TGGGGCTGGAACTGAGGTGCTGG + Intergenic
1146940673 17:36842394-36842416 TGGGGCTGGAAGGGGGCTGTTGG - Intergenic
1147745195 17:42690610-42690632 CAGAGGTGGAATGGAGCTGCTGG + Intronic
1149277331 17:55056795-55056817 CCAGGCTGGAATGGAACTGCTGG - Intronic
1149754242 17:59174517-59174539 TCGGGCTGGAGTGCAGTGGCAGG + Intronic
1150129188 17:62657790-62657812 TCAGGCTGGGCTGGAACTGCTGG - Intronic
1150466943 17:65401980-65402002 TCGTGTTGGAAAGGAGGTGCTGG - Intergenic
1151769542 17:76151069-76151091 TAGGCCTGGACTGGAGCTGCTGG - Intronic
1151785812 17:76274379-76274401 ACAGGCTGGAGGGGAGCTGCCGG + Intronic
1152703261 17:81829967-81829989 TGGGGCAGGAGTGGAGCAGCAGG - Intronic
1153057682 18:963427-963449 TGGGGCTGGAGTGGGGCTGGTGG + Intergenic
1153332359 18:3886890-3886912 TCTGGCTGGAACGCAGCTGTGGG + Intronic
1153548878 18:6239827-6239849 TCAGGTTGGAATGAAGCTGGAGG - Exonic
1155328319 18:24688604-24688626 GAGAACTGGAATGGAGCTGCTGG + Intergenic
1156498092 18:37538982-37539004 TGGGGCAGGGAGGGAGCTGCTGG - Intronic
1156700693 18:39820871-39820893 TTGGGCTGAACTGGAACTGCTGG + Intergenic
1160702930 19:517337-517359 CAGGGCTGGATGGGAGCTGCGGG + Intronic
1160797782 19:953707-953729 TCTGCCTGGAATGCAGCTCCCGG - Intronic
1161000773 19:1909734-1909756 CCTGGCTGGAGTGGGGCTGCGGG - Intronic
1161390972 19:4019958-4019980 CCGGGCTGGAGTGCAGCGGCAGG + Intronic
1161405344 19:4088381-4088403 TGGGGCTCCAATGAAGCTGCAGG + Intergenic
1161902830 19:7132264-7132286 TCGCTCTGGAACGGGGCTGCAGG - Exonic
1163310008 19:16508433-16508455 TCAGGCTGGAATGCAGTTGGGGG + Intronic
1165432640 19:35781295-35781317 CGGGGCTGGAGTGGAGGTGCTGG - Intronic
1166118153 19:40668084-40668106 CCAGGCTGGAAGGCAGCTGCAGG + Exonic
1168103499 19:54153294-54153316 TCGGCCTAGACTGGGGCTGCTGG - Intronic
925791659 2:7495013-7495035 TCAGGCTGGAGTGGAGTGGCAGG + Intergenic
926441145 2:12890032-12890054 GTGGGGTGGAAAGGAGCTGCAGG + Intergenic
926938251 2:18107851-18107873 GCAGGCTGGAATTGACCTGCAGG + Intronic
927969204 2:27293977-27293999 TCGGGCTGGAGTGCAGTGGCAGG - Intronic
927980189 2:27370176-27370198 TGGCGCTGGAACGGAGCGGCGGG + Intronic
930740915 2:54831796-54831818 AGGGGCTGGGATGGAGCTCCTGG + Intronic
930951298 2:57146645-57146667 TCAGGCTGGCACTGAGCTGCAGG + Intergenic
931671650 2:64653581-64653603 TCGGGCTGGAGGGGATCCGCGGG - Intronic
932349417 2:71020409-71020431 TTGGGCCGTAAAGGAGCTGCCGG - Intergenic
932622611 2:73274082-73274104 TACAGATGGAATGGAGCTGCGGG - Intronic
933912244 2:86951921-86951943 TCAGGCTGGAGTGCAGCAGCTGG + Intronic
934010751 2:87817976-87817998 TCAGGCTGGAGTGCAGCAGCTGG - Intronic
934021303 2:87956598-87956620 TCAGTCTGGAATGGAGTTTCTGG - Intergenic
934978944 2:98824511-98824533 TCGGGAAGGAAAGGAGCTCCAGG + Intronic
935992229 2:108729757-108729779 TCAGGCTGGAGTGCAGCAGCTGG + Intronic
936127546 2:109802407-109802429 TCCGGCTGGAGTGCAGCAGCTGG + Intronic
936217151 2:110569078-110569100 TCCGGCTGGAGTGCAGCAGCTGG - Intronic
936426291 2:112423662-112423684 TCCGGCTGGAGTGCAGCAGCTGG - Intronic
937013891 2:118586138-118586160 TCAGTCTTTAATGGAGCTGCAGG - Intergenic
939181392 2:138806841-138806863 TCAGGCTGGTCTGGAGCTCCTGG + Intergenic
943689218 2:190851666-190851688 TCAGGCTGGAATGTAGTGGCAGG - Intergenic
943811728 2:192195673-192195695 TTGGGCTGGGTCGGAGCTGCGGG - Exonic
944509493 2:200450813-200450835 ACAAGCTGGAATGGAGCTGGGGG + Intronic
946016114 2:216605480-216605502 GCAGGCTGAAATGAAGCTGCAGG - Intergenic
946155084 2:217801917-217801939 TCAGGCTGGAGTGGAGGGGCTGG + Exonic
946250876 2:218411340-218411362 CCAGGCTGGAATGGAACTCCTGG - Intergenic
947397074 2:229696780-229696802 CACGGCTGGAATGGAGCTTCTGG + Intronic
947704785 2:232265415-232265437 TGGGGCTGGACTAGAGCTGGGGG - Intronic
948516804 2:238509298-238509320 GCCCGCTGGAATGGAGGTGCGGG + Intergenic
948850758 2:240704263-240704285 TCTGGCTGGACAGGACCTGCTGG - Intergenic
1168999388 20:2156117-2156139 TGGAGCTGGCCTGGAGCTGCTGG - Intronic
1169096982 20:2910524-2910546 CCAGGCTGGAATGGAGTGGCTGG + Intronic
1169405099 20:5315967-5315989 TGGGGCGGGAAGGGGGCTGCTGG - Intergenic
1169590461 20:7135546-7135568 CCAGGCTGGAGTGCAGCTGCAGG + Intergenic
1170032992 20:11961623-11961645 TAGGGCTGGAATTGGCCTGCAGG - Intergenic
1171386384 20:24771970-24771992 GCTGGCCGGAATGGAGCTGGAGG + Intergenic
1171475918 20:25408645-25408667 TCAGGCTGGAATGCAGTGGCAGG - Intronic
1172384860 20:34526933-34526955 TTGGGGTGGAGGGGAGCTGCAGG - Intronic
1172501608 20:35432036-35432058 TGGGCCTGGAAGGGAGGTGCTGG - Intergenic
1173608794 20:44351556-44351578 TCAGGCTGGAATGCAGTCGCTGG - Intergenic
1175978651 20:62726108-62726130 TCGGGCTGGAATGGAGCTGCCGG - Intronic
1176201897 20:63864853-63864875 TCGGGCTGGAAAGGATCTCAAGG + Intergenic
1178288016 21:31342233-31342255 CCAGGCTGGACTGGAGCTCCTGG - Intronic
1179153614 21:38830848-38830870 TCAGGCTTTAATGGGGCTGCTGG + Intergenic
1179651501 21:42812114-42812136 TCTGTCTGTAATGGAGCAGCCGG + Intergenic
1180024288 21:45150228-45150250 CCAGGCTGGAATGCAGCGGCAGG - Intronic
1180075099 21:45458083-45458105 GTGGGCTGGAATGGAGGGGCAGG + Intronic
1180746465 22:18092352-18092374 TCGGGCTGGTAGGAAGCTACAGG + Exonic
1181776193 22:25161608-25161630 GAGTGCTGGAAGGGAGCTGCTGG + Intronic
1182718511 22:32378640-32378662 TGGGGCTGGACTGGAGCTGGAGG + Intronic
1183438347 22:37808207-37808229 TTGCGCTGGAATGGAGGTCCTGG + Intronic
1183715196 22:39529325-39529347 GGAGGCTGGAATGGAGCTGGTGG - Exonic
1184017913 22:41800017-41800039 CCGGGCGGGAAGGGAGCTGGAGG - Intergenic
951052854 3:18113997-18114019 ACGTGCTGAAAGGGAGCTGCAGG - Intronic
951710683 3:25582715-25582737 TGGGGCTGGAAGAGTGCTGCAGG - Intronic
952899297 3:38098985-38099007 TTGGGCTGGGATGGGGCTGGGGG + Intronic
954419550 3:50411450-50411472 TGTGTCTGGAATGGAGCTGGGGG - Intronic
956385023 3:68707580-68707602 CCAGGCTGGACTGGAGCTCCTGG - Intergenic
956498488 3:69854963-69854985 TAGGGCTGGGATGGGGCAGCAGG - Intronic
956761875 3:72450913-72450935 CCGGGCTGGTCTGGAGCTCCTGG + Intergenic
957549703 3:81687987-81688009 TTGGTGTGGAATGAAGCTGCTGG - Intronic
961249371 3:125486839-125486861 TCAGGCTGGTCTGGAACTGCTGG - Intronic
961371554 3:126434767-126434789 TGGGGCTGGACTGGAGGGGCTGG + Intronic
961426513 3:126852584-126852606 TGGTGCTGGAATGGTGCTGCAGG - Intronic
964207649 3:154192079-154192101 ACTGGCTGCACTGGAGCTGCTGG + Intronic
968273923 3:197425407-197425429 TCTGGCTGGAAGGAAGGTGCAGG + Intergenic
968699257 4:2047027-2047049 GCGGGGTGGAACGGAGCTGCGGG - Intergenic
969050359 4:4368661-4368683 GAGGGCTGGCATAGAGCTGCAGG + Intronic
969711570 4:8847222-8847244 TCAGGCTGGACTGGAGCTCCTGG - Intronic
969989231 4:11243394-11243416 CCAGGCTGGTCTGGAGCTGCTGG + Intergenic
981399506 4:144296982-144297004 TCAGGCTGGAATGCAGTGGCGGG + Intergenic
984670019 4:182472930-182472952 TCAGGCTGGTCTGGAACTGCTGG + Intronic
985771669 5:1815590-1815612 TGGGGAGTGAATGGAGCTGCAGG + Intronic
987538549 5:19222211-19222233 GAAGGCTGGATTGGAGCTGCAGG + Intergenic
988931541 5:36040061-36040083 GGAGGCTGGAATGGAGATGCTGG + Intronic
991278721 5:64884174-64884196 TAGGGCTAGAATGGGGCTGATGG + Intronic
991666549 5:69005558-69005580 TCTGGCTGGAAAGGAGGTGCTGG - Intergenic
992127133 5:73653772-73653794 AAGGGCTGGAAAGGAGCTGTAGG - Intronic
992309260 5:75478268-75478290 CCAGGCTGGAATGCAGCAGCAGG - Intronic
993227670 5:85188062-85188084 TCAGGCTGGAATGCAGTGGCAGG - Intergenic
994383751 5:99103076-99103098 CCAGGCTGGTCTGGAGCTGCTGG + Intergenic
997759659 5:136433025-136433047 TGGGGCTGGATTGGAGCTGTAGG - Intergenic
997997821 5:138600613-138600635 TAGCGCTGGTTTGGAGCTGCTGG - Intergenic
1000794263 5:165645660-165645682 TCTGGCTGAAATGGAGCAGGGGG - Intergenic
1000899627 5:166896782-166896804 TCAGGCTGGAATGCAGTGGCGGG - Intergenic
1001328155 5:170744354-170744376 GCAGGCTGGAAAGGGGCTGCAGG + Intergenic
1001496512 5:172191584-172191606 TCTGGCTGGTATGGAACTCCTGG - Intergenic
1001565720 5:172697914-172697936 TGGGGGTGGACTGGAGCTGAGGG + Intergenic
1001995300 5:176152728-176152750 TCGGGGTGGGGTGGAGCTGTGGG - Intergenic
1002092759 5:176814543-176814565 AGGGGCTGGACTGAAGCTGCGGG - Intronic
1002816230 6:683200-683222 TCTTGCTGGAATGGAGTTGGTGG - Intronic
1004335337 6:14759262-14759284 GTGGGCTGGAATGGAGCGGTGGG - Intergenic
1006067717 6:31474411-31474433 TCAGGCTGGGAGGGAGCTGGGGG + Intergenic
1006743512 6:36325530-36325552 TGGGGCTGGAAGACAGCTGCTGG + Intronic
1006750246 6:36372530-36372552 GGGGGCTGGAATGGGGCAGCAGG + Intronic
1007578835 6:42943191-42943213 TCAGGCTGGACTGGAACTCCTGG - Intergenic
1007579474 6:42948276-42948298 TCAGGCTGGACTGGAACTCCTGG - Intergenic
1010234365 6:73562956-73562978 CCAGGCTGGAATGCAGCTGCAGG + Intergenic
1013013404 6:106140292-106140314 TCGGGCATGAATGGTGCTGTTGG + Intergenic
1015786284 6:136923272-136923294 AGGGGCTGGAATGGAGGTGGGGG + Intronic
1017140783 6:151188306-151188328 TCAGGCTGGAATGCAGAGGCAGG + Intergenic
1017254447 6:152317267-152317289 CCCGGCTGGAATGCAGCAGCTGG + Intronic
1017971177 6:159314159-159314181 TGAGCCTGGCATGGAGCTGCTGG + Intergenic
1018206965 6:161445327-161445349 TTGGGCTGGAATGCAGTTGCTGG + Intronic
1018648630 6:165972243-165972265 GCTGGCCGGGATGGAGCTGCTGG + Intronic
1019638685 7:2090701-2090723 TGAGGCTGGACTGGAGCTACAGG + Intronic
1024969148 7:55052767-55052789 CCGGGTGGGAATGGAGCTGGGGG + Intronic
1026607457 7:71827967-71827989 TGGGGCTGGAAGGGAGATGAGGG + Intronic
1027940977 7:84678991-84679013 ACGGGCTGCTATGGATCTGCTGG + Intergenic
1031683419 7:124703004-124703026 ACTGGCTGGAATGGAGTGGCAGG + Intergenic
1033343214 7:140507731-140507753 TCAGGCTGGCATGCAGCAGCAGG - Intergenic
1034473536 7:151269509-151269531 TCAGGCTGGATGGGAGCTGTGGG + Intronic
1036186610 8:6627679-6627701 CCAGGCTGGACTCGAGCTGCTGG - Intronic
1037347911 8:17919324-17919346 TCAGGCTGGTCTGGAGCTCCTGG + Intergenic
1038340276 8:26680184-26680206 TTGGCCTGGAATGGAGCACCAGG - Intergenic
1038779434 8:30557570-30557592 TCTGGCTGAAATGGAGGTGCAGG - Intronic
1039444737 8:37621990-37622012 TCTGGCTGGAATGAAGGTGAGGG - Intergenic
1040853236 8:51923488-51923510 TCTGTCTGTAATGGAGCAGCCGG + Intergenic
1044231367 8:89782252-89782274 CCTGGGTGGAATGGAGCTGTAGG + Intronic
1044943988 8:97373800-97373822 CCAGGCGGGAATGGAGCAGCTGG - Intergenic
1045394452 8:101747137-101747159 TGGGGCAGGAAAAGAGCTGCTGG - Intronic
1046340376 8:112846445-112846467 CCAGGCTGGAATGCAGCAGCAGG + Intronic
1048016047 8:130498759-130498781 TCAGGCTGGGAAGGAGCTGGTGG + Intergenic
1048208943 8:132438884-132438906 TCTGGCTGGAATGGACCTTAAGG - Intronic
1049159774 8:141089713-141089735 TCGGGCTGGAGTGAAGGTGAAGG + Intergenic
1049499463 8:142953894-142953916 TCTGTCTGTAATGGAGCAGCCGG - Intergenic
1050302485 9:4273908-4273930 TGAGGGTGGAATGGAGGTGCAGG - Intronic
1055556328 9:77477301-77477323 CCAGGCTGGAATGCAGTTGCAGG - Intronic
1060536681 9:124395273-124395295 TCGGGCTGGTCTGGAACTTCTGG - Intronic
1062262976 9:135672033-135672055 CCAGGCTGAAATGGAGCTGTTGG + Intergenic
1185852442 X:3501677-3501699 TCTGGGTGGCATAGAGCTGCCGG + Intergenic
1188620596 X:32218201-32218223 TTGGTCTGGAATGGAGCCCCAGG - Intronic
1193472467 X:81923993-81924015 CTGGGCTAGAATGGAGATGCAGG + Intergenic
1195268511 X:103207738-103207760 CCGGGCTGGCATGGAACTCCTGG + Intergenic
1196668692 X:118343727-118343749 CCAGGCTGGAATGCAGCGGCGGG + Intergenic
1197716650 X:129713107-129713129 TCAGGCTGGTCTGGAGCTCCTGG - Intergenic
1198084914 X:133273269-133273291 TTGGGCTGGAAGGCAGCTGAAGG - Intergenic
1198492341 X:137154355-137154377 CTGGGATGGAATGGAGCTGGAGG + Intergenic
1199123223 X:144082523-144082545 TCAGTCTGGAATGGAGTTTCTGG + Intergenic
1202596772 Y:26548501-26548523 TCGCCCTGAAATGGAGCTCCTGG + Intergenic