ID: 1175983647

View in Genome Browser
Species Human (GRCh38)
Location 20:62753716-62753738
Sequence AGTGGAATAACAGCCATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175983647_1175983652 -9 Left 1175983647 20:62753716-62753738 CCATTGATGGCTGTTATTCCACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1175983652 20:62753730-62753752 TATTCCACTGCCCCAGGGAGGGG 0: 1
1: 0
2: 3
3: 19
4: 175
1175983647_1175983662 23 Left 1175983647 20:62753716-62753738 CCATTGATGGCTGTTATTCCACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1175983647_1175983651 -10 Left 1175983647 20:62753716-62753738 CCATTGATGGCTGTTATTCCACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1175983651 20:62753729-62753751 TTATTCCACTGCCCCAGGGAGGG 0: 1
1: 1
2: 2
3: 14
4: 194
1175983647_1175983658 9 Left 1175983647 20:62753716-62753738 CCATTGATGGCTGTTATTCCACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1175983658 20:62753748-62753770 AGGGGTGCCGGTTTCTCCATTGG 0: 1
1: 0
2: 1
3: 11
4: 78
1175983647_1175983654 -3 Left 1175983647 20:62753716-62753738 CCATTGATGGCTGTTATTCCACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1175983654 20:62753736-62753758 ACTGCCCCAGGGAGGGGTGCCGG 0: 1
1: 1
2: 7
3: 42
4: 373
1175983647_1175983661 17 Left 1175983647 20:62753716-62753738 CCATTGATGGCTGTTATTCCACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1175983661 20:62753756-62753778 CGGTTTCTCCATTGGAAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 94
1175983647_1175983660 16 Left 1175983647 20:62753716-62753738 CCATTGATGGCTGTTATTCCACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1175983660 20:62753755-62753777 CCGGTTTCTCCATTGGAAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175983647 Original CRISPR AGTGGAATAACAGCCATCAA TGG (reversed) Intronic
900720712 1:4174185-4174207 AGAGAAATAGCACCCATCAAGGG - Intergenic
902763197 1:18597825-18597847 AGTGGACTAACAGGCCTCCATGG - Intergenic
905788976 1:40780177-40780199 AGTGAATTAACAGCCATACAAGG + Intergenic
907620827 1:55977540-55977562 AGTGGAATGACAGATATCAGAGG + Intergenic
912264160 1:108138520-108138542 AGTGTAATCAAAGCCAACAATGG + Intronic
912334852 1:108852938-108852960 AGTAGAATAACAGCAAGGAATGG + Intronic
912434663 1:109652912-109652934 AGTAGAATAATAGCCAGGAAAGG - Intergenic
913344513 1:117794743-117794765 AGTGAAATAAAAGCCAGCAGTGG + Intergenic
914817449 1:151073368-151073390 AGTGGAGGTACAGCCAGCAAGGG + Intronic
918158110 1:181870593-181870615 AGAGGAATAAAAGACATTAATGG + Intergenic
920429512 1:205908098-205908120 AGTGAAATGACAGCTATCTATGG - Intergenic
920981648 1:210842019-210842041 AGTGGAATGAGAGCACTCAATGG - Intronic
923839717 1:237655919-237655941 GATGGAAAAACAGTCATCAATGG + Exonic
924920879 1:248627822-248627844 AGTGGAATAATAGGCATCGAAGG - Intergenic
1063231941 10:4074051-4074073 AGTGGAATAATTCCCATAAATGG + Intergenic
1064347367 10:14544632-14544654 AGTGGAATTACTGCGTTCAAGGG - Intronic
1069362150 10:67654641-67654663 AGTGGAATAACAGCCAGGTGTGG - Intronic
1069953542 10:72035914-72035936 AGGGGAAATACAGCCACCAAGGG - Intergenic
1071232208 10:83601558-83601580 ATTGGAATAGCACCCAGCAAAGG - Intergenic
1071277947 10:84073569-84073591 AGTGGAATTATAGACACCAAAGG + Intergenic
1071667523 10:87575408-87575430 TGTGGAATAACAGCTAACAGTGG + Intergenic
1072380579 10:94865192-94865214 AATGTAATAAAAGCCATCCATGG - Intergenic
1073764809 10:106670553-106670575 AGTGGAATAATAGCCTTTTAAGG - Intronic
1076085606 10:127627708-127627730 AGTGGAATAACAGATACCAGAGG - Intergenic
1080110452 11:28561154-28561176 GGTGGAATAACAGCCATACTAGG - Intergenic
1080589501 11:33709448-33709470 AGTGTAATAGCATACATCAATGG - Exonic
1080605402 11:33861033-33861055 AGTGAAATGGCAGCCATCATAGG + Intronic
1083236494 11:61354153-61354175 TGTGGGATAACAGCCATGAAGGG + Intronic
1084380845 11:68811769-68811791 GATGGAATAACAGACATCACAGG + Intronic
1085716393 11:78877390-78877412 AGTGCAAGAATAGCCATCAGGGG + Intronic
1087841336 11:102923732-102923754 AGTAAAATAAAACCCATCAATGG - Intergenic
1090428072 11:126624028-126624050 GGTGGAAAAACAGTCATCACAGG - Intronic
1092042661 12:5398440-5398462 CGTGGAAGAACAGCAGTCAATGG + Intergenic
1094426003 12:30317809-30317831 AGTGGAATAACTGTCAGCAGAGG - Intergenic
1097982219 12:65745911-65745933 AGTGGAAAGAAACCCATCAAAGG - Intergenic
1099039052 12:77627985-77628007 AGTGGAATAATGGCTACCAAAGG + Intergenic
1099973923 12:89526214-89526236 ACTGGAATAAGAGCGATGAATGG + Intronic
1100218497 12:92478656-92478678 TGTGAAATAACAGGAATCAAAGG + Intergenic
1101544237 12:105696309-105696331 AATGTAATAAAAGCCATCTATGG - Intergenic
1101646926 12:106639992-106640014 AGGGGAATAATCGCCTTCAATGG - Intronic
1106358099 13:29003833-29003855 AGTGGCAGAAGAGCCATCCACGG - Intronic
1108159216 13:47620485-47620507 AGTTGAGCAGCAGCCATCAAGGG + Intergenic
1109821528 13:67663117-67663139 AGTGGAATAAAAGTGCTCAAAGG - Intergenic
1111022760 13:82476440-82476462 AGTGGAAAAACAACCATTTATGG - Intergenic
1114443364 14:22768724-22768746 AAATAAATAACAGCCATCAAAGG - Intronic
1116149915 14:41127896-41127918 ACTAGAAGAACAGCCATCATTGG + Intergenic
1118432745 14:65737794-65737816 ATTGTAATAACTGCCATAAAGGG - Intronic
1120224140 14:81771087-81771109 AATGGAATCACATCCATCACTGG + Intergenic
1120817516 14:88878850-88878872 AATGGAATAACAGCCTGCATAGG - Intronic
1121068052 14:90988184-90988206 AGAGAAATAACAACCACCAAAGG - Intronic
1124676183 15:31687799-31687821 ATTATAATAACAACCATCAAGGG + Intronic
1127397341 15:58553170-58553192 GGTGGAATAAGGGCCCTCAACGG - Intronic
1129075817 15:72995038-72995060 AGGGGATAAACAGCAATCAAAGG - Intergenic
1131792928 15:95984380-95984402 AGTTGAATAACAGTCATCTGAGG + Intergenic
1135900276 16:26452128-26452150 AGTTGTAGAACAGCCAACAAAGG - Intergenic
1138612106 16:58133559-58133581 AGTGAAATAACATCCATTATTGG - Intergenic
1138842046 16:60522013-60522035 AGTAGAATAATAGATATCAAAGG + Intergenic
1139704613 16:68732591-68732613 AGTGGAATTTCAGGCATCACTGG - Intergenic
1141162548 16:81638928-81638950 AGTGGAAAAACAGCCTGCACGGG - Intronic
1141874688 16:86815231-86815253 AGTGGAATAAAAGGAATGAATGG + Intergenic
1149272842 17:55000455-55000477 AGTAGAATAAAATTCATCAAAGG + Intronic
1149504482 17:57182835-57182857 AGTAGAATATCAGGCAACAATGG + Intergenic
1151352345 17:73539268-73539290 AGTGAAAAAACAACCATTAACGG + Intronic
1153168608 18:2290074-2290096 AATGTAATAAAAGCCATCTATGG - Intergenic
1158331338 18:56366462-56366484 AATGTAATAAAAGCCATCTATGG - Intergenic
1163684759 19:18705120-18705142 AGTGGAATAACAGCCTTAGAGGG - Intronic
1164275369 19:23712656-23712678 AGTGGAATAATAGTTATCAGAGG - Intergenic
1164647742 19:29872124-29872146 AGAGGAATGACAGCCAGGAATGG + Intergenic
1202676248 1_KI270711v1_random:9465-9487 AGTCGAATAACATCTATCCAGGG + Intergenic
927876624 2:26660032-26660054 AATGGAATAACTAACATCAATGG + Intergenic
928920250 2:36519637-36519659 AGTGGGATAACAGCTTCCAAAGG + Intronic
933253348 2:80053678-80053700 TGTGGAATTTCAGGCATCAAGGG - Intronic
934995358 2:98952939-98952961 AATGGAATAATATCCATAAATGG + Intergenic
935106620 2:100050880-100050902 TGTGGAGTAACAGCCAACAAGGG + Intronic
936955844 2:118021303-118021325 AGTGCAATGAGAGCCATCAAAGG + Intergenic
938284541 2:130099042-130099064 AGGAGAATAACAGGCACCAAGGG + Intronic
941553565 2:166946467-166946489 ATTAGAATAAGAGCCATCCAGGG - Intronic
942482161 2:176400716-176400738 AGCGGAACAACAGGCAGCAAAGG + Intergenic
943268817 2:185771675-185771697 AATGGAAAAAAAGCCCTCAAAGG - Intronic
943609044 2:190010394-190010416 AGTGGGATAATAGTCATCAATGG + Intronic
943757631 2:191573428-191573450 AGTGTGTAAACAGCCATCAAGGG + Intergenic
945761545 2:213921169-213921191 GGTGGAACAACTGCCACCAAGGG - Intronic
947400847 2:229730271-229730293 ATTGGAAGAAAACCCATCAAGGG + Intergenic
948199584 2:236120074-236120096 AGTGAAATAACAGAAAGCAAAGG - Intronic
1168888730 20:1279828-1279850 ACAGGAATAAAAGGCATCAAGGG - Intronic
1171416158 20:24982090-24982112 ATTGGAATCACAGCCAACAGGGG - Intronic
1172385206 20:34529379-34529401 AGCAGAATGAAAGCCATCAAGGG + Intronic
1172752059 20:37258097-37258119 AGGGGAAAAACAGCCAGCAGGGG + Intronic
1174324870 20:49771169-49771191 AGTTGAATAACAGGCACCAAAGG - Intergenic
1175152642 20:56947125-56947147 AATGGGATAACAGATATCAAAGG - Intergenic
1175983647 20:62753716-62753738 AGTGGAATAACAGCCATCAATGG - Intronic
1176852142 21:13928587-13928609 AGTGGAATAGCAGCCAGGCATGG - Intergenic
1177507936 21:22041382-22041404 AGTGGAATTACCGCCAGCAAGGG - Intergenic
1178950880 21:36984629-36984651 AGTGGAATAACAGGCATTGGAGG + Intronic
1181100028 22:20532775-20532797 TGTGGCAGGACAGCCATCAAGGG + Intronic
1183523417 22:38309778-38309800 TGTGGAAAAACAGACACCAAAGG + Intronic
1183562617 22:38588161-38588183 AGTGGAATACCAGCCATGAAAGG - Intronic
1184307474 22:43616021-43616043 AGTGAAATAACAGACTTTAATGG - Intronic
949299218 3:2563706-2563728 AGTTGAAAAACAGACATGAATGG - Intronic
949776225 3:7635583-7635605 AGTGGAACAACTCCCAACAAGGG - Intronic
950490993 3:13304989-13305011 AGTGGAATCACAATCAGCAAAGG + Intergenic
951198475 3:19851387-19851409 AATGTAATAAAAGCCATCTATGG + Intergenic
951678011 3:25263951-25263973 AATGTAATAGAAGCCATCAAAGG + Intronic
953456635 3:43047539-43047561 AGTGGACCAACAGCAATCAGTGG - Intronic
960492040 3:118328866-118328888 AGTGGAATACTAGGCATAAATGG + Intergenic
960588018 3:119338742-119338764 AATGCAATAACAGCAATCATTGG - Intronic
962743327 3:138379196-138379218 AGTGGAATGATTGACATCAAAGG - Intronic
967717498 3:192779245-192779267 AGTGGAATATCAGACAGCATTGG + Intergenic
970605529 4:17678022-17678044 AATGTAATAAAAGCCATCTATGG + Intronic
972709629 4:41581949-41581971 AATGGAATATTAGCCATAAAAGG - Intronic
973079000 4:45966127-45966149 AGTGGAATAGCTCCCACCAAGGG - Intergenic
973959626 4:56096882-56096904 AGTGGAATAGAAGCCATAGAAGG + Intergenic
974521590 4:62987597-62987619 AGTGGCAGAACAGCTATCAGTGG + Intergenic
975587139 4:75961473-75961495 ACTGGAATAAAAGCCCTCTAAGG - Intronic
976050256 4:81003710-81003732 AGTTGAACAACAGTCATCACAGG + Intergenic
976054413 4:81046599-81046621 AGAGCAATAATAGGCATCAAAGG - Exonic
977935434 4:102797583-102797605 ATTAGAATAAAAGCCAACAAGGG + Intronic
978013855 4:103720070-103720092 AGTGCAATCACAGCCAGCGAAGG - Intergenic
978994795 4:115137566-115137588 AGTGGTATAATAGACATGAAAGG + Intergenic
979133379 4:117077305-117077327 AGTAGAATAAGAGCCAACAAGGG - Intergenic
979995749 4:127428829-127428851 ATTGTAATAAAAGCCATCTATGG + Intergenic
980569237 4:134589078-134589100 AGTGGAATAACATACATGAGAGG - Intergenic
981831180 4:149004024-149004046 AGTGCAACAACAGCTATAAAGGG + Intergenic
983802175 4:171946481-171946503 AGATGAATAACATCCACCAAGGG - Intronic
984727722 4:183037414-183037436 AGTGGCATTACAGTGATCAAAGG - Intergenic
985700672 5:1370035-1370057 AGTCGAGTATCAGCCAACAAGGG - Intergenic
986236984 5:5920087-5920109 AGTTAAATAACTGCCTTCAATGG - Intergenic
986249568 5:6044195-6044217 AGTGGAAAAGCAGCCATCGGTGG + Intergenic
988967632 5:36436124-36436146 ATGGGAATAATAGGCATCAAAGG + Intergenic
989808817 5:45647461-45647483 AGGGGAACAACAGCCTTGAAGGG - Intronic
990017705 5:51085592-51085614 AGTTGAATAACAGACATTAAAGG - Intergenic
990051728 5:51510219-51510241 AATAGAAAAACAGCCAGCAACGG + Intergenic
993056388 5:82985454-82985476 AGTCCAGTAACAGCCATAAAAGG + Intergenic
995472681 5:112519744-112519766 AATGTAATAAAAGCCATCTATGG - Intergenic
997421411 5:133769875-133769897 AGTGGAATAATAGACACCAAAGG - Intergenic
997696967 5:135869305-135869327 ACTGCACTAACAGCCATAAATGG + Intronic
999214800 5:149923624-149923646 AGAGGAAAAAGAGCCAGCAAAGG + Intronic
999387947 5:151168761-151168783 AGTGCAAAAACAGCCATAGATGG + Intergenic
999505452 5:152190194-152190216 ATTGGAATAGCAGCCATATAGGG + Intergenic
1000950726 5:167479236-167479258 AGTAGAATAAAATCCAGCAAAGG - Intronic
1005025871 6:21462468-21462490 AAAGGAATAAAAGCAATCAATGG + Intergenic
1006964188 6:37965523-37965545 AGTGGAATAACAATCATATAAGG - Intronic
1010618742 6:78046598-78046620 AGTGGAATAACAGACATTGAAGG - Intergenic
1010778599 6:79916699-79916721 GCTGGAAAAACAGCCATGAATGG - Exonic
1011168956 6:84483012-84483034 AATGTAATAAAAGCCATCTATGG + Intergenic
1014585741 6:123195464-123195486 AGTGGGAAAAAAGCCAACAATGG + Intergenic
1015969427 6:138729485-138729507 ATTAGAATAACAGACCTCAATGG - Intergenic
1016847823 6:148586695-148586717 AGTGCAATCACAGGTATCAATGG - Intergenic
1017466426 6:154697766-154697788 AGAGGCACAACAGCCATTAAAGG + Intergenic
1018689821 6:166335660-166335682 AATGGAATACCAGGCATAAATGG + Intronic
1026636829 7:72090728-72090750 AGTGGAATATTAGCCATAAAAGG + Intronic
1026881735 7:73910406-73910428 AAAGGAATAAAAGCCAACAAAGG + Intergenic
1028597631 7:92563489-92563511 AGAGGAAGAAGAGCCAGCAAAGG - Intronic
1029958579 7:104666347-104666369 AGTGGAATAATAGTCACCAGAGG - Intronic
1030122137 7:106120330-106120352 AGTAGAACAACAGCCATACAGGG - Intergenic
1030238559 7:107293652-107293674 AGTGGAATGGCAGCCTACAAAGG - Intronic
1031380280 7:121077141-121077163 AGTAGATTAACAGCAATCAGTGG + Intronic
1031732505 7:125316102-125316124 AGAGGAAAAGCAGCCATGAAGGG + Intergenic
1032661477 7:133988686-133988708 AGAGGAGTAAGAGCCATCAAAGG + Intronic
1034521564 7:151624588-151624610 AGTGTAATCACGGCCATGAAAGG + Intronic
1036603949 8:10289972-10289994 AGAGCAATAACAGACATAAAGGG - Intronic
1037212289 8:16405419-16405441 AGTAGAATCACAGACATCAGAGG + Intronic
1037637948 8:20717363-20717385 AGTGAAGAAACAGCCATCAGGGG - Intergenic
1038364036 8:26912942-26912964 AGTGGAGAAAAAGGCATCAAGGG + Intergenic
1039268699 8:35856608-35856630 AATGTAATAAAAGCCATCTATGG + Intergenic
1040663941 8:49608193-49608215 AGTGGTACAAAAACCATCAACGG + Intergenic
1041247919 8:55906397-55906419 AGTGAAATCACACCCAGCAATGG + Intronic
1041498501 8:58513755-58513777 AGTCAAGTAGCAGCCATCAATGG - Intergenic
1041877644 8:62708861-62708883 AATGTAATAAAAGCCATCTATGG - Intronic
1044884075 8:96757825-96757847 AGTAGAAAAAGAGCCAACAATGG - Intronic
1046472564 8:114696098-114696120 AGTGAAATATATGCCATCAAAGG + Intergenic
1048146629 8:131851305-131851327 AGTGGAATCAAGGACATCAAGGG - Intergenic
1050222136 9:3404492-3404514 ATTGGAAGGACAGCCATCCATGG - Intronic
1052384268 9:27806279-27806301 AGTTGAATAGCTGCCAGCAAGGG + Intergenic
1052624589 9:30958833-30958855 AATGTAATAAAAGCCATCTATGG - Intergenic
1054853115 9:69869251-69869273 GGTGAAATAATATCCATCAACGG - Intronic
1055310540 9:74974974-74974996 AGTAGAATGATAGCCATCAGAGG + Intergenic
1055554488 9:77460938-77460960 AGTGGGATCACAGACGTCAAGGG + Intronic
1055988013 9:82073079-82073101 AGGGGAACAACAGACACCAATGG + Intergenic
1056526818 9:87450852-87450874 AGGGGAATAACACACACCAAGGG - Intergenic
1058271095 9:102972533-102972555 AGTGAAATATGAGCCATCATAGG + Intergenic
1058499384 9:105594985-105595007 AATGGAATATTAGCCATAAAAGG + Intronic
1059009379 9:110440136-110440158 AGTGAATTAACAGACATTAAAGG - Intronic
1060323379 9:122587717-122587739 AGTGGAATACTAACCAGCAAAGG + Intergenic
1060327383 9:122630426-122630448 AGTGGACTAACAGCAAAGAATGG - Intergenic
1062576330 9:137210272-137210294 AGTGCAGTGGCAGCCATCAACGG + Intronic
1186949672 X:14609747-14609769 AGTAGCATATCAGCCATTAAAGG - Intronic
1189613320 X:42760919-42760941 AGTGGAATCAAAGCCTTCCAGGG + Intergenic
1191140343 X:57109683-57109705 AATGTAATAAAAGCCATCTATGG + Intergenic
1191144020 X:57146704-57146726 AATGTAATAAAAGCCATCTATGG - Intergenic
1191164614 X:57374848-57374870 AGTGTAATAAATGCCATCTATGG - Intronic
1192073726 X:67968509-67968531 AATGTAATAAAAGCCATCTAAGG + Intergenic
1194526104 X:94978753-94978775 GGTGGAACAACTGCCACCAAGGG - Intergenic
1196125513 X:112094623-112094645 AGTGAAATAAAGGCCATCAAAGG + Intergenic
1197276955 X:124490471-124490493 ACTGGAATAGCAGCCATTTAGGG - Intronic
1198639528 X:138741506-138741528 AGTGGAATTACAGGCAGCTAGGG - Intronic
1199033456 X:143027200-143027222 AGTTGAATAGCTGCCAGCAAGGG + Intronic
1199075004 X:143516188-143516210 AGTTGAATAGCTGCCAGCAAGGG - Intronic
1199093995 X:143719465-143719487 AGTTGAATACCTGCCAGCAAGGG - Intronic
1201338606 Y:12906350-12906372 AGTGGAAAAATAACCTTCAAAGG - Intronic