ID: 1175983653

View in Genome Browser
Species Human (GRCh38)
Location 20:62753734-62753756
Sequence GGCACCCCTCCCTGGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 1, 2: 6, 3: 42, 4: 404}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175983653_1175983658 -9 Left 1175983653 20:62753734-62753756 CCACTGCCCCAGGGAGGGGTGCC 0: 1
1: 1
2: 6
3: 42
4: 404
Right 1175983658 20:62753748-62753770 AGGGGTGCCGGTTTCTCCATTGG 0: 1
1: 0
2: 1
3: 11
4: 78
1175983653_1175983662 5 Left 1175983653 20:62753734-62753756 CCACTGCCCCAGGGAGGGGTGCC 0: 1
1: 1
2: 6
3: 42
4: 404
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1175983653_1175983660 -2 Left 1175983653 20:62753734-62753756 CCACTGCCCCAGGGAGGGGTGCC 0: 1
1: 1
2: 6
3: 42
4: 404
Right 1175983660 20:62753755-62753777 CCGGTTTCTCCATTGGAAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1175983653_1175983666 18 Left 1175983653 20:62753734-62753756 CCACTGCCCCAGGGAGGGGTGCC 0: 1
1: 1
2: 6
3: 42
4: 404
Right 1175983666 20:62753775-62753797 CGGGCCATGGCCGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 145
1175983653_1175983661 -1 Left 1175983653 20:62753734-62753756 CCACTGCCCCAGGGAGGGGTGCC 0: 1
1: 1
2: 6
3: 42
4: 404
Right 1175983661 20:62753756-62753778 CGGTTTCTCCATTGGAAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 94
1175983653_1175983664 14 Left 1175983653 20:62753734-62753756 CCACTGCCCCAGGGAGGGGTGCC 0: 1
1: 1
2: 6
3: 42
4: 404
Right 1175983664 20:62753771-62753793 AAGCCGGGCCATGGCCGTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175983653 Original CRISPR GGCACCCCTCCCTGGGGCAG TGG (reversed) Intronic
900182984 1:1320589-1320611 GGGGCCCCTCCCTGGGGCATGGG - Intronic
900265112 1:1753394-1753416 GGCACCCGTCCTGGGGGCAGCGG - Intronic
900290778 1:1922759-1922781 GGCACCGCTCCCAGAAGCAGTGG + Intronic
900333072 1:2146235-2146257 GCCACCCTTCCCTGGGGCTGGGG + Intronic
900395517 1:2451726-2451748 GGGACCCCTCCCTGGGGGCTGGG + Intronic
900940113 1:5793197-5793219 GTCACCCCACTCTTGGGCAGGGG + Intergenic
901317444 1:8318383-8318405 GGCACCCTCCCCTGGGCCCGAGG - Intronic
901629975 1:10643258-10643280 GGCAGCCCTCCCGGATGCAGTGG + Exonic
902606901 1:17573912-17573934 GGCCTGCCTCACTGGGGCAGGGG - Intronic
904618180 1:31761007-31761029 GGCACCGCCCCCAGGGGCCGAGG - Intronic
906117602 1:43366779-43366801 GGGGCCCCTCCCTGAGGGAGGGG - Intronic
906531133 1:46524706-46524728 GGCACAGCAGCCTGGGGCAGTGG + Intergenic
906668576 1:47638738-47638760 GGCTCACCTGCCTGGGGCAGAGG + Intergenic
907308438 1:53526274-53526296 GGTACCTCTCCCTGGGTCTGAGG - Intronic
907414057 1:54301961-54301983 GGCACCAATCCCTGGGAAAGAGG + Intronic
907688849 1:56642565-56642587 TGAACACCTCCCTGGGGCACTGG + Intronic
909957890 1:81801600-81801622 GCCAGCCTTCCTTGGGGCAGCGG + Intronic
912775467 1:112504078-112504100 GGGAACCCTCCCTTGGGGAGAGG + Intronic
913469930 1:119177434-119177456 GGCACTGGTCCCTGGGGAAGAGG - Intergenic
914915333 1:151815958-151815980 GCCACCCCTCCCAGGTGTAGGGG + Intronic
915129095 1:153684904-153684926 AGCACCCTGCCCTGGGTCAGCGG + Intronic
915129663 1:153687836-153687858 GGACCCTCTCCCTGGGGCTGGGG - Intronic
915364972 1:155309881-155309903 GGCGGCCCTCCCTGGTGCACGGG + Exonic
915592505 1:156878751-156878773 GGGTCCCTTCCCTGAGGCAGGGG + Intronic
916430225 1:164720841-164720863 GGAAGCCCTCCCTTGGACAGAGG - Intronic
917618715 1:176772657-176772679 GGCAACACTCCCTGGTTCAGTGG + Intronic
919818839 1:201459964-201459986 GCCTCCTGTCCCTGGGGCAGTGG + Intergenic
921213005 1:212915928-212915950 GGAACCCCTCACTGGGCCACTGG - Intergenic
922322983 1:224503890-224503912 GGCACCCCTCCCTCCTGGAGCGG - Intronic
922748331 1:228059575-228059597 GGGACTCCTCCCTGGGGGTGGGG + Exonic
1065115392 10:22478204-22478226 AGCACCTCTGCCTTGGGCAGCGG - Intergenic
1067293726 10:44962519-44962541 GGCACACAGGCCTGGGGCAGTGG + Intronic
1067473776 10:46553489-46553511 GGCCCCCCTCCCTGGGAGGGTGG - Intronic
1068670780 10:59721115-59721137 TGCACCCATCACTGGAGCAGTGG + Intronic
1068827305 10:61453750-61453772 AGCGCACCTCCCTGGGCCAGTGG + Intergenic
1069590986 10:69641709-69641731 CGCACCCCTCCCTGGTGCCTGGG - Intergenic
1069593581 10:69656419-69656441 TGCCCTCTTCCCTGGGGCAGTGG + Intergenic
1069703076 10:70440524-70440546 GACGGCCCTCCCTGGGGCCGGGG - Intronic
1070768711 10:79070328-79070350 GGCTCCCCGCCCTGGAGCGGTGG + Intronic
1070936770 10:80304453-80304475 GGCAAGCCTGCCTGGGGGAGGGG + Intergenic
1071997872 10:91164140-91164162 GGCCACTCTCCCTGGGTCAGAGG - Intronic
1073321250 10:102617513-102617535 GGCACCCCTTCCTGGGGGGCTGG + Intronic
1073448843 10:103597490-103597512 GGCCCCAGTCCCTGGAGCAGAGG - Exonic
1074027277 10:109649647-109649669 TGCACCCCAGCCTGGGCCAGAGG + Intergenic
1075182275 10:120222303-120222325 GGCACTCTTGCCTGAGGCAGGGG - Intergenic
1075572628 10:123556971-123556993 GGCACCCCTTCCCGGGCCTGGGG - Intergenic
1075866056 10:125719965-125719987 GGCATCCCTCCCCGGTGGAGCGG - Intronic
1075912127 10:126133641-126133663 GGCACCCATCACTGGGGGGGAGG + Intronic
1076067540 10:127460694-127460716 GGCAGTCCTCCCTTGGGGAGGGG - Intergenic
1076215168 10:128687371-128687393 GGGACCCCTCCCCGGGGCAGGGG - Intergenic
1076529441 10:131134830-131134852 GCCACCCTTCCCTGGGGCAGTGG - Intronic
1076541801 10:131219624-131219646 GGCAACCTTCCCTGGGGAGGCGG - Intronic
1076730965 10:132438704-132438726 GCCAGGCATCCCTGGGGCAGTGG + Intergenic
1076809690 10:132880026-132880048 GGCCACCCTCCCTGTGGCCGCGG - Intronic
1077117902 11:893587-893609 CCCACCCCTCCCTGAGGCAGCGG - Intronic
1077221033 11:1416444-1416466 GTCACCTCTCCCTGAGGCTGTGG + Intronic
1077304831 11:1864368-1864390 GGCCCCTGTGCCTGGGGCAGGGG + Intronic
1077340746 11:2025298-2025320 GGCAGGGCTCCCTGGGGCACAGG + Intergenic
1077350825 11:2092494-2092516 GGTAGGCCTGCCTGGGGCAGTGG + Intergenic
1077467831 11:2741954-2741976 GGCAGCCCGCCCTGGGGCAGGGG - Intronic
1077830323 11:5861261-5861283 GGTACCCATCCCAGGGGAAGTGG - Intronic
1078867046 11:15307646-15307668 GACACCCCTCACTGCAGCAGTGG + Intergenic
1079083316 11:17428696-17428718 CTCACCCCTGCCAGGGGCAGAGG + Intronic
1081907306 11:46678129-46678151 GTCACCTCTGGCTGGGGCAGGGG + Exonic
1082076583 11:47980380-47980402 GGATCCCCTCCCGCGGGCAGAGG - Intergenic
1083714319 11:64567108-64567130 GGCAGCACTCCCAGGGGCTGGGG + Intronic
1083924974 11:65800583-65800605 GGCACCCATCAGTGGTGCAGGGG + Intergenic
1084065340 11:66700795-66700817 GGCCACCCTGCCTGAGGCAGAGG - Exonic
1084219364 11:67667876-67667898 GGATCCCCTCCCTGGAGTAGGGG - Intronic
1084273058 11:68039175-68039197 GGATCTCCTCCCCGGGGCAGGGG - Intronic
1084571456 11:69962445-69962467 GTCCCCCGCCCCTGGGGCAGTGG + Intergenic
1084632520 11:70363265-70363287 GGCACTCATCCCTAGGGAAGGGG - Intronic
1085254550 11:75164972-75164994 GACACTCCTCGCTGGGGGAGTGG - Intronic
1085333039 11:75668667-75668689 CGCGCCCCTCCCTGCGGCTGCGG + Exonic
1085450532 11:76629557-76629579 GGCCCCTCTGCCTGGGGCTGGGG - Intergenic
1086567911 11:88247908-88247930 ATCACCACTCCCTGTGGCAGGGG + Intergenic
1088450325 11:109974785-109974807 GGCTCTCCTCCCTTGGCCAGTGG + Intergenic
1088597405 11:111450572-111450594 GGGAGCCCTCCCTAGGGGAGTGG - Intronic
1089215145 11:116830501-116830523 TGGACCCCTCCCTGGGGAGGTGG - Intronic
1089300350 11:117495111-117495133 GGCCCAGCTCCATGGGGCAGAGG - Intronic
1089496357 11:118910356-118910378 GGTACCCCACCCTGGGTGAGGGG - Exonic
1091157234 11:133385015-133385037 GGAACCCCTCCTTGTGGCTGTGG + Intronic
1202823731 11_KI270721v1_random:80487-80509 GGCAGGGCTCCCTGGGGCACAGG + Intergenic
1091568638 12:1665170-1665192 TGCAGACCTGCCTGGGGCAGAGG + Intergenic
1092284198 12:7119403-7119425 GGCACCCTTCTCTGGGGATGGGG + Intergenic
1095898764 12:47306300-47306322 TCCACACCTCCCTGGAGCAGAGG - Intergenic
1096188310 12:49598588-49598610 TTCACCTCTCCCTGGTGCAGAGG + Intronic
1096476906 12:51914014-51914036 GGCTCCCCTTCCTGGTGCAGAGG + Exonic
1096789946 12:54038404-54038426 CTCACCCCTCCCTGGAACAGTGG - Intronic
1097029882 12:56082591-56082613 GCCACCCTTCCCTGAGGCGGTGG - Intronic
1098692277 12:73503737-73503759 GGCACCCCTCCCCAGGGTAATGG + Intergenic
1102951862 12:117036573-117036595 GTCACCTCTCCAGGGGGCAGGGG + Intergenic
1103323384 12:120104403-120104425 GTCTCCCCTGCCTGGAGCAGTGG - Intronic
1103409151 12:120698509-120698531 GGACCACCTGCCTGGGGCAGTGG + Exonic
1104003226 12:124873699-124873721 TGCTCCCCACCCTGGGGCTGAGG - Intronic
1104568203 12:129903670-129903692 GGCGCCCCTCCTTGGGCCACCGG - Intergenic
1104929079 12:132328915-132328937 GGCAGCCCTGCCCGGGACAGTGG - Intronic
1104944398 12:132409248-132409270 GGAAGCCCTCCCTGCGTCAGGGG - Intergenic
1104957139 12:132472498-132472520 CTCACCCCTTCCTCGGGCAGGGG - Intergenic
1105211811 13:18261471-18261493 AGAACACCTCACTGGGGCAGAGG + Intergenic
1105701824 13:22940166-22940188 CGCACCCATCCCTGGGGCAGAGG - Intergenic
1105854448 13:24361951-24361973 CTCACCCATCCCTGGGGCAGAGG - Intergenic
1105866229 13:24461893-24461915 GCCACCTCCCCATGGGGCAGGGG + Intronic
1106483771 13:30155529-30155551 GTGCCCCCTCCATGGGGCAGAGG - Intergenic
1109390509 13:61685488-61685510 GGCACCAGTGCCTGGGGCACAGG - Intergenic
1110307520 13:74007034-74007056 GGAACCCCTCCCAGAGGAAGAGG - Intronic
1113699572 13:112374603-112374625 GACATCCCTCCTTGGTGCAGTGG + Intergenic
1115490404 14:33952752-33952774 GGTACCCCTCCTTGGGGTAAAGG + Intronic
1116569681 14:46499648-46499670 GGCACCCATCCTTAGAGCAGAGG - Intergenic
1116798597 14:49418327-49418349 GGCAACCTTCCCAGGGGAAGGGG + Intergenic
1117200513 14:53385302-53385324 AGGACCACTCCATGGGGCAGTGG - Intergenic
1119650236 14:76377867-76377889 CCCACTCCACCCTGGGGCAGAGG + Intronic
1121367999 14:93332561-93332583 CGCCGCCGTCCCTGGGGCAGGGG - Intronic
1121605408 14:95236607-95236629 GGCAACACTGCCAGGGGCAGAGG + Intronic
1121727861 14:96166141-96166163 GGATCGCCTGCCTGGGGCAGAGG + Intergenic
1122119125 14:99542560-99542582 GCCACCACTCCCTGGGTCTGTGG - Intronic
1122208498 14:100160034-100160056 GCCGCTCCTCCTTGGGGCAGGGG - Exonic
1122771449 14:104099694-104099716 AGCACCCCTCCCTGAGGCAGCGG + Intronic
1122806552 14:104262893-104262915 GGCCCCCCACCCTGGGGCAGAGG + Intergenic
1122981807 14:105195406-105195428 GGCAGCCTTCCCTGGTGGAGAGG - Intergenic
1123538537 15:21262467-21262489 GGCTACCCTGCCTGTGGCAGTGG - Intergenic
1124687857 15:31797753-31797775 GGGACCACTCGTTGGGGCAGTGG - Intronic
1128573459 15:68752654-68752676 TGCACTCCAGCCTGGGGCAGAGG + Intergenic
1129295617 15:74598519-74598541 GGTGCCCCTCGCAGGGGCAGAGG - Intronic
1129360132 15:75019363-75019385 GGGACCCCTCACGGGGCCAGGGG + Exonic
1129738060 15:77976677-77976699 GGCACCCCTCCACATGGCAGGGG - Intergenic
1129848016 15:78776932-78776954 GGCACCCCTCCACATGGCAGGGG + Intronic
1130253900 15:82317004-82317026 GGCACCCCTCCACATGGCAGGGG - Intergenic
1132013702 15:98298019-98298041 GGCACCCAGCCCTGGGTGAGTGG + Intergenic
1132683162 16:1152165-1152187 GCCAGCCCTCCCTGGGACAAGGG + Intergenic
1132700721 16:1220957-1220979 TGCACCACCCCCTGGGGCAGGGG - Exonic
1132721915 16:1320765-1320787 GCCACAACTCACTGGGGCAGTGG - Intronic
1132878088 16:2149067-2149089 GGCTCCGCGCCCTGGGGCCGCGG - Intronic
1132880288 16:2159128-2159150 GGACCCCCTCCCTGGAGCAGAGG + Intronic
1132896892 16:2233458-2233480 GGCTGCCCTCGCTGGAGCAGGGG - Exonic
1132999636 16:2842387-2842409 GGCCCCCATCCCAGGGCCAGGGG + Intergenic
1133125448 16:3643064-3643086 GGCTCTTCTCCCTGGGGCACTGG + Intronic
1133267734 16:4594827-4594849 GGCACCCTTGCCTGGGGCCCTGG + Intronic
1133339069 16:5025196-5025218 GGCAGCCCTCCCGGGGGCACGGG + Exonic
1135047858 16:19168966-19168988 GGCACCCCACCCCAGGGGAGGGG + Intronic
1135991804 16:27223081-27223103 GGACCGCATCCCTGGGGCAGAGG - Intergenic
1136392822 16:29976118-29976140 GGCACCCCTCCGTGTGGCCTAGG + Intronic
1136548226 16:30967109-30967131 GGCCCCCTTCCTTGGGGTAGGGG + Intronic
1137224079 16:46485085-46485107 GGCACCCAACCCTGGAGCATCGG + Intergenic
1137475930 16:48810576-48810598 GTCAGCCCTCCCTGGGCCGGAGG - Intergenic
1137556352 16:49472849-49472871 GGCACGGCTCCCTGGGTGAGGGG - Intergenic
1137787994 16:51152645-51152667 GGCACCCCGCCCTGGGGAGGGGG + Intergenic
1138349129 16:56337242-56337264 GACAGCCATCCCTGGGGCACTGG + Intronic
1138588415 16:57986031-57986053 GCCAGGCCTCGCTGGGGCAGGGG - Intronic
1139365321 16:66429020-66429042 GGTGCCCCTCTCTGGGGCAGCGG - Intronic
1139437612 16:66945394-66945416 GGCACTCCTGCCTGGGCCACAGG + Intergenic
1139657763 16:68399350-68399372 GGCACCAGACCATGGGGCAGTGG - Intronic
1139974158 16:70795692-70795714 AGCAGCCCTCCCTGGGGCTTTGG + Intronic
1140121295 16:72085202-72085224 GGCACCCCTCCCTGCAGGAAAGG + Exonic
1140135044 16:72198503-72198525 GGCAGCTCTCCCCAGGGCAGGGG - Intergenic
1140359507 16:74332514-74332536 GGCACCCCACAGTGGGGGAGGGG + Intergenic
1140734040 16:77882020-77882042 GGAACCCCTGCTTTGGGCAGAGG - Intronic
1141786133 16:86201999-86202021 GGCTCCCCTCCCAGGCCCAGCGG + Intergenic
1142151096 16:88512862-88512884 GGCACCCCTGCGTGTGACAGTGG - Intronic
1142181209 16:88671554-88671576 GGAACCCCTGCCTGGGTCAAAGG - Intergenic
1142518705 17:490201-490223 GGCCCCCCATCCCGGGGCAGAGG - Intergenic
1142763893 17:2055585-2055607 GGCTCCCCTCCCCGCGGCGGTGG - Intronic
1142979738 17:3664636-3664658 GGGACCGCTCCATGGGGCACAGG - Intronic
1144030207 17:11313619-11313641 GGAAGCCCTCCCTGGGGAGGCGG + Intronic
1144201825 17:12948902-12948924 GCCACCCCTGCCTGAGGCTGTGG + Intronic
1144792588 17:17869039-17869061 GCTACCCCTCCCTGGGGCTGGGG + Intronic
1145193542 17:20867805-20867827 GGCTACCCTGCCTGTGGCAGTGG - Intronic
1145298479 17:21613275-21613297 GGCTACCCTGCCTGTGGCAGTGG + Intergenic
1145351769 17:22090077-22090099 GGCTACCCTGCCTGTGGCAGTGG - Intergenic
1145903377 17:28502095-28502117 TACACCCATTCCTGGGGCAGAGG + Intronic
1145993407 17:29092471-29092493 GACATCTCTCCCTGGGGCGGGGG - Intronic
1146436998 17:32859469-32859491 GGCATCCATCCCAGGGGAAGGGG - Intronic
1146647225 17:34583360-34583382 GGCACCCTTCTCTGAGGCAGGGG - Intronic
1146647608 17:34585416-34585438 GGCCCACCTACCTGGAGCAGGGG + Intronic
1146722054 17:35130560-35130582 GGCACCCCACCCCTGGGCTGGGG + Exonic
1146901344 17:36591697-36591719 GGCAGCGCTCACTGGGGAAGCGG + Intergenic
1147017696 17:37505743-37505765 GGCATCCATACCTGGAGCAGTGG - Intronic
1147168626 17:38605789-38605811 GGCACCGCGCCCCGGGGCTGGGG - Exonic
1147323398 17:39659129-39659151 GGCACCCATTCCAAGGGCAGGGG - Intronic
1147466105 17:40612329-40612351 GACACCCCTCCCTTGTGCTGTGG + Intergenic
1147741734 17:42674112-42674134 GGCACCCCTCCCCCAGGCTGTGG + Intronic
1147867210 17:43560855-43560877 GGCTCCCTTCCCTGTAGCAGCGG - Intronic
1148808020 17:50273865-50273887 GGCACCCCTCCCTGGAGTCTGGG + Intronic
1149647206 17:58249374-58249396 GGCACCTTTCCCCGGGGCGGGGG + Intronic
1149923279 17:60678286-60678308 GGCTCTGCTCCTTGGGGCAGAGG + Intronic
1151568950 17:74916475-74916497 GGCCCCCATGGCTGGGGCAGGGG - Exonic
1151611942 17:75182339-75182361 GGGACCCCTGCCTGGGGCCGCGG - Intergenic
1151807770 17:76417188-76417210 GGCACCTCTCCCTGACTCAGGGG + Intronic
1151902285 17:77024335-77024357 GGCTCCACTCCTTGGGGCAAAGG - Intergenic
1152092625 17:78255522-78255544 GGCAGTCCACCCAGGGGCAGGGG - Intergenic
1152110013 17:78352846-78352868 GGCGCACCTCCCTGGGGTGGGGG - Intergenic
1152112296 17:78363784-78363806 GGCACCAGTCGCTGAGGCAGTGG - Intergenic
1152392276 17:80009990-80010012 GGAGCCCCTCCCTGAGGCAAGGG - Intronic
1152403201 17:80082064-80082086 ACAGCCCCTCCCTGGGGCAGGGG - Intronic
1152423926 17:80208818-80208840 GCCACCCTTGCCCGGGGCAGAGG + Exonic
1152459026 17:80431731-80431753 GGCTCCCCTCACCGTGGCAGAGG + Intronic
1152700970 17:81819624-81819646 GGCACCTCTCCCCTGGGCTGCGG - Intergenic
1152750425 17:82060077-82060099 TGCTCCCCTCCCTGGGCCTGAGG + Exonic
1152780557 17:82225863-82225885 TGCCACCCTCCCTGGGGCAGCGG + Intergenic
1153226863 18:2906559-2906581 GGGACCCCTGCCCGGGGCCGGGG - Intronic
1153807011 18:8717650-8717672 GGCCTCCATCCCTGGGGGAGGGG - Intronic
1158145707 18:54309794-54309816 GGCATGCCTCGCTGGGGGAGGGG - Intronic
1160221440 18:76980699-76980721 GGCACCACTCCCTGGGGCCTGGG - Intronic
1160451106 18:78966439-78966461 GGCACCCCTTGGTGGGGGAGGGG - Intergenic
1160461483 18:79042067-79042089 GGCCACGCTCCCTGGGACAGTGG + Intergenic
1160577972 18:79867778-79867800 GGCACCCCTCCCCTCGGCACCGG + Intronic
1160805583 19:991018-991040 TGCACCCTGCCCTGGGGCTGAGG + Intronic
1160856778 19:1221362-1221384 GCCCCGCCTCCCTGGGGCTGCGG - Intronic
1160859397 19:1231241-1231263 GGCACCACTTCCAGCGGCAGCGG - Exonic
1160969750 19:1762313-1762335 GGCTCTCCTCCCTGGAGCTGGGG + Intronic
1161003310 19:1922018-1922040 GACTCCCCTCCCTGGTGCACAGG - Intronic
1161365642 19:3877858-3877880 GGCTCCCCTGCGTGGGGCTGCGG - Intergenic
1161404674 19:4084681-4084703 GGCAGCCCTCCCTGGGGCCAGGG - Intergenic
1161800080 19:6412549-6412571 GGCACACCTGCATGGGTCAGGGG + Intergenic
1161821143 19:6531834-6531856 GGCTTCCCTCCATGTGGCAGTGG + Intronic
1162038784 19:7956892-7956914 GGAAGCCATCCCTGGAGCAGAGG + Intergenic
1162042687 19:7980065-7980087 AGCACCTTTCTCTGGGGCAGGGG + Intronic
1162278738 19:9678767-9678789 TGCACCCCAGCCTGGGACAGAGG + Intergenic
1162524982 19:11201757-11201779 GCCACCCCTCTCTGGGTCTGAGG + Intronic
1162808906 19:13152789-13152811 GGCCCCCCTCCCTTGGGCCAAGG + Exonic
1163019750 19:14475702-14475724 TGCCCCCCTCCCTGGGGCTTTGG + Intergenic
1163106060 19:15123648-15123670 TGCCCCCTTACCTGGGGCAGGGG - Intronic
1163364378 19:16867968-16867990 TGGATCCCTCCCTGGGGCTGGGG + Intronic
1163426636 19:17244224-17244246 TGCACCCACCCCTGGGGGAGAGG + Intronic
1163462501 19:17447657-17447679 GGGACCCCTATCAGGGGCAGTGG - Intronic
1163530068 19:17843684-17843706 ACCATACCTCCCTGGGGCAGGGG + Intronic
1163783890 19:19264598-19264620 GTCAGCCCTACCTGGGGAAGCGG - Exonic
1164733538 19:30523778-30523800 ACCACCTCTCCCTGGGGCTGTGG - Intronic
1165472552 19:36011580-36011602 GGGACCATTCCCTGGGGCGGTGG + Intronic
1165867596 19:38948525-38948547 GGCCCCGATCCCTGGGGCAAAGG - Intronic
1165906131 19:39196092-39196114 TGCACCCCTGCCTGGGACTGGGG - Intergenic
1166054180 19:40278875-40278897 GGCACCCCTCTCGGTGGCTGTGG - Intronic
1166094550 19:40530730-40530752 GGACCCCCACCCTGGGGGAGGGG + Intronic
1166691728 19:44825711-44825733 AGCACACTTCCCTGGGCCAGTGG + Intergenic
1166798651 19:45443119-45443141 GAGACCCCTCCCTAGTGCAGAGG - Intronic
1166887950 19:45973137-45973159 GACACCCCTCCCCGAGGCGGGGG - Intronic
1166997821 19:46728167-46728189 TGGGCCCCTCCGTGGGGCAGTGG + Intronic
1167121538 19:47520263-47520285 GGGACCCCTGGCAGGGGCAGGGG - Intergenic
1167492448 19:49800412-49800434 GGGCCCCTTTCCTGGGGCAGAGG - Intronic
1167582135 19:50351384-50351406 GGCACCTCTGCCTGTGGCAAAGG - Intronic
1167716386 19:51144968-51144990 GAGCCCCCTCCCTGGGGCTGGGG + Intronic
1167722087 19:51185978-51186000 GAGCCCCCTCCCTGGGGCTGGGG + Intergenic
1167774268 19:51544592-51544614 GAGCCCCCTCCCTGGGGCTGAGG - Intergenic
1168069317 19:53941128-53941150 GCCAAACCTGCCTGGGGCAGGGG - Intronic
924973267 2:150868-150890 GACACCCCACTGTGGGGCAGTGG + Intergenic
925154273 2:1638026-1638048 GGTACCTCTCCCTGTGGCTGGGG + Intronic
926152870 2:10434561-10434583 GGCACCTGTCCCTGAGCCAGAGG - Intergenic
926716840 2:15931153-15931175 TCCACCCCTCCCTGGGGGAGTGG - Intergenic
928233964 2:29524003-29524025 TGCAACCCTCCCTGGGGCTCAGG - Intronic
928409957 2:31047324-31047346 GGCATCATTCCCTGGGGAAGTGG + Intronic
930781048 2:55225008-55225030 GGCACAGCTCCCTGGGCCTGTGG - Intronic
932298012 2:70642873-70642895 TCTACCCCTCCCTGGGGCCGAGG + Intronic
932625399 2:73292563-73292585 GGCACCCTTCCCCGGTCCAGAGG - Exonic
933872576 2:86582967-86582989 TGCACTCCACCCTGGGACAGAGG + Intronic
933951197 2:87331852-87331874 TGCACCCCAGCCTGGGACAGAGG + Intergenic
934301816 2:91780983-91781005 AGAACACCTCACTGGGGCAGAGG - Intergenic
934677698 2:96261234-96261256 GGCACCGCTTGCAGGGGCAGTGG + Intronic
934856778 2:97734738-97734760 AGCACCGCCGCCTGGGGCAGAGG + Intronic
935171059 2:100611871-100611893 GGCTCCCCACCTTGGGGCAGAGG - Intergenic
935256409 2:101313625-101313647 TGCACACCTTCCTGGGTCAGAGG + Intergenic
935588220 2:104821088-104821110 GGTCCCCCTCCATGGGGAAGGGG + Intergenic
936328581 2:111526726-111526748 TGCACCCCAGCCTGGGACAGAGG - Intergenic
937305312 2:120867231-120867253 GGCATGCCTTCCAGGGGCAGCGG - Intronic
937885306 2:126895498-126895520 GCCACTTCTCCCTGGAGCAGTGG + Intergenic
937933104 2:127220420-127220442 GGCTCCCTCCCCTGGGGCTGGGG + Intergenic
938068074 2:128292561-128292583 GGCCGCCCTCCCTGAGGCAGGGG - Intronic
938680380 2:133683792-133683814 GAATTCCCTCCCTGGGGCAGAGG - Intergenic
944441993 2:199752192-199752214 GCCAACCCTCCCTGGAGCTGAGG + Intergenic
946185675 2:217979097-217979119 TGGACCCCTGCCAGGGGCAGAGG + Intronic
946248301 2:218399306-218399328 GGCACCTCGCCCTGGGGCTGCGG + Intronic
946329154 2:219000113-219000135 GAGACCCCGCCCTGTGGCAGCGG + Intergenic
946339071 2:219056963-219056985 GTCAGCCCTCCCTGGGGCGCAGG - Intronic
946690293 2:222304243-222304265 GGCAGCCCTCCCGGGGTCTGTGG - Exonic
947736361 2:232457469-232457491 GGCTCCCCTCCCCAGGGCTGTGG - Intronic
948144397 2:235697515-235697537 GTCACCCCTCCCAGGCACAGGGG - Intronic
948630706 2:239300929-239300951 GGGACCCCTCCCTAGGGCAAGGG + Intronic
948829224 2:240589648-240589670 GGCACCCCCCCCTGCAGCAGAGG - Intronic
1168777829 20:462506-462528 GGCTCCCCTCCGTCGGCCAGCGG + Exonic
1169140958 20:3227344-3227366 GGAAGCCCTCCCTGGGGAAGTGG - Intergenic
1169214737 20:3786521-3786543 GGCCCCCCGCCCCGGGGCGGCGG - Exonic
1171562104 20:26135298-26135320 GGCTACCCTGCCTGTGGCAGTGG - Intergenic
1172626630 20:36351121-36351143 GGCCCCCCTGCCTGGCACAGAGG + Intronic
1172633962 20:36396924-36396946 GAAACTCCTCCCTGGGGCACAGG - Intronic
1172930910 20:38585956-38585978 GGGACTCCTTCCTGGGTCAGGGG + Intronic
1175387171 20:58604757-58604779 GGAAGGCCTGCCTGGGGCAGGGG + Intergenic
1175810988 20:61857132-61857154 CATACCCCTCCCCGGGGCAGAGG + Intronic
1175899371 20:62353996-62354018 GGCAGCCCTGCCCAGGGCAGAGG + Intronic
1175983653 20:62753734-62753756 GGCACCCCTCCCTGGGGCAGTGG - Intronic
1176147891 20:63573575-63573597 AGGACCCCTGGCTGGGGCAGAGG - Intronic
1176253873 20:64140471-64140493 GGCCCCCAGCCCTGGGTCAGAGG - Intergenic
1176260592 20:64177612-64177634 GGCACCCCTCTCCGGGGGCGGGG + Intronic
1177789530 21:25707882-25707904 GTCACCCATGCCTGGTGCAGTGG + Intronic
1179518125 21:41923819-41923841 CGCTCCCCTCCCGGGGGCAGAGG + Intronic
1180150640 21:45945490-45945512 AGACCCCCTCCCTGGGGCTGTGG + Intergenic
1180814615 22:18781736-18781758 AGAACACCTCACTGGGGCAGAGG + Intergenic
1180955249 22:19738539-19738561 GGCAGCCCTCCCTGGGGGTCTGG + Intergenic
1181343561 22:22201110-22201132 GGCCTCCCTCTGTGGGGCAGGGG - Intergenic
1181466227 22:23112132-23112154 GGCAGCCCTCCTTTGGGCTGCGG - Intronic
1181700937 22:24620901-24620923 AGAACACCTCACTGGGGCAGAGG - Exonic
1183366467 22:37409600-37409622 GGCACGCTGCCCTGGGGCACGGG - Intronic
1183385230 22:37510334-37510356 GGGCCCGCCCCCTGGGGCAGAGG - Exonic
1183605460 22:38864938-38864960 GGCACCCGTGCCAGTGGCAGAGG - Exonic
1183719982 22:39557191-39557213 GTGACCCCTCACCGGGGCAGTGG + Intergenic
1184060649 22:42079192-42079214 GGCTCCCCTCACTGGGGCCTTGG + Exonic
1184554261 22:45224853-45224875 GGCCCTCTTCCCTGGGTCAGGGG + Intronic
1184981796 22:48100558-48100580 GGGACCCCTCCCTCATGCAGGGG - Intergenic
1185225183 22:49648058-49648080 GGCCGCCCTCCCAGGGGCTGTGG - Intronic
1203226113 22_KI270731v1_random:79363-79385 AGAACACCTCACTGGGGCAGAGG - Intergenic
1203264715 22_KI270734v1_random:7423-7445 AGAACACCTCACTGGGGCAGAGG + Intergenic
950118249 3:10464953-10464975 AGCATCCATCCCTGGGGTAGAGG - Intronic
950125401 3:10507033-10507055 GGCACCCTTCCATGGGGCTGGGG - Intronic
950482835 3:13255196-13255218 GGCTCCCCTCCCTTGGGCTGGGG - Intergenic
950649707 3:14399667-14399689 GCCACCTCTCCCTGGGGCTGAGG + Intergenic
951242793 3:20306249-20306271 GGGACCCCTCTCTGTGGCAGAGG + Intergenic
951881939 3:27488083-27488105 TGCACCCCAGCCTGGGGCACAGG + Intergenic
952778199 3:37067121-37067143 AGCACCCATCCCAAGGGCAGAGG + Intronic
953406415 3:42662149-42662171 GGCAGCCTTGCCTGGGGCAGTGG - Intronic
953611493 3:44450915-44450937 GGCACCCCTCTCTCGGGAAAAGG + Exonic
953928814 3:46996036-46996058 GGCACACCTCACTGAGGGAGGGG - Exonic
954300421 3:49698153-49698175 GGGACCCCTCCCTGGGCCCAGGG + Intronic
954453874 3:50586484-50586506 GGCCCCCTTCCCAGGGGCTGGGG + Intergenic
955055945 3:55456288-55456310 GGGACGCTTCCCAGGGGCAGTGG - Intergenic
955111276 3:55952705-55952727 GTCACCCATACTTGGGGCAGGGG - Intronic
956336188 3:68166686-68166708 AGCACCCCTCCCTGGAGGACGGG + Intronic
956885809 3:73558598-73558620 GGTCCCGCTCCCTGGGTCAGGGG + Intronic
958479734 3:94631024-94631046 GGCAAGCCTGCCTGGGGGAGGGG + Intergenic
961563787 3:127749012-127749034 GGGAGCACTCCCTGGGGAAGGGG - Intronic
961713726 3:128845426-128845448 GGGGCCGCTCCCTGGGGCTGAGG + Intergenic
962065150 3:131971822-131971844 GGCATGCCTGCCTGGGGCTGTGG - Intronic
962676775 3:137763703-137763725 GGCGCCGCATCCTGGGGCAGGGG + Intergenic
963593970 3:147301705-147301727 TGCACCCCTGCCTGGGGGACGGG + Intergenic
963804912 3:149713822-149713844 GGCACGCATCCCTGAGGCAGCGG + Intronic
965655066 3:170975263-170975285 AGCACCCCTTCCTAGGGGAGTGG + Intergenic
966111592 3:176408868-176408890 GGCAACCATCCCTGGAACAGGGG - Intergenic
966907596 3:184539036-184539058 GGCAGCCTACTCTGGGGCAGGGG + Intronic
968232388 3:197011519-197011541 GGGACACCTTCCTGGGGCACAGG - Intronic
968353194 3:198080236-198080258 GGCCCCCGTCCCAGGGGCTGCGG + Intergenic
968612342 4:1563030-1563052 AGCACCCCTAGCTGGGGCAGAGG - Intergenic
968810121 4:2795990-2796012 GGCCCCCTTCCCTGGGGCACTGG + Intronic
969410080 4:7022264-7022286 GGGAGCCCTGACTGGGGCAGAGG + Intronic
969462420 4:7335818-7335840 GGCATCCCTCCTTGCAGCAGAGG - Intronic
969478383 4:7434046-7434068 GGGTCCCCTCCCTGGAGCTGGGG - Exonic
969496520 4:7529499-7529521 TGCTCCCCGCCCTGGGCCAGAGG - Intronic
969638347 4:8382271-8382293 GGCACCACTGCCAGGGGAAGGGG - Intronic
969853873 4:9983477-9983499 GGCTTCCCACCCTGGGCCAGGGG - Intronic
970345188 4:15146418-15146440 GGCACCCCTCCCTGCCCCCGTGG + Intergenic
974764720 4:66328744-66328766 GGCTCCCCTCCTTGGAACAGAGG + Intergenic
978514900 4:109559747-109559769 GGCACCGCAGCCCGGGGCAGAGG + Intergenic
981062276 4:140437524-140437546 AGCATTCCTCCCTGGGGCACTGG - Intergenic
981573684 4:146179991-146180013 GGCACAGCTCCCTGCCGCAGAGG + Intronic
984831943 4:183984006-183984028 GGCAGGCCTGCCTGGGGCTGAGG - Intronic
984982766 4:185299091-185299113 GTCAGCCCTACCTGGAGCAGAGG + Intronic
985547321 5:516170-516192 GGAAGCCATCCCTGGGGCAGAGG - Intronic
985579958 5:691355-691377 GGGTCACCTCCCAGGGGCAGGGG + Intronic
985594164 5:780822-780844 GCCACCCCGCCGAGGGGCAGAGG + Intergenic
985594805 5:783414-783436 GGGTCACCTCCCAGGGGCAGGGG + Intergenic
985635449 5:1033527-1033549 GGAACACGTCCCTGGGGCCGGGG + Intronic
985666239 5:1182817-1182839 GGCCCACCTCTCAGGGGCAGCGG + Intergenic
985710338 5:1424287-1424309 GCCTGCCCTTCCTGGGGCAGTGG + Intronic
986125622 5:4880448-4880470 GGAGCACCTCCTTGGGGCAGAGG + Intergenic
986548388 5:8924674-8924696 GACACCCCTGCCTGGGGAAAGGG + Intergenic
989812596 5:45695954-45695976 GGCACCCCGCCGGGGGGCGGCGG - Exonic
990315436 5:54578638-54578660 ACCATCTCTCCCTGGGGCAGGGG - Intergenic
990740672 5:58909291-58909313 GGCTCACCTCTCTGAGGCAGTGG - Intergenic
991387517 5:66106350-66106372 GGCAACCCTGGCTGGGGGAGGGG + Intergenic
994237185 5:97376416-97376438 GGTTCCCATCACTGGGGCAGTGG + Intergenic
995039023 5:107567565-107567587 GACATCCCAACCTGGGGCAGGGG - Intronic
1001314228 5:170631385-170631407 GAAGCCCCTTCCTGGGGCAGTGG - Intronic
1002350793 5:178582419-178582441 TGAGTCCCTCCCTGGGGCAGTGG - Intronic
1002851642 6:1002087-1002109 GGAAACCATGCCTGGGGCAGAGG - Intergenic
1003377676 6:5594603-5594625 AGCTCCCCACCCTGGGGCTGAGG + Intronic
1004510168 6:16278493-16278515 GCCACTCCTCCCTGTGGCACTGG - Intronic
1004568456 6:16821748-16821770 AGCACACATCCCTGGGACAGTGG + Intergenic
1005450118 6:25963833-25963855 GGCACCCCTCTCTGCAGAAGAGG + Intronic
1005681953 6:28216921-28216943 GCCTCTTCTCCCTGGGGCAGAGG - Intergenic
1006639656 6:35483404-35483426 GGCCCCACTGCCTGGGGGAGAGG - Intronic
1007827029 6:44608184-44608206 GGCCCACATCCCTGGGGCACAGG + Intergenic
1012400977 6:98842888-98842910 GGCACGCGTGGCTGGGGCAGAGG + Intergenic
1013349188 6:109290539-109290561 GGCGGCCGTCGCTGGGGCAGGGG - Intergenic
1015102851 6:129501630-129501652 GTCAGCACTCACTGGGGCAGCGG + Intronic
1017527404 6:155253706-155253728 GGAGCCCCTCTCTGGGGAAGAGG - Intronic
1018910441 6:168098408-168098430 GGAATGCCTGCCTGGGGCAGGGG + Intergenic
1019391712 7:791359-791381 AACACCCTTCCCTGGGACAGGGG - Intergenic
1019431115 7:1000304-1000326 GGCACGTCTCCCGGGGGCTGAGG - Intronic
1019431127 7:1000345-1000367 GGCACGTCTCCCGGGGGCTGAGG - Intronic
1019696928 7:2451378-2451400 GTCAGCCATTCCTGGGGCAGTGG - Intergenic
1020008975 7:4798361-4798383 TGCACCTCTCACTGGGACAGAGG - Intronic
1020669996 7:11094654-11094676 GGTAACCGTCCCTGGGGCTGTGG + Intronic
1022097013 7:27147469-27147491 GGCGCCTCGCCCTCGGGCAGTGG - Exonic
1022762073 7:33365721-33365743 GGCACCAGTGCCTGGGGCACAGG + Intronic
1023270402 7:38456086-38456108 TGCATCCCTCCCTGGGGCCAAGG + Intronic
1023793579 7:43772484-43772506 CACACCCAGCCCTGGGGCAGGGG - Intronic
1025275755 7:57580393-57580415 GGCTACCCTGCCTGTGGCAGTGG + Intergenic
1026158570 7:67849204-67849226 GGCACCCATCTGTGGGGCAAAGG - Intergenic
1026805801 7:73429183-73429205 GGCACCCCTCCCTGGGCCGAGGG - Intergenic
1027170269 7:75866838-75866860 CGCACTGCTCCCTGGGGCACGGG + Intronic
1028111490 7:86947835-86947857 GGCACCTATTCCTTGGGCAGTGG - Exonic
1029549940 7:101232357-101232379 GTCCCCTCTCCTTGGGGCAGTGG + Exonic
1029620431 7:101687008-101687030 TGCCCACCTCCCTGGGGCAGGGG - Intergenic
1029736704 7:102469316-102469338 GGCGCCACACCCGGGGGCAGGGG - Intronic
1030521862 7:110607294-110607316 GCCACCCTTCCCTGAGGCAGAGG - Intergenic
1032075508 7:128833970-128833992 GGCACCCCTCCCGGGGCAGGTGG + Intronic
1032488188 7:132304270-132304292 GGCACCCCTCCCTACTACAGAGG - Intronic
1032775739 7:135110566-135110588 CTCACCCCTTCCTTGGGCAGGGG + Intronic
1034555004 7:151844939-151844961 GGCAAACCTCCCTGGGACACGGG + Intronic
1034558886 7:151867119-151867141 GGGACCCCTTCCTGGGGCCTTGG + Intronic
1035477749 7:159155624-159155646 GGCACCTCACACTGGGACAGAGG - Intergenic
1035598703 8:882262-882284 GGCACCCGTGCCTGGCCCAGCGG + Intergenic
1035598719 8:882314-882336 GGCACCCGTGCCTGGCCCAGCGG + Intergenic
1036776017 8:11613618-11613640 GGCTCCCCTCCCTGGCTCCGGGG - Intergenic
1037855355 8:22367460-22367482 CGCACCCCAGGCTGGGGCAGTGG + Intronic
1040549971 8:48430164-48430186 CAGACCCCTCCCTGGGGCAGAGG - Intergenic
1040604076 8:48912313-48912335 GGCTCCACTCCCTGAGGCATCGG - Intergenic
1040933211 8:52756607-52756629 AGCACTCCTCCCAGGGGCTGAGG + Intergenic
1044832254 8:96261845-96261867 GCCACCGCGGCCTGGGGCAGGGG - Exonic
1049071249 8:140357607-140357629 GGCAGCACTCCCAGGGGCTGGGG + Intronic
1049280406 8:141741277-141741299 GGCTGCCCTCCCTGTGGCTGGGG + Intergenic
1049460536 8:142725645-142725667 GCCACCCCTCCCTGGGGCAGAGG + Intergenic
1049717406 8:144099471-144099493 GGGAGCCCTGCCAGGGGCAGAGG - Intronic
1050552280 9:6758485-6758507 GGGTCGCCTCCTTGGGGCAGAGG + Intronic
1052857877 9:33418283-33418305 CACACCCCACCCTGGGGCCGAGG + Intergenic
1056425227 9:86468719-86468741 GTCACCCTTGCCTGGCGCAGTGG - Intergenic
1056443604 9:86643808-86643830 GGCATGCCTACCTGGGGCCGGGG - Intergenic
1056774166 9:89498932-89498954 GTCACCTCTCCTGGGGGCAGAGG - Intergenic
1056963101 9:91143831-91143853 GCCACCTCTGCCTGGGGCCGTGG - Intergenic
1057132226 9:92662011-92662033 GGCACCCATGGCTGGGGAAGAGG + Intronic
1057827629 9:98382974-98382996 GGCACCCCAGCCTGGGCCACAGG - Intronic
1059403881 9:114087985-114088007 GCCTCCCCTGCCTGGGGCTGAGG + Intronic
1060946331 9:127571216-127571238 GGAACCCGTCCCTGGGCCAGGGG - Intronic
1061368814 9:130186595-130186617 CCCACCCCTTCCTGGGGCTGGGG - Intronic
1061369103 9:130187907-130187929 CCCACCCCTTCCTGGGGCTGGGG + Intronic
1061516427 9:131092978-131093000 GGCTCCCCTGACAGGGGCAGGGG + Exonic
1061538958 9:131267039-131267061 ACCACACCTCCCTGGGGCCGGGG + Intronic
1061677076 9:132223500-132223522 GTCACCCCTCCCAGTGGAAGGGG + Intronic
1061720469 9:132547892-132547914 GGCAGCCCTCCCTGGGGCCCTGG + Intronic
1061743326 9:132722881-132722903 GGCATCCCTGCCTGGGGCCTGGG - Intergenic
1062003352 9:134227688-134227710 AGCACCACACTCTGGGGCAGTGG + Intergenic
1062021111 9:134319850-134319872 GGCACCACTCCTCGGGGCAGAGG - Intronic
1062102865 9:134737647-134737669 GGAATCCCGCCCTGGGGAAGGGG + Intronic
1062284579 9:135767384-135767406 GGTTCCCTGCCCTGGGGCAGAGG + Intronic
1062358696 9:136177350-136177372 GGCCGCCCTCCCTGGAGCACAGG - Intergenic
1062368024 9:136221183-136221205 GGCACCCCACGCAGGGGCAAAGG + Intronic
1062523809 9:136970297-136970319 GGAACCCCTGCCTGGGGAGGGGG + Intronic
1062594948 9:137295406-137295428 GCCCCGCCTCCCTGGGGCCGAGG + Intergenic
1186602498 X:11053043-11053065 GGCACCCCACACCAGGGCAGTGG + Intergenic
1187279703 X:17848632-17848654 AGCCAGCCTCCCTGGGGCAGGGG - Intronic
1188663543 X:32790662-32790684 GCCACCCCTCTGTTGGGCAGGGG - Intronic
1189354041 X:40298202-40298224 GGGACCCATCTCTGAGGCAGGGG + Intergenic
1190732123 X:53233336-53233358 CACACACCTCGCTGGGGCAGGGG - Exonic
1192928389 X:75780044-75780066 GGCAGCAATCCTTGGGGCAGGGG + Intergenic
1198081840 X:133247475-133247497 GGGACCCCTCTCTATGGCAGAGG + Intergenic
1198387960 X:136147129-136147151 GGGCCCCCTCCCTCGCGCAGCGG - Intergenic
1200069581 X:153521330-153521352 GCCACGCGTCACTGGGGCAGAGG + Intronic
1200315929 X:155132994-155133016 GGCACCTCTGCCTGTGGAAGGGG + Intronic