ID: 1175983655

View in Genome Browser
Species Human (GRCh38)
Location 20:62753740-62753762
Sequence GAAACCGGCACCCCTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175983655_1175983666 12 Left 1175983655 20:62753740-62753762 CCCCAGGGAGGGGTGCCGGTTTC 0: 1
1: 0
2: 2
3: 4
4: 120
Right 1175983666 20:62753775-62753797 CGGGCCATGGCCGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 145
1175983655_1175983664 8 Left 1175983655 20:62753740-62753762 CCCCAGGGAGGGGTGCCGGTTTC 0: 1
1: 0
2: 2
3: 4
4: 120
Right 1175983664 20:62753771-62753793 AAGCCGGGCCATGGCCGTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1175983655_1175983661 -7 Left 1175983655 20:62753740-62753762 CCCCAGGGAGGGGTGCCGGTTTC 0: 1
1: 0
2: 2
3: 4
4: 120
Right 1175983661 20:62753756-62753778 CGGTTTCTCCATTGGAAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 94
1175983655_1175983662 -1 Left 1175983655 20:62753740-62753762 CCCCAGGGAGGGGTGCCGGTTTC 0: 1
1: 0
2: 2
3: 4
4: 120
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1175983655_1175983660 -8 Left 1175983655 20:62753740-62753762 CCCCAGGGAGGGGTGCCGGTTTC 0: 1
1: 0
2: 2
3: 4
4: 120
Right 1175983660 20:62753755-62753777 CCGGTTTCTCCATTGGAAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175983655 Original CRISPR GAAACCGGCACCCCTCCCTG GGG (reversed) Intronic
900125215 1:1066007-1066029 GAGGCCTGAACCCCTCCCTGTGG - Intergenic
900226249 1:1534874-1534896 GCCACCTGCACCCCACCCTGTGG + Intergenic
900655734 1:3755891-3755913 GAAACAGGCACACCTGTCTGCGG - Intronic
902058281 1:13620355-13620377 GACACCTGCACACCTTCCTGAGG - Intergenic
902303719 1:15521386-15521408 GAGACCTAAACCCCTCCCTGTGG + Intronic
904404704 1:30278650-30278672 CAACCAGGCACCCCTTCCTGTGG + Intergenic
904890025 1:33772683-33772705 GAAACCGGGAGCCTTCCCTCCGG + Exonic
906041332 1:42789790-42789812 GAAACTGGTACCCTTACCTGGGG - Intronic
907272016 1:53296762-53296784 GCAACCTGCACCCCACCCGGGGG + Intronic
910059068 1:83067207-83067229 GATATTGGCACCCCTCCATGGGG + Intergenic
913216590 1:116625983-116626005 GAAGCAGCCACCCATCCCTGGGG - Intronic
914785109 1:150822393-150822415 GGTACCGGCTCCCCTCCATGAGG - Intronic
917150451 1:171938191-171938213 GACACCAGCACCCCTGGCTGTGG + Intronic
917483026 1:175428946-175428968 AAAATTGGCACCCCTCCCTTGGG + Intronic
1062832136 10:612937-612959 GGATCCGGCCCCCCTCCCAGTGG + Intronic
1063623353 10:7667608-7667630 AAACCCGGCCCGCCTCCCTGTGG + Intergenic
1067182700 10:44001243-44001265 GATACCTGCATACCTCCCTGTGG - Intergenic
1067480764 10:46596046-46596068 GAATTCTTCACCCCTCCCTGTGG - Intergenic
1067613975 10:47745755-47745777 GAATTCTTCACCCCTCCCTGTGG + Intergenic
1069566365 10:69465998-69466020 GCAACCGGCCCACCTCCCTAGGG - Intronic
1071629383 10:87205730-87205752 GAATTCTTCACCCCTCCCTGTGG + Intergenic
1076021354 10:127076593-127076615 GGAACCCTCACCACTCCCTGGGG - Intronic
1077077904 11:709502-709524 CCAAACTGCACCCCTCCCTGGGG - Intronic
1077325873 11:1963893-1963915 GAAACCTGAACGCATCCCTGAGG + Intronic
1083875554 11:65522290-65522312 GAAGCCTAAACCCCTCCCTGTGG - Intergenic
1084600416 11:70142282-70142304 GGAACTGGAACCCCTCCCAGGGG + Intronic
1085404350 11:76253023-76253045 GAAGCCACCACCCCTGCCTGGGG - Intergenic
1088368133 11:109060241-109060263 GAACCCCTCAGCCCTCCCTGAGG - Intergenic
1090955089 11:131506532-131506554 GAAGCAGCCACCTCTCCCTGTGG - Intronic
1202808853 11_KI270721v1_random:19072-19094 GAAACCTGAACGCATCCCTGAGG + Intergenic
1091626416 12:2124437-2124459 AAAACCAGCACCCCTTCCTCTGG - Intronic
1096580095 12:52579598-52579620 GAAAAAGGCACCCCTTCCTCTGG + Intergenic
1096849629 12:54427277-54427299 GAACCCAGCCCCCCTCCCTGAGG - Intergenic
1097267894 12:57756074-57756096 GAAAGCCCCACCCCTTCCTGGGG - Intronic
1100755084 12:97742477-97742499 GAAAATGGCACACCACCCTGGGG + Intergenic
1106054574 13:26226479-26226501 GAACCAGGCACTCATCCCTGAGG + Intergenic
1107449094 13:40492476-40492498 TCACCCGGCAGCCCTCCCTGGGG - Intergenic
1119523998 14:75307825-75307847 GACACCGGCTCCCCCACCTGTGG - Intergenic
1122246082 14:100404517-100404539 GAAACAGGGGCCCCTACCTGTGG + Intronic
1122771447 14:104099688-104099710 CACGCCAGCACCCCTCCCTGAGG + Intronic
1134597698 16:15509139-15509161 GAAAACGGCAACACACCCTGGGG - Intronic
1135904492 16:26498796-26498818 GACACAGGCACCCCTAGCTGTGG + Intergenic
1139357774 16:66377488-66377510 GACACCCTCAGCCCTCCCTGAGG + Intronic
1140875110 16:79143715-79143737 CAAACCGGCACCTATCCCTCAGG - Intronic
1141300852 16:82814325-82814347 GAAACCAGCACCCATCCTGGGGG - Intronic
1142192884 16:88725948-88725970 CAAGCCAGAACCCCTCCCTGGGG + Intronic
1142633573 17:1242386-1242408 GATTCTGGCACCTCTCCCTGGGG + Intergenic
1143026763 17:3945584-3945606 GAAACCCACACGCCTCTCTGGGG + Intronic
1144254475 17:13452966-13452988 GAAACCAGCACCATCCCCTGTGG + Intergenic
1145110865 17:20159934-20159956 CAAAACGGCACCCCTTCCTCTGG - Intronic
1151114286 17:71716419-71716441 GAAAACCTCACCCCTCCCTCAGG + Intergenic
1151902286 17:77024341-77024363 GAAACTGGCTCCACTCCTTGGGG - Intergenic
1152670080 17:81598271-81598293 GAAACTGGCCACCCTCCCTCTGG + Intronic
1156225808 18:35105988-35106010 TAAACTGGCACCCCTGCTTGTGG + Intronic
1159169830 18:64751683-64751705 TAAAACGGCAGCACTCCCTGAGG + Intergenic
1161846985 19:6717355-6717377 GACACCTGCACTGCTCCCTGGGG + Intronic
1166688587 19:44809990-44810012 GACCCCGTCACCCCTCCCTGGGG + Intronic
1168726387 19:58584684-58584706 GAGGCCGAAACCCCTCCCTGTGG + Intergenic
925285029 2:2710147-2710169 AAAAGCGTCTCCCCTCCCTGTGG + Intergenic
927177252 2:20419494-20419516 GATCCCGGCACCACTCCCGGTGG + Intergenic
927934573 2:27069067-27069089 GAATCCGGGACCCCTCCTGGCGG - Intronic
928294886 2:30074021-30074043 GAGACAGACAGCCCTCCCTGCGG + Intergenic
936935731 2:117836682-117836704 GACACCAGCAGCCTTCCCTGGGG - Intergenic
937886143 2:126901213-126901235 GGAACCGGCGGACCTCCCTGTGG + Exonic
941543939 2:166821762-166821784 GAATCAGCCACCCCTCCCAGGGG - Intergenic
948585328 2:239015563-239015585 GTGAGCCGCACCCCTCCCTGGGG - Intergenic
1171481962 20:25460978-25461000 TGAGCCGGCTCCCCTCCCTGAGG + Intronic
1175983655 20:62753740-62753762 GAAACCGGCACCCCTCCCTGGGG - Intronic
1175987261 20:62770335-62770357 GACACCGGCACTCCAGCCTGAGG + Intergenic
1178608208 21:34057547-34057569 GGAACCAGACCCCCTCCCTGGGG + Intergenic
1180160822 21:45997990-45998012 GAAGCCGGCTCCCTCCCCTGGGG - Intronic
1180817946 22:18804354-18804376 GAAGCAGCCACCCATCCCTGGGG - Intergenic
1181204162 22:21238809-21238831 GAAGCAGCCACCCATCCCTGGGG - Intergenic
1182747374 22:32616148-32616170 GAACTCTGCACCCTTCCCTGGGG - Intronic
1184149239 22:42628892-42628914 ACAACAGGCTCCCCTCCCTGAGG - Intronic
1185057304 22:48587686-48587708 GGAACCCGCACCCTGCCCTGAGG - Intronic
1203222759 22_KI270731v1_random:56606-56628 GAAGCAGCCACCCATCCCTGGGG + Intergenic
1203268070 22_KI270734v1_random:30207-30229 GAAGCAGCCACCCATCCCTGGGG - Intergenic
950727597 3:14927198-14927220 GTAAGCTGCACCCCACCCTGAGG + Intronic
951990585 3:28671823-28671845 AAAACCTCCACCCCTCCCTCAGG - Intergenic
954259009 3:49425366-49425388 GCAACCTGCACTCCTCCGTGAGG - Exonic
956277736 3:67521309-67521331 GAAAAAGGCACCCCTTCCTCTGG + Intronic
960938032 3:122915359-122915381 GAAACGGGGACCCCTCACTTGGG - Intronic
961779845 3:129315121-129315143 GGACCCGGGGCCCCTCCCTGAGG + Exonic
962348930 3:134642737-134642759 GAAACCAGCCTCCCTCCCTCTGG - Intronic
963326963 3:143873956-143873978 GAGGCCTACACCCCTCCCTGTGG - Intergenic
969862816 4:10051073-10051095 GCAACCAGCCCCCCACCCTGGGG + Intronic
976086103 4:81408722-81408744 GAAACTGGAATCCCTCCCTTTGG + Intergenic
985997804 5:3606468-3606490 GAACCCGGCGCCCCTCCGCGAGG + Intergenic
990761159 5:59131013-59131035 GAAAAGGGCACCCCTTCCTCAGG - Intronic
991600611 5:68348438-68348460 AAAATCGGCAGCTCTCCCTGTGG + Intergenic
998006003 5:138657424-138657446 GAAACAGGTCCCCTTCCCTGAGG - Intronic
999314862 5:150576740-150576762 GATACAGGCACCCCTCCCTCCGG - Intergenic
1000793442 5:165634792-165634814 GAAACCAGCACCTCTCTGTGGGG - Intergenic
1001238360 5:170049006-170049028 GAAACCTGCACCCCTCTCTGCGG - Intronic
1002087553 5:176785411-176785433 GAAAGCAGCACCTCTCCCCGAGG - Intergenic
1003377675 6:5594597-5594619 GAAAGCAGCTCCCCACCCTGGGG + Intronic
1003939317 6:11008576-11008598 GGACCCGGGACCCCTCCCTTAGG - Intronic
1005732724 6:28714194-28714216 GAACCTGGCACCTCTCCTTGAGG - Intergenic
1007565299 6:42845702-42845724 GAAACCGGCGCACCTGCCAGTGG - Intronic
1019304045 7:324144-324166 CAACCCCGCACCCCACCCTGTGG - Intergenic
1024054879 7:45653629-45653651 GAGGCCTGAACCCCTCCCTGGGG + Intronic
1032512131 7:132480727-132480749 AAAACCTCCTCCCCTCCCTGTGG + Intronic
1035298015 7:157877698-157877720 GGAACAGCCAACCCTCCCTGTGG + Intronic
1035459010 7:159027988-159028010 GAAACAGCCACCTCTCCCTGAGG - Intergenic
1035850980 8:2919089-2919111 GGAATCGGCGTCCCTCCCTGTGG - Intergenic
1038422411 8:27441847-27441869 GACACCTGCACAGCTCCCTGTGG - Intronic
1038613719 8:29074609-29074631 GAGACCGGCACCATTCCCAGGGG + Intronic
1040323288 8:46329077-46329099 GGAACCGACAGGCCTCCCTGGGG + Intergenic
1041650200 8:60294710-60294732 GAGACCTAAACCCCTCCCTGTGG + Intergenic
1043706589 8:83358290-83358312 GAAACAGGCACCCCTCCATGGGG + Intergenic
1049460535 8:142725639-142725661 CAAAAGGCCACCCCTCCCTGGGG + Intergenic
1049488023 8:142876570-142876592 GAATCCCCGACCCCTCCCTGTGG + Intronic
1049492912 8:142914593-142914615 GAATCCCCGACCCCTCCCTGTGG + Intronic
1049896159 9:113602-113624 GGAACCGGGAACCCTCCCCGGGG - Intergenic
1049967004 9:788927-788949 GAAACCAGCACCACTCAGTGTGG - Intergenic
1053353456 9:37428400-37428422 GAACCCGGCACCTCTGACTGTGG - Intronic
1055600244 9:77909086-77909108 GAAAAAGGCACCCCTTCCTCTGG + Intronic
1060481911 9:124021356-124021378 GAACCCTGCACCCCTCGCCGTGG + Intronic
1060485030 9:124041241-124041263 GTCCCCGACACCCCTCCCTGAGG - Intergenic
1061677073 9:132223494-132223516 AAAAGCGTCACCCCTCCCAGTGG + Intronic
1189283825 X:39838089-39838111 GAAAACTGCACTCCTGCCTGGGG - Intergenic
1189515123 X:41705883-41705905 CACCCCGGCACCCCTCCCCGTGG + Intronic
1190070245 X:47273512-47273534 GCAACCTGCACTCCTCCATGAGG - Intergenic
1195208160 X:102624922-102624944 GAGACCGGCTCCTCTCCGTGTGG + Intergenic
1196915013 X:120524837-120524859 GAAAGCGGGTCCCCTCCCCGAGG - Intronic
1200226242 X:154419429-154419451 GAAACAGGCCCTTCTCCCTGGGG - Intronic