ID: 1175983656

View in Genome Browser
Species Human (GRCh38)
Location 20:62753741-62753763
Sequence AGAAACCGGCACCCCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175983656_1175983666 11 Left 1175983656 20:62753741-62753763 CCCAGGGAGGGGTGCCGGTTTCT 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1175983666 20:62753775-62753797 CGGGCCATGGCCGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 145
1175983656_1175983664 7 Left 1175983656 20:62753741-62753763 CCCAGGGAGGGGTGCCGGTTTCT 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1175983664 20:62753771-62753793 AAGCCGGGCCATGGCCGTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1175983656_1175983662 -2 Left 1175983656 20:62753741-62753763 CCCAGGGAGGGGTGCCGGTTTCT 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1175983656_1175983660 -9 Left 1175983656 20:62753741-62753763 CCCAGGGAGGGGTGCCGGTTTCT 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1175983660 20:62753755-62753777 CCGGTTTCTCCATTGGAAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1175983656_1175983661 -8 Left 1175983656 20:62753741-62753763 CCCAGGGAGGGGTGCCGGTTTCT 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1175983661 20:62753756-62753778 CGGTTTCTCCATTGGAAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175983656 Original CRISPR AGAAACCGGCACCCCTCCCT GGG (reversed) Intronic
900514847 1:3076749-3076771 AGAAACCGGCTCGGCTTCCTTGG + Intronic
901163698 1:7199456-7199478 AGACACGGGCACCCGACCCTAGG + Intronic
902924357 1:19686128-19686150 GCAAACCGCCACCCCTCTCTGGG - Intronic
906041333 1:42789791-42789813 AGAAACTGGTACCCTTACCTGGG - Intronic
907272015 1:53296761-53296783 AGCAACCTGCACCCCACCCGGGG + Intronic
908751730 1:67430394-67430416 AGAAGACGGCCCCCCTCTCTCGG - Intronic
913216591 1:116625984-116626006 AGAAGCAGCCACCCATCCCTGGG - Intronic
914933980 1:151961757-151961779 AGAAACAGGCTCCCTTCCCTTGG + Intergenic
917483025 1:175428945-175428967 AAAAATTGGCACCCCTCCCTTGG + Intronic
921437542 1:215143266-215143288 AGAAACAGGCAGCCTTCCCTTGG - Intronic
1067704142 10:48594593-48594615 AGAAACCACCACCCACCCCTGGG - Intronic
1069566366 10:69465999-69466021 GGCAACCGGCCCACCTCCCTAGG - Intronic
1070916667 10:80159478-80159500 AGAAACCGGCACCCCACTCTTGG + Intronic
1071587937 10:86843468-86843490 AGTAACCTGCTCCCCACCCTTGG + Intronic
1074847564 10:117411712-117411734 AGGAACAGGGAGCCCTCCCTGGG + Intergenic
1075389744 10:122083837-122083859 AGAAACTGGCATCCCAGCCTTGG - Exonic
1076021355 10:127076594-127076616 AGGAACCCTCACCACTCCCTGGG - Intronic
1079025142 11:16941161-16941183 AAAAATGGGTACCCCTCCCTAGG + Intronic
1085466383 11:76726519-76726541 AAAAACCGGCACCACTTCCCTGG - Intergenic
1089079203 11:115761806-115761828 AGGAACAGGCTCCACTCCCTGGG - Intergenic
1089934116 11:122345722-122345744 AGAAACCAGCACTCCTTCCAAGG - Intergenic
1090719738 11:129460309-129460331 AGAGGCTGGCACCCCTCCCAAGG - Intergenic
1097176607 12:57147054-57147076 AGAAGCTGGTACCCCTCCCTTGG + Intronic
1097267895 12:57756075-57756097 AGAAAGCCCCACCCCTTCCTGGG - Intronic
1100755083 12:97742476-97742498 AGAAAATGGCACACCACCCTGGG + Intergenic
1113628424 13:111863625-111863647 AGACACCAGCACCCATCCCCAGG + Intergenic
1113636315 13:111921351-111921373 AGGAACCGGCGCCCATCCCCTGG - Intergenic
1116229483 14:42198192-42198214 AGCAACCAGCACCCTGCCCTTGG - Intergenic
1119952835 14:78763729-78763751 AGAAAGCTGCACCTCTCTCTAGG - Intronic
1126362265 15:47858714-47858736 AGAAACCTGCACCCACACCTTGG - Intergenic
1128063385 15:64749026-64749048 AGCAACGTGCACCCCGCCCTAGG - Exonic
1128290764 15:66476733-66476755 AGAAACCAGCACTCCTCCAGCGG - Intronic
1129253234 15:74319992-74320014 AGCAACTGCCTCCCCTCCCTGGG + Intronic
1130714424 15:86317508-86317530 ATGAATCGGCACCACTCCCTTGG + Intronic
1134244915 16:12532825-12532847 AGACACTGGCTCCCCTCGCTAGG - Intronic
1136610377 16:31362248-31362270 AGAACCCTGGACCCCACCCTGGG - Intronic
1136610396 16:31362297-31362319 AGAAGCCTGGACCCCACCCTGGG - Intronic
1136610471 16:31362493-31362515 AGAACCCTGGACCCCACCCTGGG - Intronic
1136618024 16:31410568-31410590 AGAACCCTGGACCCCACCCTGGG - Intronic
1138540093 16:57682661-57682683 AGCCCCCGGCTCCCCTCCCTCGG + Intronic
1139562935 16:67755262-67755284 CTAAACATGCACCCCTCCCTAGG + Intronic
1142986329 17:3697172-3697194 AGACACAGGCAACCCACCCTAGG + Intergenic
1145263510 17:21368502-21368524 AGAAAGCAGCACCCAGCCCTTGG - Intergenic
1148797150 17:50202459-50202481 AGAATCCCCCACCCCTACCTTGG - Intergenic
1150255487 17:63741423-63741445 ACAAACCGGCACCCAGCCCTAGG + Intronic
1152742767 17:82025563-82025585 TGAGCCCGGCACCCCGCCCTCGG - Intronic
1160536675 18:79598151-79598173 AGAAATCGTCGTCCCTCCCTCGG + Intergenic
1160743622 19:699549-699571 ACAAATCGGCTCCCCTCTCTGGG - Intergenic
1163861018 19:19742880-19742902 AGGAACTGCCACCCCTCCCAGGG - Intergenic
1165957940 19:39513726-39513748 AGACACAGACACCCCTCTCTTGG + Intergenic
1166688586 19:44809989-44810011 GGACCCCGTCACCCCTCCCTGGG + Intronic
1166871995 19:45876784-45876806 AGGCACCCGCCCCCCTCCCTCGG + Intergenic
926458105 2:13093861-13093883 AGTAATTGGGACCCCTCCCTTGG - Intergenic
926827887 2:16926635-16926657 AGAGCCTGGTACCCCTCCCTGGG - Intergenic
934568076 2:95351538-95351560 ACAAACCTGCACCCCGCCCCAGG - Intronic
938963052 2:136360383-136360405 TGAAACCATCCCCCCTCCCTGGG - Intergenic
941543940 2:166821763-166821785 AGAATCAGCCACCCCTCCCAGGG - Intergenic
944983558 2:205149663-205149685 AAAAACTGCCACCCCTTCCTGGG + Intronic
1173614288 20:44392839-44392861 AGAAAAAGGCACCCCACTCTGGG + Intronic
1173631734 20:44521582-44521604 AGGAACCGGAGCCCCTCGCTGGG + Intronic
1173849231 20:46207416-46207438 AGAATCCTCCTCCCCTCCCTGGG + Intronic
1175000002 20:55617251-55617273 AGACACTGACACCCCTCACTTGG + Intergenic
1175983656 20:62753741-62753763 AGAAACCGGCACCCCTCCCTGGG - Intronic
1178508329 21:33180980-33181002 TGAGACAGGCAGCCCTCCCTGGG + Intergenic
1180160823 21:45997991-45998013 AGAAGCCGGCTCCCTCCCCTGGG - Intronic
1180817947 22:18804355-18804377 AGAAGCAGCCACCCATCCCTGGG - Intergenic
1181204163 22:21238810-21238832 AGAAGCAGCCACCCATCCCTGGG - Intergenic
1183596843 22:38818032-38818054 TCACCCCGGCACCCCTCCCTAGG + Intergenic
1203222758 22_KI270731v1_random:56605-56627 AGAAGCAGCCACCCATCCCTGGG + Intergenic
1203268071 22_KI270734v1_random:30208-30230 AGAAGCAGCCACCCATCCCTGGG - Intergenic
953138469 3:40204912-40204934 AGAAGCCAGCACCCCTTCCACGG + Intronic
959311121 3:104738623-104738645 AGAAACCTGCACCCTTTTCTAGG + Intergenic
960938033 3:122915360-122915382 GGAAACGGGGACCCCTCACTTGG - Intronic
960960151 3:123064981-123065003 AGAAACTGTTACCCTTCCCTAGG + Intergenic
961753005 3:129108239-129108261 AGAACTCAGCACACCTCCCTAGG + Intronic
962607757 3:137046451-137046473 ATATACAGGCACCCCTTCCTTGG + Intergenic
966392089 3:179463753-179463775 AGAATCAGGCAGCCCTTCCTGGG + Intergenic
969331041 4:6473494-6473516 AGGAACCATCAGCCCTCCCTAGG + Intronic
969876522 4:10139628-10139650 AGAAACAGGCCCCCCTCTCCTGG + Intergenic
992533177 5:77671741-77671763 TGAACCGGGCACTCCTCCCTGGG + Intergenic
999306642 5:150523793-150523815 ACATGCCCGCACCCCTCCCTAGG - Intronic
1003377674 6:5594596-5594618 AGAAAGCAGCTCCCCACCCTGGG + Intronic
1003504029 6:6725304-6725326 AGAACGTGGCATCCCTCCCTGGG + Intergenic
1003690895 6:8352603-8352625 AAAAACCAGCTCCCCTCCCCAGG + Intergenic
1005114463 6:22319970-22319992 GGAAAACGAAACCCCTCCCTTGG - Intergenic
1007312529 6:40957991-40958013 GGAGACAGGCAGCCCTCCCTAGG + Intergenic
1014750043 6:125245419-125245441 AGAAACCAGAATACCTCCCTTGG - Intronic
1016570526 6:145507468-145507490 AGAAACAGGGTGCCCTCCCTTGG - Intronic
1018053898 6:160035439-160035461 AGAGACAGGCACCCCTGCCCTGG + Intronic
1024606826 7:51028577-51028599 AGAAACCAGCCCCCCACCATGGG - Exonic
1029270965 7:99376235-99376257 AGAAGCTGGCACTCCTACCTAGG - Intronic
1031383008 7:121111430-121111452 AGAAACAGGCACCCCTGCCAAGG - Intronic
1035942466 8:3917721-3917743 AGAAACCGTCACCACTCTCAAGG + Intronic
1038266244 8:26041686-26041708 GGAAACCGGCAGCCCAGCCTTGG - Intronic
1038613718 8:29074608-29074630 AGAGACCGGCACCATTCCCAGGG + Intronic
1043706588 8:83358289-83358311 TGAAACAGGCACCCCTCCATGGG + Intergenic
1046387845 8:113526541-113526563 AGAAGCTGGCATCCCTCACTGGG - Intergenic
1049214407 8:141401171-141401193 AGACACCAGCTTCCCTCCCTGGG - Intronic
1049830521 8:144698868-144698890 AGACAAGGCCACCCCTCCCTTGG + Intergenic
1056920806 9:90787194-90787216 AGGGACAGGCACCCCTTCCTTGG + Intergenic
1057493718 9:95543263-95543285 AGGAACTGCCACCTCTCCCTTGG - Intergenic
1061087414 9:128407187-128407209 AGAAACAGGCATTCCTCACTGGG + Intergenic
1061129629 9:128701701-128701723 AGTGACCAGCACACCTCCCTTGG + Intergenic
1061733798 9:132638130-132638152 AGATACCTGCAGCCCGCCCTGGG - Intronic
1062541014 9:137041577-137041599 AGCACCCGGGACCCCTCCCCAGG + Intronic
1197182699 X:123553308-123553330 AGATACCGGCATCCTTCCCTTGG + Intergenic
1197701854 X:129605691-129605713 AGAATCCTGCACCTTTCCCTAGG - Intergenic
1199973329 X:152876558-152876580 AGAAAATGGAACTCCTCCCTCGG - Intergenic
1200107595 X:153723816-153723838 AGAAACCGGCACCTCCCTCGAGG + Exonic