ID: 1175983662

View in Genome Browser
Species Human (GRCh38)
Location 20:62753762-62753784
Sequence CTCCATTGGAAGCCGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175983657_1175983662 -3 Left 1175983657 20:62753742-62753764 CCAGGGAGGGGTGCCGGTTTCTC No data
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1175983647_1175983662 23 Left 1175983647 20:62753716-62753738 CCATTGATGGCTGTTATTCCACT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1175983655_1175983662 -1 Left 1175983655 20:62753740-62753762 CCCCAGGGAGGGGTGCCGGTTTC 0: 1
1: 0
2: 2
3: 4
4: 120
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1175983653_1175983662 5 Left 1175983653 20:62753734-62753756 CCACTGCCCCAGGGAGGGGTGCC 0: 1
1: 1
2: 6
3: 42
4: 404
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1175983656_1175983662 -2 Left 1175983656 20:62753741-62753763 CCCAGGGAGGGGTGCCGGTTTCT 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175983662 Original CRISPR CTCCATTGGAAGCCGGGCCA TGG Intronic
900083158 1:874197-874219 CTCCATTGGTACACGGGCGAGGG + Intergenic
900309716 1:2027855-2027877 CTGCCTGGGGAGCCGGGCCATGG + Intronic
900697041 1:4018996-4019018 CCCCATTGGATGTCAGGCCAAGG + Intergenic
901522938 1:9799262-9799284 CTCCATGGGAACCGGTGCCAGGG + Intronic
903130977 1:21279373-21279395 CTCCAAGGGAAGCGGGGCCCGGG - Intronic
906713555 1:47950932-47950954 CTCTACTGGAAGCAGGCCCAAGG - Intronic
908256034 1:62304480-62304502 CTGGATTGGAAGCAGGTCCAGGG - Intronic
911383086 1:97140331-97140353 CTACATTGAAAGCCCTGCCAAGG + Intronic
912389213 1:109290314-109290336 CTCCAGTGGAAGCAGGACCTAGG - Intergenic
922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG + Intergenic
1064307977 10:14185841-14185863 CTCTATGGGAAACCTGGCCATGG - Intronic
1066041677 10:31554448-31554470 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1069905595 10:71730449-71730471 CACCTGTGGGAGCCGGGCCAGGG - Intronic
1070617496 10:77980063-77980085 TTCCCTTGGAAGCCTAGCCATGG + Intronic
1072409520 10:95187126-95187148 CTCCATAGGTATCTGGGCCATGG - Intergenic
1073053029 10:100681415-100681437 CTCCTCCGGAAGCCGGCCCAGGG + Intergenic
1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG + Intronic
1077376962 11:2209622-2209644 CCCCCTGGGAAGCAGGGCCAGGG - Intergenic
1077441069 11:2569509-2569531 CTCCCTCAGAAGCCGGGCCCTGG - Intronic
1081600302 11:44488205-44488227 CTCCAGTGGAGGCCGGGCCCTGG - Intergenic
1083641744 11:64149400-64149422 CTCCATTTGCACCAGGGCCAGGG - Intronic
1084423614 11:69072561-69072583 CTCCCTTGGAACCCTGGCCTGGG - Intronic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1086496998 11:87414601-87414623 CTCCATTAAAAACTGGGCCAAGG + Intergenic
1087362216 11:97175449-97175471 CTCCATTAAAAGCTGGGCAAAGG + Intergenic
1092370841 12:7915693-7915715 CTGCATTGGAAGGCAGGTCAAGG + Intergenic
1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1104775874 12:131389831-131389853 TTCCATGGGAAGCAGAGCCAGGG - Intergenic
1104902540 12:132197226-132197248 CCCCATTGTGAGCCGGGCCACGG - Exonic
1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG + Intergenic
1115907192 14:38212529-38212551 CTACATTGGAAGCCTGAGCAGGG + Exonic
1119478792 14:74947103-74947125 CTCCCTTGGGAGCCAGGGCAAGG + Intronic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1121786198 14:96663083-96663105 CTCCGCGGGAATCCGGGCCACGG - Intergenic
1122318442 14:100839359-100839381 CTCCTTTGGAAGAGGGGACAGGG - Intergenic
1124880657 15:33639639-33639661 CCCCAGTGGGAGCTGGGCCATGG + Intronic
1127611219 15:60639477-60639499 GTCCACTGGAAGCCGGGACGTGG - Intronic
1128749376 15:70138086-70138108 CTCCTTAGGCAGCTGGGCCATGG - Intergenic
1129970622 15:79774916-79774938 CTCCCTTGGAGGCAGGGGCAGGG - Intergenic
1134844888 16:17431716-17431738 ATCCATTCGAAGGCAGGCCATGG + Intronic
1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG + Intronic
1135828409 16:25751173-25751195 AGCCATTGCAAACCGGGCCATGG - Intronic
1141151102 16:81565245-81565267 TTCCTTTGGAAGGTGGGCCATGG - Intronic
1141324061 16:83039103-83039125 CTCCGTGGGAACCTGGGCCATGG - Intronic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1141880356 16:86854441-86854463 CTCTGTTGAAAGCCAGGCCAGGG - Intergenic
1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG + Intergenic
1142204499 16:88776492-88776514 CTCCAAGGGAAGCTGGGCCCCGG - Intronic
1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG + Intronic
1148103167 17:45105048-45105070 CTCCAGCAGAAACCGGGCCATGG + Intronic
1151423929 17:74017373-74017395 CTGCCTTGGAGGCCCGGCCAAGG - Intergenic
1151938765 17:77280359-77280381 CTCCATTGGCAGCTGTGCAAGGG + Intergenic
1152737543 17:82004799-82004821 GGCCTTTGGAAGCCGGGCCCAGG + Intronic
1153580608 18:6569963-6569985 ATCCATTAGAAGCCGAGCAAGGG - Intronic
1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG + Intergenic
1157327112 18:46677323-46677345 CTCCATTGGGTGCCTGACCAAGG + Intronic
1159636952 18:70816642-70816664 CTCCCCTGGAAGCCTGGCAAGGG - Intergenic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1168459093 19:56538892-56538914 GCCCAGTGGATGCCGGGCCATGG + Intergenic
929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG + Intergenic
932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG + Intronic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG + Intergenic
933892418 2:86783983-86784005 CTCCTGTGGAAGCAGGGCCTGGG - Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
942865667 2:180671535-180671557 CTCCATTAGAAGGTGGGCTAAGG - Intergenic
945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG + Exonic
1168931391 20:1627167-1627189 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1174226773 20:49006968-49006990 CTCCAATGGCAGGCCGGCCACGG - Intronic
1175213315 20:57375416-57375438 CCCCATCGGAAGCCAGGGCAGGG - Intronic
1175929160 20:62485479-62485501 CTCCAGAGGAAGCCAAGCCAGGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176364324 21:6023484-6023506 CTCCAGTGGAAGCCAGGTCCAGG + Intergenic
1179373809 21:40830928-40830950 CTCCATGGGATCCCTGGCCAAGG + Intronic
1179759194 21:43515061-43515083 CTCCAGTGGAAGCCAGGTCCAGG - Intergenic
1182285019 22:29241192-29241214 CTCCAGAGGAACCAGGGCCAGGG - Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1185137226 22:49079903-49079925 CTTGGTTGGAAGCCGGGCCCAGG - Intergenic
1185388303 22:50546596-50546618 CTTGAGTGGAAGCCGGGCCATGG - Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG + Intronic
961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG + Exonic
962308238 3:134307608-134307630 GTCCATTTGAAGCCAGGACAAGG - Intergenic
963067570 3:141275446-141275468 CTCCCTTGGAGTCTGGGCCAGGG - Intronic
970635966 4:18009788-18009810 CTCCATTGGAAGGCATGCTAAGG - Intronic
985183805 4:187295074-187295096 CTCCAGTTGAATCCAGGCCAAGG - Intergenic
985260689 4:188112191-188112213 CTCCATTAGAAGCAGGGGCTTGG + Intergenic
991354121 5:65749851-65749873 TTCCATAGGGAGCAGGGCCAAGG - Intronic
1000140922 5:158402804-158402826 CTCTATTGGAAGATGGGGCAGGG - Intergenic
1002469942 5:179429124-179429146 CTGCACTGGCAGCTGGGCCAGGG + Intergenic
1003499725 6:6694499-6694521 CTCCATCGCAAGCCCTGCCACGG - Intergenic
1003500654 6:6700268-6700290 CTCCTCTGAAAGCTGGGCCAAGG + Intergenic
1003515117 6:6811438-6811460 GTGATTTGGAAGCCGGGCCAAGG + Intergenic
1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG + Exonic
1007815930 6:44525557-44525579 TTCCAGTGGAAGCCAGGCCAGGG - Intergenic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1019759084 7:2795860-2795882 CTCCATTGCACTCCAGGCCAGGG - Intronic
1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1026824611 7:73573693-73573715 CTCATCTGGAAGCCAGGCCAAGG + Intronic
1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033040085 7:137909653-137909675 CTCCATTGGAAGAAGGGACAAGG - Intronic
1033541431 7:142359341-142359363 ATCCATTGGCATCCAGGCCAAGG - Intergenic
1035641992 8:1190917-1190939 CTCCTATGGAAGCCGTCCCATGG + Intergenic
1036793276 8:11737572-11737594 CAGCATTAGAAGCCAGGCCAGGG + Intronic
1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG + Intergenic
1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG + Intergenic
1043170714 8:76962454-76962476 CTGCAATGGAAGCTGGGTCAAGG - Intergenic
1047672984 8:127169356-127169378 ATCCATTGGAACCAGTGCCAGGG - Intergenic
1052736944 9:32352385-32352407 CTCCATGGGAAGCAGTGACAGGG + Intergenic
1059717234 9:116924461-116924483 CTCCATTGGCAGCGGTGGCATGG + Intronic
1061649874 9:132038871-132038893 CTCCGTTCGAAGCCCTGCCACGG - Intronic
1192201113 X:69067339-69067361 CTGCAGTGGCAGCGGGGCCAGGG - Intergenic
1198739298 X:139823973-139823995 CTCCATTAAAAGCTGGGCAAAGG + Intronic
1200843239 Y:7805127-7805149 CCCCATTGGAAGGAGGGTCAGGG + Intergenic