ID: 1175983669

View in Genome Browser
Species Human (GRCh38)
Location 20:62753789-62753811
Sequence TGGCAGCAGCAGAACCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 4, 3: 51, 4: 478}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175983669_1175983676 20 Left 1175983669 20:62753789-62753811 CCTGGCTGGTTCTGCTGCTGCCA 0: 1
1: 1
2: 4
3: 51
4: 478
Right 1175983676 20:62753832-62753854 CCTGTTCTGAGCAGCAGCTCTGG 0: 1
1: 0
2: 2
3: 37
4: 252
1175983669_1175983677 26 Left 1175983669 20:62753789-62753811 CCTGGCTGGTTCTGCTGCTGCCA 0: 1
1: 1
2: 4
3: 51
4: 478
Right 1175983677 20:62753838-62753860 CTGAGCAGCAGCTCTGGTTGAGG 0: 1
1: 0
2: 1
3: 35
4: 267
1175983669_1175983678 29 Left 1175983669 20:62753789-62753811 CCTGGCTGGTTCTGCTGCTGCCA 0: 1
1: 1
2: 4
3: 51
4: 478
Right 1175983678 20:62753841-62753863 AGCAGCAGCTCTGGTTGAGGAGG 0: 1
1: 0
2: 6
3: 105
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175983669 Original CRISPR TGGCAGCAGCAGAACCAGCC AGG (reversed) Intronic
900139287 1:1132745-1132767 AGGCCTCCGCAGAACCAGCCCGG - Intergenic
900186100 1:1333947-1333969 GGCCAGCAGCACCACCAGCCAGG - Exonic
900510079 1:3054683-3054705 TGGCAGAGGCAGAAGCAGCTGGG + Intergenic
900778157 1:4600075-4600097 TACCAGCCGCAGGACCAGCCGGG + Intergenic
900913723 1:5620036-5620058 TGGCTGCTGCAGAACAAGCATGG + Intergenic
901245216 1:7725024-7725046 TGGAAGCAGCAGTTTCAGCCTGG - Intronic
901835218 1:11919782-11919804 AGGCAGCAGCACAGCCACCCTGG + Exonic
902140256 1:14347599-14347621 TGACAACTGCAGAAGCAGCCAGG - Intergenic
902240026 1:15082195-15082217 GGGCAGCAACAGGCCCAGCCAGG + Intronic
902363229 1:15953684-15953706 TGGAAGCAGCAGAGCCTCCCGGG + Intronic
902697049 1:18147115-18147137 TGGCAGCCGCAAGACCAGCAGGG - Intronic
902962025 1:19970550-19970572 TGTCAGCAGGAGCACCTGCCTGG + Intergenic
903742038 1:25563898-25563920 TGGGAGGACCAGACCCAGCCCGG + Intronic
903770113 1:25758530-25758552 TGTCAGCAGAGGAGCCAGCCTGG + Intronic
904038528 1:27571448-27571470 GGGCAGGAGCAGAACAAGTCAGG + Intronic
904304280 1:29577567-29577589 TGGAAGCAGCAGAAACCCCCAGG + Intergenic
904835258 1:33331550-33331572 TGGGAGCAGGAGGACCAGGCAGG - Intronic
904841612 1:33375473-33375495 TGCCACCAGCAGTACCAGCGGGG - Exonic
905570436 1:39000235-39000257 TGCCAGCTCCAGAACCAGGCTGG + Intronic
905659763 1:39712490-39712512 TGGCAGCAGCAGCACCTTCCTGG + Intronic
906256019 1:44350964-44350986 TGGAAGCAGCAGGACTAGTCAGG - Intronic
906631462 1:47372300-47372322 AGGCAACAAAAGAACCAGCCCGG - Intronic
907011496 1:50968200-50968222 AGGCAGCAGCAGCCGCAGCCTGG + Exonic
907369791 1:53993243-53993265 TGGCAGCAGCCGCTCCAGACAGG + Intergenic
907393943 1:54176839-54176861 TGGTGGCAGCAGAACCATCAAGG + Intronic
907403261 1:54238676-54238698 TGGCAGCAGCACAGGCAGGCGGG + Intronic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
912153156 1:106883360-106883382 TGGCTGAAGCTGAAGCAGCCTGG + Intergenic
912190837 1:107338433-107338455 TTGCAGCAGCAGACCTAGCTGGG - Intronic
912382603 1:109255423-109255445 TGGCTGCAGCTGCCCCAGCCTGG + Intronic
912464723 1:109864001-109864023 TGGCAGCATCAGAGAGAGCCTGG - Intergenic
913186287 1:116373297-116373319 TGGCAACAGCGGTAGCAGCCCGG + Intronic
914753905 1:150552545-150552567 AAGCAGCAGCAGATACAGCCAGG - Exonic
915185260 1:154099429-154099451 TGGCAGCAGCTGCTCCAGACAGG + Intronic
915540166 1:156560961-156560983 TGGCTGCAGCCACACCAGCCTGG + Exonic
916672111 1:167030841-167030863 TGGCAGCAGCAAAGGCAGTCAGG + Intergenic
917109839 1:171536050-171536072 TGGCAGCAGCAGCAACAGCAAGG + Exonic
917235653 1:172888912-172888934 TGGCTGTAGCATAAGCAGCCAGG + Intergenic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
917876891 1:179294016-179294038 TGGCGGCAGCAGCTCCGGCCCGG + Intronic
918306100 1:183248098-183248120 TGGCATCAGCTGAACCAGGCAGG + Intergenic
921035811 1:211377036-211377058 TGGGAGCAGCTGATCCATCCAGG + Intergenic
921127180 1:212188249-212188271 AAGCAGCACCAGCACCAGCCGGG + Intergenic
922336859 1:224624922-224624944 AGGCTGCAGCAGAGCCAGTCGGG - Intronic
923254474 1:232209424-232209446 TGTCAGCAGCAGCTCCAGACTGG - Intergenic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
1063957579 10:11280946-11280968 CGCCAGCATCAGAAGCAGCCAGG - Intronic
1064380427 10:14837510-14837532 TGGAAGCAGCAGAATCAATCTGG + Intronic
1064392968 10:14957468-14957490 TGGCTGCAGCAGAATGATCCGGG + Intergenic
1064697149 10:17978891-17978913 GGGCAGCAGCAGTACCACCTGGG + Intronic
1065288608 10:24208805-24208827 TTGCAGCAGTGGAACCAGGCAGG + Intronic
1067064714 10:43097257-43097279 TCGCAGGAGCAGATCCAGTCTGG - Intronic
1067849579 10:49746159-49746181 GGACGGCAGCAGCACCAGCCGGG + Intronic
1068130494 10:52889819-52889841 TGGCTGCAGCAGCACCAGGGAGG - Intergenic
1068472669 10:57484780-57484802 GTTCAGCATCAGAACCAGCCAGG + Intergenic
1068881730 10:62056441-62056463 TGGCATCAGCAATACCAGCAAGG - Intronic
1069943568 10:71971258-71971280 TGGCAGCAGCAGAACAAAGCAGG - Intronic
1070842019 10:79493990-79494012 TGGCAGCCACAGAAGCTGCCAGG - Intergenic
1070981012 10:80647336-80647358 TGGCAGCATCAGCAACACCCAGG - Intergenic
1071572636 10:86706431-86706453 TGGCTGCAGCAGAGGCAGGCTGG - Intronic
1071848603 10:89545200-89545222 TGAGATCAGCAGAACCACCCAGG + Intronic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072574188 10:96685362-96685384 TGGGAGGAGCAGAGGCAGCCAGG + Intronic
1073496600 10:103897266-103897288 AGGCAGGAGAAGCACCAGCCTGG + Intronic
1074705643 10:116127551-116127573 TGGCAGCTGCACATCCATCCCGG + Intronic
1075441692 10:122484899-122484921 AGGCAGTGGCAGAGCCAGCCTGG + Intronic
1075683655 10:124349492-124349514 AGACAGAAGGAGAACCAGCCTGG - Intergenic
1076719172 10:132385697-132385719 TGGCACCAGCAGCACCAGCCAGG - Intergenic
1076758402 10:132587362-132587384 TGGCAGCAGCAGAAGCAGGCTGG - Intronic
1076984011 11:222585-222607 TGGGAGCAGCAGACCCAGCAGGG - Intronic
1077228681 11:1449234-1449256 TGCCAGCAGCTGCCCCAGCCTGG + Intronic
1078076671 11:8168656-8168678 TTCCAGCAGCAGAACCATCTGGG + Intronic
1079077411 11:17392819-17392841 TGGGTTCAGTAGAACCAGCCTGG - Intergenic
1080491647 11:32771155-32771177 TGGCAGCAGCACTGCCAGCTTGG + Intronic
1082249283 11:49961379-49961401 TGGCAGAAGCTGGAGCAGCCTGG - Intergenic
1083158563 11:60840785-60840807 TGTCCACAGCAGAAGCAGCCGGG - Intergenic
1083179019 11:60972414-60972436 TGGCCTCAGCACAACCAGCTGGG + Intronic
1083257059 11:61503068-61503090 TGGCAGTGGCTGAGCCAGCCTGG + Intergenic
1083750131 11:64756228-64756250 TGGCAGCACCAGAGGGAGCCAGG + Intronic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1084315280 11:68342258-68342280 TGGCAGGAGCAGAACCCGACGGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084775164 11:71370095-71370117 TGGCAGCAGCACAGCCAGAGGGG + Intergenic
1086081066 11:82902405-82902427 TGAAAGCAGGAGAACCAGCTGGG - Intronic
1086249160 11:84794328-84794350 TGGCAGTAGCTGCTCCAGCCAGG - Intronic
1086862602 11:91942920-91942942 AGGCAGTAGCTGAACCAGCCAGG + Intergenic
1086926287 11:92644056-92644078 AGGCAGCAGCAGAGGCACCCAGG - Intronic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087701374 11:101440231-101440253 TGGGAGCATCAGAACCGGCTGGG - Intergenic
1088172837 11:107017848-107017870 CGGCGGCGGCAGAAGCAGCCGGG + Exonic
1088333436 11:108676859-108676881 TGGCAGCAGCTGAACTACCGTGG + Intronic
1088886080 11:114008147-114008169 TGACAGCAGCATAATCACCCAGG - Intergenic
1088887554 11:114019737-114019759 TGGCAGCTGCAGTAGCAGGCAGG + Intergenic
1089996029 11:122908316-122908338 TGGCAGCAGCAGTAACACCTTGG - Intronic
1090064923 11:123494545-123494567 TGACAGCCACAGAAGCAGCCAGG - Intergenic
1090382819 11:126338763-126338785 TGACACCAGCAGATCCAGGCAGG + Intronic
1090454833 11:126839716-126839738 TGACAGCAGAGGAACCCGCCTGG - Intronic
1090957238 11:131524349-131524371 TGTCAGCACCAGGCCCAGCCTGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1092153091 12:6264566-6264588 TGGCAGCAGCAGCAGAAGCAGGG + Intergenic
1092155113 12:6277124-6277146 TGGCAGGAGCAGAGCAAGCAAGG + Intergenic
1092447260 12:8568623-8568645 TGGCAGCTGCAGCAACACCCAGG + Intergenic
1093128930 12:15366035-15366057 TGGCAGGACCAAAACCAGCCAGG + Intronic
1094171950 12:27502808-27502830 TGTAAGCAACAGAACCAGTCTGG - Intergenic
1094480521 12:30877690-30877712 TGGCTGGAGCAGACCCAGCAAGG - Intergenic
1094525422 12:31227804-31227826 TCACAGCAGGAGAAGCAGCCAGG - Intergenic
1096380270 12:51151178-51151200 CGGCTGCAGCAGAGCAAGCCAGG + Intronic
1096519198 12:52174606-52174628 GGGCTGCAGCAGTGCCAGCCTGG - Intronic
1096785372 12:54014338-54014360 TGTGAGCAGCGGCACCAGCCAGG + Intronic
1097794119 12:63844269-63844291 TGGCAGCAGCATCCCCAGCCCGG + Intergenic
1100890744 12:99123383-99123405 TGGCCGGATCAGGACCAGCCAGG + Intronic
1101124212 12:101614405-101614427 TGCCTGCAGCAGAAGCTGCCTGG + Intronic
1101865525 12:108517079-108517101 CGGCAGCAGCAGGGCCAGCAGGG - Exonic
1102664134 12:114555497-114555519 TGAGAGCTGCAGAACCAGCCAGG - Intergenic
1103300963 12:119926424-119926446 TAGCAGCAGCAGCAGCACCCAGG + Intergenic
1103542948 12:121678960-121678982 TGGCAGCAGCATGACTGGCCAGG - Intergenic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104023273 12:125008098-125008120 TAGCAGCAGCAGCATCACCCAGG - Intronic
1104209672 12:126676729-126676751 TAGCAGCAGCAGACCCAGTATGG - Intergenic
1104369470 12:128210886-128210908 TGGGAGCAGAAGAACCGCCCAGG - Intergenic
1104729709 12:131098092-131098114 GGACAGCAGCAGAGCCAGGCCGG - Intronic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1105411308 13:20174055-20174077 TGGCTGCAGCCGAAGCTGCCTGG - Intergenic
1105571140 13:21603996-21604018 TGGCAGGAGCAGGAGCGGCCTGG - Exonic
1105602588 13:21900500-21900522 CAGCAGCAGAAGCACCAGCCTGG + Intergenic
1105719601 13:23100806-23100828 TGGCAGCTCCAGGAACAGCCTGG - Intergenic
1105858949 13:24392992-24393014 TGGCAGCAGCTGCATGAGCCAGG - Intergenic
1106072965 13:26431247-26431269 TTGCTGCATCAGAACCACCCGGG - Intergenic
1107184735 13:37505333-37505355 AGGAAGCAGCAGAAACACCCTGG + Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1108689916 13:52850849-52850871 CGGCAGCAGCAGCGCCAGGCGGG - Intergenic
1108896390 13:55334311-55334333 TGGCAGCTTCAGCACTAGCCAGG + Intergenic
1109134135 13:58625711-58625733 TGGCAGCAGCAGCAGCAGGCAGG - Intergenic
1110819555 13:79898627-79898649 TGGCATCAACAAAACCAGCCAGG - Intergenic
1111579695 13:90207276-90207298 TGGCAGCAGTAGACCTAGTCAGG - Intergenic
1113447339 13:110379540-110379562 TGGCTGCAGCAGAAGCTGCAAGG + Intronic
1113640577 13:111954099-111954121 TGGTAGGAGCAGAAGCTGCCAGG + Intergenic
1113708039 13:112446767-112446789 TTGGACCAGCAGAACAAGCCTGG - Intergenic
1114358309 14:21940171-21940193 TGGCAGCAACAAAACCATCAGGG + Intergenic
1114757595 14:25277746-25277768 TGACACAGGCAGAACCAGCCTGG - Intergenic
1114856259 14:26448300-26448322 TTGCAGCAGTAGCAGCAGCCAGG + Exonic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115134347 14:30091014-30091036 TGGCAGTAGCAGGAGCAGTCAGG + Intronic
1115534864 14:34363467-34363489 TGGCAGTAGCAGAACCTTCCTGG + Intronic
1115642141 14:35341679-35341701 TGGGAGGAGGAGACCCAGCCGGG - Intergenic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1117512897 14:56471256-56471278 TGGCAGCGGCAGCAGCAGGCTGG + Intergenic
1117733856 14:58750644-58750666 TGGCAGCAGCCGCTCCAGACAGG - Intergenic
1118062878 14:62160174-62160196 AGGCAGGAGCAGAACCAGGGAGG - Intergenic
1118230675 14:63945831-63945853 TGGCAACAGCTTGACCAGCCTGG - Intronic
1118749316 14:68794955-68794977 GGGCAGCAGCAGAACAAGCGAGG - Intronic
1119615602 14:76096799-76096821 TGGCAGTGGCAGCACCAGCTGGG - Intergenic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119740040 14:77008233-77008255 TGGAAGCAGCAGAACCTTCTGGG + Intergenic
1121017520 14:90557546-90557568 TGGCAGCAGCCAACGCAGCCAGG + Intronic
1122011573 14:98753374-98753396 TGGCTCCAGGAGAACCAGACAGG - Intergenic
1122275593 14:100589258-100589280 TGGCAGCAGCAGTGCCAGGGCGG - Intergenic
1122477385 14:102020177-102020199 TGGAAGGAGCAGAGTCAGCCAGG + Intronic
1122775149 14:104113718-104113740 TGCCAGCGGCAGTACCAGCCAGG - Exonic
1123028410 14:105439381-105439403 TGGCAGCACCAGATCCTTCCTGG + Intronic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1125435960 15:39645660-39645682 GGGCAGCAGCAGCTGCAGCCAGG - Intronic
1125442200 15:39715069-39715091 TGGTAGCATCAAGACCAGCCAGG - Intronic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127792935 15:62414454-62414476 TGGCAGCAGCAGTATCACCTGGG + Intronic
1127978276 15:64015165-64015187 TGGCAGGAGAACAAACAGCCTGG + Intronic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1129699943 15:77762072-77762094 TGGCTGCAGCCAAACCTGCCAGG - Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130821798 15:87503631-87503653 TGTCTGCAGCAGAACCATTCTGG - Intergenic
1132559395 16:586469-586491 GGTCACCAGCAGACCCAGCCAGG - Intergenic
1132673147 16:1110055-1110077 GGGCTGCAGCAGAACCTGCCTGG - Intergenic
1132758021 16:1495431-1495453 TGTCGGCAGCAGACGCAGCCCGG + Exonic
1132902355 16:2264171-2264193 TGGTAGCAGCAGTACCAGGTGGG - Exonic
1133042869 16:3069751-3069773 TGGCAGCAGGAGAAGCAGGGTGG + Intronic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133746394 16:8690184-8690206 TGGCAGCAGCAGCATCTGCCTGG + Intronic
1134267771 16:12706658-12706680 TGGCAGCCCCAGGGCCAGCCTGG + Intronic
1134447257 16:14340201-14340223 TGGCTGCAGCAGAGCGAGTCGGG + Intergenic
1134640486 16:15826039-15826061 TGGCAGCACCAAGCCCAGCCTGG + Intronic
1134761522 16:16718951-16718973 CAGCAGCATCAGCACCAGCCTGG + Intergenic
1134984536 16:18640219-18640241 CAGCAGCATCAGCACCAGCCTGG - Intergenic
1135300138 16:21319674-21319696 TTTCAGCAGCAGCACCAGGCTGG - Intergenic
1135477924 16:22794176-22794198 TGGCAGAGGGAGAGCCAGCCTGG + Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1137483276 16:48870233-48870255 TGGAAGCAGCAGGATCAGTCAGG + Intergenic
1137582744 16:49643887-49643909 CGTCAGCAGCAGAAAGAGCCAGG + Intronic
1137646549 16:50080084-50080106 TGGCAGCAGGAGGACCAGTCAGG + Intronic
1138382051 16:56609259-56609281 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138383338 16:56618585-56618607 GGGCAGCAGGAGCAGCAGCCTGG - Intergenic
1138385600 16:56633747-56633769 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138386153 16:56636848-56636870 GGGCAGCAGAAGCAGCAGCCTGG - Intergenic
1138386651 16:56639855-56639877 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138389408 16:56659069-56659091 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138390459 16:56666952-56666974 GGGCAGCAGGAGCAGCAGCCTGG + Exonic
1138392155 16:56677648-56677670 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138393059 16:56683954-56683976 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138442231 16:57042017-57042039 TGGGAGCAGCTGAGCCAGCCGGG - Exonic
1138702397 16:58878149-58878171 TGCCAGCAACAGAACAAACCTGG - Intergenic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139276978 16:65736838-65736860 TGGCAGCACCAGAAACAGCTAGG + Intergenic
1139433568 16:66924056-66924078 TGGCAACAGCAGTGCCAGGCAGG + Intronic
1140320821 16:73950369-73950391 TGGCAGCATCAGTACCACCATGG + Intergenic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140916352 16:79497329-79497351 TGGCAGCATCTGATCCATCCTGG - Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141374917 16:83521782-83521804 TGGCAGAACCAGCACTAGCCAGG - Intronic
1141523596 16:84597577-84597599 TGGCAGCCTCAGAATCACCCTGG - Intronic
1141646742 16:85371613-85371635 TGCCAGCAGCAGAGGCAGCTGGG - Intergenic
1141718186 16:85739103-85739125 TGGCGGCAGGAGAGCCAGCATGG - Intronic
1141818570 16:86429780-86429802 TGGCAGCAACAGAAGCAGGGAGG - Intergenic
1142080282 16:88145551-88145573 TGGCAGCAGAACCACCACCCTGG - Intergenic
1142164165 16:88576845-88576867 TGGCAGAAGGAGACGCAGCCTGG - Intronic
1142194823 16:88734547-88734569 GGGCAGCATCAGCACCGGCCCGG + Intronic
1142490326 17:274364-274386 GGGCAGCAGCTGAAGCCGCCTGG + Intronic
1142690794 17:1605252-1605274 TGGCTGCAGCATAAACAGGCCGG + Intronic
1144201086 17:12943366-12943388 GGGAAGCAGGAGAACCAGACAGG - Intronic
1144437975 17:15258391-15258413 TGGCAGCAGAAGCACCAACTAGG - Intronic
1145932605 17:28696773-28696795 TGGCAGCAACAGGACAAACCAGG - Intronic
1146249645 17:31327495-31327517 GGACAGCAGTAGAACCAACCTGG - Exonic
1147268433 17:39249007-39249029 AGGCACCAGCAGGACCAGTCAGG - Intergenic
1147494472 17:40902844-40902866 TGGCAGCATCAGCAGCACCCAGG + Intergenic
1148133608 17:45277384-45277406 TGGCAGTAACAGAACCAGCTTGG + Intronic
1148236400 17:45972013-45972035 GGGGAGCAGCAGATGCAGCCAGG - Intronic
1148690440 17:49524022-49524044 TGGCAGCACCAGAAACAGGCTGG + Intergenic
1148846827 17:50534422-50534444 TGGAACTAGCAGAACCAGTCGGG - Intronic
1149534198 17:57419856-57419878 GGGCAGAAGCAGGCCCAGCCAGG - Intronic
1149578688 17:57732167-57732189 TCACATCAGCAGAACCACCCAGG - Intergenic
1150226168 17:63525679-63525701 TGGCAGCAGCAGGAACAACCAGG - Intronic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1151356689 17:73562845-73562867 TGGCAGCAGCCGCACGAGGCAGG + Intronic
1151357248 17:73567188-73567210 TGGCTGGAGCTGAAGCAGCCAGG - Intronic
1152828955 17:82485704-82485726 TGGCAGCTGCAGGACCAGTGTGG - Intronic
1156308043 18:35897421-35897443 TGGCAGGAGCCAAACCAGACTGG - Intergenic
1157383796 18:47246621-47246643 TGGCGGCGGCAGCAGCAGCCCGG - Intronic
1157954606 18:52082820-52082842 TGAGAACAGCAAAACCAGCCAGG + Intergenic
1159259941 18:66001511-66001533 TGGCAGCATCTGACCCTGCCAGG - Intergenic
1159420042 18:68206168-68206190 TGGCAGGAGCAGAAACACCATGG - Intergenic
1160630217 18:80241804-80241826 TGACAGCAGCAGAACCTTCCAGG - Intronic
1161070137 19:2255877-2255899 CCCCAGCAGCAGAACCATCCTGG + Intronic
1161120376 19:2522319-2522341 GGGCAGCCGCAGTCCCAGCCGGG + Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161522732 19:4734428-4734450 AGCCAGTAGAAGAACCAGCCTGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161735159 19:5987698-5987720 TGGCAACAGCAGCAGCAGGCTGG - Intergenic
1162447256 19:10731087-10731109 GGGCAGGAGCAGCCCCAGCCAGG + Intronic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162926583 19:13933273-13933295 TTGCTGCAGCACAACCAGCTGGG - Exonic
1163820598 19:19494414-19494436 TGACAGCAGCAGTGCCAGCAGGG - Intronic
1164401163 19:27903276-27903298 TCTCAGGACCAGAACCAGCCTGG - Intergenic
1164463593 19:28468997-28469019 TGGCAGCAGCGGAGGCAGTCAGG + Intergenic
1164700709 19:30281934-30281956 TGGCATAACCAGAAGCAGCCTGG - Intronic
1164740247 19:30570393-30570415 TGGCAGGTGCAGAGGCAGCCGGG + Intronic
1164903053 19:31944465-31944487 TGTCAGCAGTAAAACCAGTCAGG + Intergenic
1165433051 19:35783223-35783245 GGCCAGCAGCAGAATAAGCCTGG + Intronic
1165939636 19:39408570-39408592 TGCCAGCAGCGGCAGCAGCCTGG + Exonic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1166914150 19:46183154-46183176 TGGCAGCAGGAGAGCAAGACGGG + Intergenic
1167250060 19:48394777-48394799 TGGCGGCAGCAGCGGCAGCCCGG - Intergenic
1168713942 19:58516521-58516543 TGGGAGCAGCAGAGGGAGCCGGG + Exonic
925325061 2:3012332-3012354 TGGCAGCTGCAGACCCAGGAAGG - Intergenic
926963903 2:18388626-18388648 TGGAAGCAACAGCACCAGGCTGG - Intergenic
926997476 2:18752328-18752350 TGTCAGCAGCAGCACGACCCTGG - Intergenic
927899340 2:26808042-26808064 GGGCAGCAGCAGAAGATGCCAGG + Intergenic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928403000 2:30992717-30992739 TGGCAGCAGATGGTCCAGCCCGG + Intronic
928404188 2:31002053-31002075 TGGTAACAGTATAACCAGCCTGG - Intronic
928593218 2:32838110-32838132 GGGCAGCAGCAGAACCAGCCTGG + Intergenic
929033007 2:37666216-37666238 GAGCAGCTGCAGGACCAGCCTGG - Intronic
929666835 2:43839923-43839945 TGGAAGGAGTAGAAGCAGCCAGG + Intronic
932102804 2:68916154-68916176 TGGCAGCACCAGAACAGGCAGGG + Intergenic
932740879 2:74290301-74290323 AGGCAGCAGCGGAAGCAGGCTGG - Intronic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933649627 2:84840112-84840134 TGGAAGCAGCAGCAGCAGGCAGG - Intronic
934058093 2:88269513-88269535 TGGCAGCAGCATGACAAGGCTGG - Intergenic
934169249 2:89325728-89325750 TGTCACCAGCAGAGCCAGTCAGG - Intergenic
934198044 2:89856856-89856878 TGTCACCAGCAGAGCCAGTCAGG + Intergenic
934937998 2:98479067-98479089 TGGCAGTAGCAGTACCACCCAGG - Intronic
935220504 2:101008294-101008316 AGGTAGCAGCAGAACCAGGGTGG + Intronic
935600233 2:104915005-104915027 AGGCAGCAGCAGACACAGCTGGG + Intergenic
936147067 2:109987243-109987265 TGGGAGCAGCAGAGGGAGCCGGG + Intergenic
936197625 2:110384240-110384262 TGGGAGCAGCAGAGGGAGCCGGG - Intergenic
937929622 2:127193849-127193871 TGGCAGCACTGGAAACAGCCTGG + Exonic
937997068 2:127702073-127702095 GGGCAGCAGCCCAACCAGCGCGG - Exonic
938141784 2:128800363-128800385 AGGCAACAGCAGAAGCAGCCAGG + Intergenic
938540064 2:132278456-132278478 TGGCAGCAGCTGATCGACCCTGG + Intergenic
940783649 2:157959354-157959376 TGGCTGGAGCTGAAGCAGCCGGG + Intronic
945922183 2:215766202-215766224 GGGCACCTGCAGAACCAGCATGG + Intergenic
946979697 2:225196051-225196073 TGGTTGCAGGAGAACCAGGCTGG + Intergenic
947209959 2:227699508-227699530 AGGCAGCAGCAGCACCAGGTAGG + Exonic
947642866 2:231716642-231716664 AGGCATGGGCAGAACCAGCCAGG + Intergenic
947876455 2:233470978-233471000 GGGCTGCTGCAGACCCAGCCCGG - Exonic
948163658 2:235844760-235844782 TTGGACCAGCAGGACCAGCCAGG - Intronic
948843986 2:240674525-240674547 TGGCAGCAGAAGCAGCAGCAGGG - Intergenic
948849826 2:240700110-240700132 TGGCAGCAGAAGCAGCAGCAGGG + Intergenic
1169065614 20:2692925-2692947 GAGCAGCAGCAGCAGCAGCCCGG - Exonic
1169072534 20:2742085-2742107 TTGCCGCTGCAGTACCAGCCTGG + Intronic
1169551439 20:6705565-6705587 TGGCAGCTGATGAACCAACCTGG + Intergenic
1170122631 20:12927079-12927101 GTACAGCATCAGAACCAGCCTGG + Intergenic
1171179347 20:23081199-23081221 GTTCAGCAGCAGAACAAGCCAGG - Exonic
1171210169 20:23310613-23310635 TGGGGGCAGCAGAGGCAGCCAGG - Intergenic
1171360089 20:24581455-24581477 TGAAAGCAGCAGAGCCAGGCTGG - Intronic
1171373144 20:24674520-24674542 TGGCAGAGGAAGAATCAGCCTGG + Intergenic
1172064570 20:32209924-32209946 TGGCAGCATAAGAACAAGTCTGG - Intronic
1172143930 20:32743315-32743337 ATGCAGCAGCTGAACCAGCTGGG - Exonic
1172476348 20:35241089-35241111 TGGAGGCAGCAGAAACAGCCTGG + Intronic
1173231410 20:41201924-41201946 TGGCAGCAGCATTAACCGCCTGG - Intronic
1175312999 20:58024680-58024702 TGGCAGCAGCTGCTCCAGACGGG + Intergenic
1175414949 20:58794992-58795014 CGTCAGCAGCTGACCCAGCCTGG - Intergenic
1175507491 20:59496117-59496139 TGGCAGAAGCTGGAGCAGCCAGG - Intergenic
1175794793 20:61764884-61764906 CGGCAGCAGCAGAAGCCTCCAGG - Intronic
1175813324 20:61870428-61870450 TGAAAGCAGCACAGCCAGCCTGG - Intronic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1175983669 20:62753789-62753811 TGGCAGCAGCAGAACCAGCCAGG - Intronic
1176009458 20:62884875-62884897 GGGAAGCAGGAAAACCAGCCGGG + Intronic
1176161601 20:63651504-63651526 TGGCACCATGAGAAGCAGCCTGG - Intronic
1176385896 21:6138434-6138456 GGGCAGCAGCAGTGCCAGGCTGG - Intergenic
1176418130 21:6491573-6491595 GGGCAGCAGCAGCTCCAGACTGG + Intergenic
1176521153 21:7825560-7825582 AGGCAGAAGCAGAAACGGCCAGG - Exonic
1176942240 21:14938860-14938882 TGCCAGCAGCAGAACAAAGCTGG - Intergenic
1177910265 21:27022532-27022554 AGGCATGAGCAGCACCAGCCTGG + Intergenic
1178319718 21:31596132-31596154 GGGCAGCAGCAGCGCCTGCCAGG + Intergenic
1178655173 21:34455572-34455594 AGGCAGAAGCAGAAACGGCCAGG - Intergenic
1179000126 21:37449979-37450001 TGGCAGCAGAGGACACAGCCAGG + Intronic
1179132570 21:38651823-38651845 GGGCAGCATCAGAACCAGGCAGG - Intronic
1179737577 21:43399818-43399840 GGGCAGCAGCAGTGCCAGGCTGG + Intergenic
1179959017 21:44758009-44758031 TGGCAGAAGCCCCACCAGCCTGG + Intergenic
1180008456 21:45034152-45034174 TGGCATCAGCAGAACCAGCATGG - Intergenic
1181348993 22:22241970-22241992 TGGAACCAGAAGAACCACCCAGG + Intergenic
1181499196 22:23306232-23306254 TGGCAGCATCAGTACCAGGTTGG + Intronic
1183045091 22:35212998-35213020 TGGCAGCATCAGAATCACCTGGG + Intergenic
1183211618 22:36454973-36454995 TGGGACCAGCGGAACAAGCCGGG - Intergenic
1183736907 22:39649373-39649395 TGGAACCAGCCGACCCAGCCTGG - Intronic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184157603 22:42678612-42678634 TGGCAGGAGCTGAAACAGCTGGG - Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1185269224 22:49921118-49921140 TGGGAGCAGCAGGGCCTGCCAGG - Intronic
949878224 3:8641061-8641083 TGGCAGAACCAGCCCCAGCCAGG - Intronic
950216639 3:11164397-11164419 TGGAAGCATCTAAACCAGCCTGG - Intronic
950505314 3:13391003-13391025 TGGGGGCTGCAGAAGCAGCCAGG + Intronic
950645541 3:14374542-14374564 TGGCAGCAGCTGCCCCTGCCAGG + Intergenic
952884690 3:38005284-38005306 TGGCTGCAGCAGAAGCAGTGAGG - Intronic
953473379 3:43185231-43185253 TGGGAGCAGCGGAACCTGCAAGG - Intergenic
954419870 3:50413115-50413137 TGGCAGCGGCAGCAGCAGCTGGG - Intronic
955799635 3:62672282-62672304 TTGCAGCATCAGCACCACCCAGG - Intronic
956912662 3:73835119-73835141 TGGCAGCAGCAGGCCCAGGTGGG - Intergenic
957482500 3:80816454-80816476 TCTCAGCAGCAGCACCAGCACGG - Intergenic
958528366 3:95291813-95291835 TGGCTGCAGCTGAAGCAGCTAGG - Intergenic
959949718 3:112165869-112165891 TGGCATCTGCAGAAGCAGGCAGG + Intronic
961311970 3:126008017-126008039 TTGCAGCAGCAGACCCTGCAGGG + Intronic
961531620 3:127543724-127543746 GGGCAGGAGCAGAAGCAGCAAGG + Intergenic
961566667 3:127768909-127768931 GAGCAGCAGCAGCACCACCCAGG - Intronic
962212741 3:133492313-133492335 TGGCAGCAGCTGCAGCAGCATGG - Intergenic
962343221 3:134602206-134602228 TGGCCACTGCAGAACCATCCTGG - Intronic
963148712 3:142021365-142021387 TGGCAGCTGCAGAAACATTCAGG - Intronic
964624577 3:158747059-158747081 TGGCAGCAACAGCACCACCTGGG - Intronic
965090440 3:164155593-164155615 TGGCAAAAGCAGAAGCAGCAGGG + Intergenic
965360825 3:167735610-167735632 GGGCAGCTGCAGAAACAGCAGGG + Intronic
966961727 3:184946467-184946489 TGGCAGCTTCATAACCAGCCTGG + Intronic
967984776 3:195086689-195086711 TGGAAGCAGCAAGACCAGGCAGG + Intronic
968143101 3:196274378-196274400 TGGCAGCAGCCCATCCAGACAGG + Intronic
968723180 4:2222802-2222824 TGGGAGCAGCTGCACCAGCTGGG - Intronic
968767503 4:2480788-2480810 TGGGAGCGGCAGGACCAACCTGG + Exonic
969296220 4:6271780-6271802 TGGCAGCTGAAGAACCAGCAGGG - Intronic
972543097 4:40056549-40056571 CGGAAGCAGCCGAACCGGCCGGG + Intergenic
972715794 4:41644667-41644689 TGGCAGCAGAAAATCCAGCCGGG + Intronic
973204062 4:47540376-47540398 TGGCAGCATCAGCAACACCCGGG + Intronic
973795998 4:54427406-54427428 TGACAGCAGCAGCAACAGACAGG + Intergenic
975044739 4:69787506-69787528 TGTCAGCACCACACCCAGCCTGG + Intronic
976066306 4:81191496-81191518 TGGGTGCAGCAAAACCAGCATGG + Intronic
976119352 4:81762674-81762696 AGGCAGCTGCAGAGTCAGCCAGG - Intronic
976596248 4:86897811-86897833 TGCCAGCCTGAGAACCAGCCAGG - Intronic
977493877 4:97749936-97749958 TGGCAGAAGCAAAACCTGTCTGG - Intronic
977855553 4:101886318-101886340 TGGCTGAAGCAGAAACAGCAAGG + Intronic
977978377 4:103293915-103293937 TGGCAGCAGCAGGAACAACAGGG + Intergenic
978081408 4:104596877-104596899 TAGCAGCAGCAGTGACAGCCAGG - Intergenic
979310624 4:119198775-119198797 TGCCAGCAACAGAACCAAGCTGG + Intronic
980792032 4:137632457-137632479 TGCCAGCAGCAGCAGCAGCATGG - Intergenic
982883374 4:160747480-160747502 TGCCAGCAGCAGAACAAAGCTGG + Intergenic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
983305621 4:165981739-165981761 TGGTAGCAACAAAACCACCCAGG - Intronic
983388960 4:167103439-167103461 TGGGAGCATCAGCACTAGCCTGG + Intronic
984856593 4:184200836-184200858 TGTCTGCAGCAGAACAACCCAGG - Intronic
984953583 4:185024120-185024142 TGGCAGCAGCAGACCATGCCTGG + Intergenic
986297048 5:6448621-6448643 TGGCAGCAGCAGCAGCACCCCGG + Exonic
986315939 5:6586402-6586424 AGCCAGCATCACAACCAGCCTGG + Intergenic
986456756 5:7927613-7927635 TGGCAGCATCAGCAGCAGCCAGG + Intergenic
989565962 5:42901561-42901583 AGACAGCAGCTGAACCACCCTGG + Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
992260462 5:74965557-74965579 AGGCAGCATCAGAACCAACAGGG - Intergenic
992411041 5:76505372-76505394 TGGTAGCAGCAGAAAGAGCCTGG - Intronic
992917192 5:81468916-81468938 TGGCAGCAGCAGTACTAGCAAGG + Intronic
993546720 5:89221022-89221044 TGCCAGCAGCAGAACAAAGCTGG + Intergenic
993900280 5:93580082-93580104 CGGCACCAGCAGGAACAGCCGGG + Intergenic
994197442 5:96935977-96935999 TGGCAGCTGCAGAAAGAGCGAGG - Exonic
996012576 5:118497491-118497513 TGCCAGCAGCAGGACTTGCCAGG + Intergenic
997800526 5:136856404-136856426 TGGCAGAAGCAGAACAAGATGGG + Intergenic
997887270 5:137641412-137641434 TGGCAGCAGCAGCAGCACCTGGG - Intronic
998774950 5:145588781-145588803 AGGCAGCACCAGCAGCAGCCAGG + Intronic
999103204 5:149044916-149044938 CGGCAGCAGCAAAAGAAGCCAGG + Intronic
999868927 5:155729681-155729703 TAGAAGCAGCAGAGGCAGCCCGG - Intergenic
999887324 5:155937288-155937310 TGGCAGCAGCTGCTCCAGGCAGG + Intronic
1001319943 5:170672284-170672306 TGGCAGCTGCAGAGACAGCATGG + Intronic
1001686179 5:173596616-173596638 TGCCAGCAGAGGAACCAGCAAGG - Intergenic
1001766066 5:174248110-174248132 CGGCAGCATCAGGATCAGCCTGG + Intergenic
1002310585 5:178311360-178311382 TGGCAGCAGACACACCAGCCTGG + Intronic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1004418648 6:15447828-15447850 TGGCAGGAGCAGCAGAAGCCTGG - Intronic
1005215197 6:23518513-23518535 TGGCAGCAGGAGCACCAGGCGGG - Intergenic
1005896298 6:30182062-30182084 TGGCGGCAGCAGCCCCAGCCAGG + Intergenic
1005898129 6:30195703-30195725 TGTCAGCAGCAGAGCCACCCAGG - Intronic
1006599724 6:35217366-35217388 TGGCTCCAGGAGAGCCAGCCTGG + Intronic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007241798 6:40431892-40431914 TGGCTCCAGCAAGACCAGCCGGG - Exonic
1007350748 6:41271936-41271958 GAGCAGCAGCAGCAGCAGCCAGG + Intronic
1007490543 6:42218008-42218030 TGGCCGGAGCCAAACCAGCCTGG - Intergenic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1008301940 6:49851625-49851647 TGGCAGCATCAGCATCAGCTGGG + Intronic
1008403555 6:51093186-51093208 TGGGTGCATCAAAACCAGCCTGG + Intergenic
1009396215 6:63203588-63203610 TGTCAGCAGCTGTACCATCCTGG + Intergenic
1010184324 6:73125400-73125422 TGGCAGAGGCAGAACCAGCAAGG + Intronic
1013285219 6:108675406-108675428 AGGCAGCAGGTGAACCAGTCTGG - Intronic
1014342951 6:120231142-120231164 AGGCAGCAGGAGAGACAGCCAGG - Intergenic
1014461731 6:121704033-121704055 TGCCAGCAACAGAACAAACCTGG + Intergenic
1014618614 6:123636898-123636920 AAGAAGCAGCAGAAACAGCCAGG - Exonic
1015383672 6:132598593-132598615 TGGCAGCAGCACAGCCTGCTAGG - Intergenic
1015919803 6:138255511-138255533 CAGCAGCACCAGTACCAGCCTGG + Exonic
1017175062 6:151494568-151494590 TGGCAGGAGGAGGGCCAGCCCGG + Intronic
1017510852 6:155113173-155113195 TGGCCGCAGCAGAGCAAGCGAGG - Intronic
1017647683 6:156554256-156554278 TGGAAGCAGATGCACCAGCCAGG - Intergenic
1019073704 6:169370203-169370225 AGGCAGCAGCAGAACTTGGCTGG + Intergenic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019559937 7:1650941-1650963 TGGCTGGGGCCGAACCAGCCTGG - Intergenic
1019613859 7:1949986-1950008 TGGCAGCAGCAGGGACAGGCTGG + Intronic
1019666252 7:2253603-2253625 AGGCAGCAGCAGAACCCACAGGG + Exonic
1020724258 7:11789401-11789423 TGGAAGAAGGAAAACCAGCCAGG + Intronic
1020887850 7:13841796-13841818 TGACAGCATCAGAACCACCTGGG + Intergenic
1021653212 7:22851410-22851432 TAACAGCAGCAAAACAAGCCAGG + Intergenic
1022538214 7:31111369-31111391 TGGCAGCAGCAGTAGCAGTAAGG - Exonic
1022793616 7:33714378-33714400 GGGCTGCAGCAGAAAGAGCCTGG - Intergenic
1023856629 7:44188211-44188233 TGCCAGAAGCACAGCCAGCCCGG + Intronic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1025834847 7:65085045-65085067 GGCCAGCAGCACAACCAGCCAGG - Intergenic
1025904619 7:65774524-65774546 GGCCAGCAGCACAACCAGCCAGG - Intergenic
1026058312 7:67004488-67004510 TGCCAGGAGTAGAAGCAGCCTGG + Intronic
1026457198 7:70583105-70583127 GGGCAGCAGGAAGACCAGCCAGG - Intronic
1026719778 7:72820538-72820560 TGCCAGGAGTAGAAGCAGCCTGG - Intronic
1027628586 7:80574946-80574968 TGGCAGCTGCAGCAGCAGCAGGG + Intronic
1028413185 7:90552953-90552975 TGGCAGCAGCAAAATTGGCCAGG + Intronic
1028845318 7:95473483-95473505 TAGCAGCTGCACACCCAGCCAGG - Intergenic
1029193642 7:98789168-98789190 TGATAGCAGCACAGCCAGCCAGG - Intergenic
1031035547 7:116784525-116784547 TGGCAGGAGCAGGACCAACGGGG + Intronic
1031500619 7:122510646-122510668 TGGCAGCGGCAGACACAGCAGGG + Intronic
1031987387 7:128171945-128171967 TGGCAGCAGGAGAGCTTGCCAGG - Intergenic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1033713417 7:143974171-143974193 TGTCAGCTTCAGAACAAGCCAGG + Intergenic
1033947808 7:146743787-146743809 TGGCAGAAACAGAAACAGCCTGG + Intronic
1034466711 7:151234025-151234047 TGGCCGCAGCAGAGCCAACAGGG - Exonic
1034516716 7:151586720-151586742 TGACATCAGCAGCATCAGCCTGG + Intronic
1034549441 7:151810957-151810979 TGGCAGTAGCAGAACCACCATGG + Intronic
1034666512 7:152822506-152822528 TCGCAGCAGCAGCAGCATCCTGG + Intronic
1035287642 7:157816426-157816448 TGGCAGAGGCCGAGCCAGCCTGG + Intronic
1036088664 8:5640646-5640668 TGGAGGCACAAGAACCAGCCAGG - Intergenic
1036733755 8:11288835-11288857 TGGAAGCAGCAGGCCCAGCTTGG + Intronic
1038429258 8:27486551-27486573 GGGCAGCAGCAGCAGCGGCCAGG - Intergenic
1039449674 8:37662034-37662056 TAGAAGCAGCAAGACCAGCCAGG + Intergenic
1039476573 8:37842031-37842053 GGGCAGCAGCCGCAACAGCCCGG + Exonic
1039821823 8:41141685-41141707 GGACAGTATCAGAACCAGCCCGG - Intergenic
1040563715 8:48547208-48547230 TTGCAGCAGGAGCTCCAGCCTGG - Intergenic
1041554289 8:59135324-59135346 AGGCACCTGCAGAAGCAGCCAGG - Intergenic
1042638498 8:70905647-70905669 TGCCAGCAGCAGAACAAAGCTGG - Intergenic
1042951441 8:74204227-74204249 TGGCAGCAGCTGCAGCAGCCAGG + Intergenic
1043735167 8:83731588-83731610 TGGCAGCAGCCGCTCCAGGCAGG + Intergenic
1043837042 8:85060231-85060253 TCTCAGCAGTAGAACCACCCAGG - Intergenic
1043886056 8:85601992-85602014 TAGCAGCAACAAAAGCAGCCAGG + Intergenic
1045248040 8:100460320-100460342 TGGCTGGAGCAGAAGCAGCTGGG - Intergenic
1045782725 8:105886677-105886699 TGGCAGCAGCTGCTCCAGACGGG - Intergenic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1047493074 8:125390225-125390247 TGGCAGCGGCAGCAGCAGCGTGG - Intergenic
1047812421 8:128425079-128425101 AGACATCATCAGAACCAGCCAGG + Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1049222220 8:141433365-141433387 GGCTAGCAGCAGAACCAGCCAGG - Intergenic
1049237267 8:141518587-141518609 GGGCAGCAGCAGGACGAGGCCGG - Exonic
1049245355 8:141559549-141559571 TGGCCACAGCAGGACCAGTCAGG + Intergenic
1049372728 8:142275429-142275451 TGGCTGCAGCAGTGCCACCCAGG + Intronic
1049549799 8:143251934-143251956 GGCCAGCAGCAGGAGCAGCCGGG - Intronic
1050116778 9:2271607-2271629 TGGCAGCCAAAGAAACAGCCCGG + Intergenic
1050733423 9:8735508-8735530 TGGCAGCATCAGCATCACCCAGG - Intronic
1051196244 9:14565347-14565369 TGGCTGCAGCAGAATCACCAGGG + Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1053305379 9:36980980-36981002 TGGCAGGAGCAGAATAAGCGGGG - Intronic
1053511271 9:38689739-38689761 CGGCAGCAGCAGCAACAGCAGGG - Intergenic
1053753473 9:41279260-41279282 TGGCAGGAGCAGAGGGAGCCTGG + Intergenic
1054160638 9:61670313-61670335 TGGCTGCAGCAGGAGCATCCCGG - Intergenic
1054258995 9:62843623-62843645 TGGCAGGAGCAGAGCGAGCCTGG + Intergenic
1054332782 9:63776417-63776439 TGGCAGGAGCAGAGGGAGCCTGG - Intergenic
1054437419 9:65225348-65225370 GAGCAGCAGCAGAAGCTGCCAGG + Intergenic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1056796175 9:89660296-89660318 TGGAGGCAGCAAGACCAGCCAGG - Intergenic
1056882082 9:90404845-90404867 TGGAAGCAGCAGGGTCAGCCCGG - Intergenic
1057998726 9:99844088-99844110 TGGCAGCATCAGCAACACCCAGG - Intronic
1058863894 9:109144126-109144148 AGGCAGCAGGAGAAACAGCAGGG - Intronic
1060759240 9:126234378-126234400 ACGCCGCAGCAGAGCCAGCCAGG + Intergenic
1060868817 9:127022613-127022635 TGGCTGGAGCAGAAGGAGCCTGG - Intronic
1061304548 9:129724789-129724811 CGGCACCAGGAGATCCAGCCCGG - Intergenic
1062285323 9:135770218-135770240 GGGCACCTGCAGACCCAGCCGGG + Intronic
1186171573 X:6882773-6882795 TGGAAGCAGAAGGAGCAGCCGGG + Intergenic
1187213256 X:17250309-17250331 AGGGAGCAGCTGAACCAGGCTGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189481519 X:41395651-41395673 AGGCAGCACCAGAACCCGGCAGG + Intergenic
1189712530 X:43828003-43828025 TAGCAGCAGCACAACTATCCTGG + Intronic
1190056044 X:47181568-47181590 TGCCAGGAGCAGCACCAGGCTGG - Exonic
1191083490 X:56538488-56538510 TGCAATCAGCAGAGCCAGCCAGG - Intergenic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191920116 X:66246605-66246627 TGGGAACAGCAGAATCACCCTGG - Intronic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1194265177 X:91744228-91744250 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1195122879 X:101774672-101774694 TGGCACCTGCAGACCCACCCAGG - Intergenic
1196399464 X:115299335-115299357 AGCCAGTAGCAAAACCAGCCAGG + Intronic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197141559 X:123122467-123122489 TGTCAGCAGCAGCAGCAGCTTGG - Intergenic
1198113746 X:133525011-133525033 TGTGAGCCTCAGAACCAGCCTGG + Intergenic
1198233583 X:134716022-134716044 GGGCAGCAGCAGGCCCAGCTGGG + Intronic
1199467242 X:148152515-148152537 TGGCAGCAGCAAAAGCAGGAAGG - Intergenic
1200449581 Y:3308549-3308571 TGGCAGGAGCAGGACCAAGCTGG - Intergenic
1200582329 Y:4964674-4964696 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1200705035 Y:6435441-6435463 AGGCAGCATCAGAAGCTGCCAGG - Intergenic
1201029076 Y:9729267-9729289 AGGCAGCATCAGAAGCTGCCAGG + Intergenic
1202179228 Y:22125394-22125416 AGGCAGCCTCAGAAGCAGCCAGG - Intergenic
1202212133 Y:22461000-22461022 AGGCAGCCTCAGAAGCAGCCAGG + Intergenic