ID: 1175987981

View in Genome Browser
Species Human (GRCh38)
Location 20:62773630-62773652
Sequence GCGTTTTTTCCCAGCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175987981_1175987985 9 Left 1175987981 20:62773630-62773652 CCAGGGTGGCTGGGAAAAAACGC No data
Right 1175987985 20:62773662-62773684 CTGAGCATTCGTTTCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175987981 Original CRISPR GCGTTTTTTCCCAGCCACCC TGG (reversed) Intergenic
No off target data available for this crispr