ID: 1175991007

View in Genome Browser
Species Human (GRCh38)
Location 20:62789120-62789142
Sequence CTCCCAGGGGGCCACGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175990996_1175991007 13 Left 1175990996 20:62789084-62789106 CCTGAAGAAGATGATTCCTGCCA No data
Right 1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG No data
1175990998_1175991007 -7 Left 1175990998 20:62789104-62789126 CCATGCCTGCAGAAAACTCCCAG No data
Right 1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG No data
1175990997_1175991007 -3 Left 1175990997 20:62789100-62789122 CCTGCCATGCCTGCAGAAAACTC No data
Right 1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG No data
1175990995_1175991007 18 Left 1175990995 20:62789079-62789101 CCTCTCCTGAAGAAGATGATTCC No data
Right 1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175991007 Original CRISPR CTCCCAGGGGGCCACGGGAA GGG Intergenic
No off target data available for this crispr