ID: 1175991766

View in Genome Browser
Species Human (GRCh38)
Location 20:62793419-62793441
Sequence GCCAAGCGTGTGTCTCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175991754_1175991766 25 Left 1175991754 20:62793371-62793393 CCTGCCCAGGTTCCCACTGGAGC No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991763_1175991766 -8 Left 1175991763 20:62793404-62793426 CCCCGGCTGGGATGAGCCAAGCG No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991765_1175991766 -10 Left 1175991765 20:62793406-62793428 CCGGCTGGGATGAGCCAAGCGTG No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991758_1175991766 13 Left 1175991758 20:62793383-62793405 CCCACTGGAGCAGGCAGACAGCC No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991764_1175991766 -9 Left 1175991764 20:62793405-62793427 CCCGGCTGGGATGAGCCAAGCGT No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991752_1175991766 27 Left 1175991752 20:62793369-62793391 CCCCTGCCCAGGTTCCCACTGGA No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991759_1175991766 12 Left 1175991759 20:62793384-62793406 CCACTGGAGCAGGCAGACAGCCC No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991757_1175991766 20 Left 1175991757 20:62793376-62793398 CCAGGTTCCCACTGGAGCAGGCA No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991756_1175991766 21 Left 1175991756 20:62793375-62793397 CCCAGGTTCCCACTGGAGCAGGC No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data
1175991753_1175991766 26 Left 1175991753 20:62793370-62793392 CCCTGCCCAGGTTCCCACTGGAG No data
Right 1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175991766 Original CRISPR GCCAAGCGTGTGTCTCCATG TGG Intergenic