ID: 1175992192

View in Genome Browser
Species Human (GRCh38)
Location 20:62795195-62795217
Sequence AACGCGAGTCACTGCGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175992192_1175992197 1 Left 1175992192 20:62795195-62795217 CCCCATCCGCAGTGACTCGCGTT No data
Right 1175992197 20:62795219-62795241 CCCTCCCCCTCCCCCGTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175992192 Original CRISPR AACGCGAGTCACTGCGGATG GGG (reversed) Intergenic
No off target data available for this crispr