ID: 1175994284

View in Genome Browser
Species Human (GRCh38)
Location 20:62805274-62805296
Sequence CGCGCCCGAGGCACCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175994284_1175994289 -2 Left 1175994284 20:62805274-62805296 CCCCCGGGGGTGCCTCGGGCGCG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1175994289 20:62805295-62805317 CGTCCCGCCCCCAGCCGCCGTGG 0: 1
1: 0
2: 2
3: 22
4: 258
1175994284_1175994304 29 Left 1175994284 20:62805274-62805296 CCCCCGGGGGTGCCTCGGGCGCG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1175994304 20:62805326-62805348 GATGGAACCCCTCCCGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 80
1175994284_1175994296 11 Left 1175994284 20:62805274-62805296 CCCCCGGGGGTGCCTCGGGCGCG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1175994296 20:62805308-62805330 GCCGCCGTGGCCGCCCCTGATGG 0: 1
1: 0
2: 1
3: 11
4: 202
1175994284_1175994303 28 Left 1175994284 20:62805274-62805296 CCCCCGGGGGTGCCTCGGGCGCG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1175994303 20:62805325-62805347 TGATGGAACCCCTCCCGCCTCGG 0: 1
1: 0
2: 0
3: 16
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175994284 Original CRISPR CGCGCCCGAGGCACCCCCGG GGG (reversed) Intronic
901633387 1:10658691-10658713 AGTGTCCGAGGCACCCACGGTGG + Intronic
902368614 1:15992331-15992353 CCCTCCCGAGTCACCCCCTGGGG + Intergenic
902392136 1:16112974-16112996 CGTGCCTGAGCCACCCCTGGGGG + Intergenic
903738415 1:25544370-25544392 CTCTCCCGAGGCACCCCAGGCGG - Intronic
905308400 1:37034118-37034140 CGCGCCCCGGGCACGCTCGGCGG - Exonic
910549739 1:88462728-88462750 GGCGCCCGCGGCAGCCCCAGCGG - Intergenic
920013682 1:202888688-202888710 CGCGCTCGAAGCCCCCCCGGGGG + Intronic
922250643 1:223846006-223846028 CCCGCCCGCGGCGCGCCCGGCGG + Intergenic
923148092 1:231211567-231211589 CCCGCCCCGGGCACCCTCGGGGG + Intronic
923163381 1:231337299-231337321 GTCGCGGGAGGCACCCCCGGGGG + Exonic
923372557 1:233327962-233327984 CGCGCCCGCGGCCGCCCGGGAGG + Exonic
1074130389 10:110568164-110568186 CCCGCCCGCGGCCGCCCCGGCGG - Intronic
1076793238 10:132787428-132787450 CGCGCTCGGGGCTGCCCCGGCGG + Intergenic
1076935430 10:133565544-133565566 CCCTCCCGAGGCACCCTCGCTGG - Exonic
1077250071 11:1557028-1557050 CGCGCCCACGGCCCCGCCGGCGG - Exonic
1077361837 11:2144325-2144347 CGCGGCCGAGCCGCCACCGGGGG + Intronic
1077361854 11:2144372-2144394 GGGGCCCGGAGCACCCCCGGTGG + Intronic
1077463590 11:2722972-2722994 CTGCCCCGAGGCACCCCAGGTGG - Intronic
1077535470 11:3122100-3122122 TGGGCCCGGGGCACCCGCGGTGG + Intronic
1083922064 11:65786584-65786606 CGCGCCCGAGGCTCCTGGGGAGG - Intergenic
1083941583 11:65899306-65899328 CGGGTCCGAGGCACCGCCGGCGG + Intronic
1084179391 11:67438889-67438911 CGGGCCCGAGGCAGCCCTGGAGG - Exonic
1085396674 11:76210095-76210117 CATGCCCGAGCCACCCCCGGGGG - Intronic
1089347068 11:117797293-117797315 CCCCCCCGCGGCACCCCGGGTGG + Intronic
1093894674 12:24562723-24562745 CGCCCCCGCCGCACCCCCCGGGG - Intergenic
1102470850 12:113159073-113159095 CACGCCCCAGGCACCCCTGCAGG - Exonic
1104966269 12:132509992-132510014 TGCGCCCCAGGCAGCCCCAGCGG + Intronic
1112570347 13:100588491-100588513 CGCGCCCGTGGCCCCCGCGCGGG + Intronic
1115269503 14:31536211-31536233 CGGGCCTTAGGCACCCCTGGGGG + Intronic
1122542746 14:102507152-102507174 CGAGCCGGCGGCACCCACGGGGG + Exonic
1122798040 14:104216203-104216225 CGAGCCCCAGGCACCCCAAGGGG - Intergenic
1131257561 15:90872046-90872068 CGAGCCGGCGGCAGCCCCGGTGG - Intronic
1132690263 16:1178900-1178922 CGCGCCCTTGCCAGCCCCGGAGG + Intronic
1132932871 16:2467817-2467839 CGCGCTCGAGCCTCCCCCAGCGG + Intergenic
1132994746 16:2817200-2817222 CGGGCCCGGGGCGCCCCCTGGGG - Intronic
1133199207 16:4192230-4192252 CGAGCCCGAGGCTACCCAGGAGG + Exonic
1133324824 16:4936362-4936384 CGCGCCAGAGCCGCGCCCGGAGG - Intronic
1135296501 16:21283809-21283831 CCCGCCAGAGGCACACCAGGAGG - Intronic
1143503449 17:7351746-7351768 CGCGCCCGGGCCACCCCGGCTGG + Intergenic
1144830093 17:18126452-18126474 CGCCCCCGAGACACTCACGGGGG - Exonic
1147189377 17:38730081-38730103 GGCGCCTGGGGCACCCCCGAGGG - Intergenic
1148108611 17:45132356-45132378 CCCGCCCGAGGAGCCCCCGGTGG - Exonic
1148579377 17:48733222-48733244 CGCGGCCGCCGCGCCCCCGGGGG + Intergenic
1149685424 17:58531999-58532021 AGCGCCCGAGCGACCCGCGGCGG + Intronic
1160454634 18:78992246-78992268 CGCGCCCGCGCCGCCCCCCGAGG + Exonic
1161939833 19:7395335-7395357 GAGGCCCGAGGCAGCCCCGGGGG - Intronic
1162128503 19:8511815-8511837 CGCGCCGGAGCGCCCCCCGGAGG - Exonic
1163606970 19:18280969-18280991 CGTGCCCGAGGGCCCCCCGGCGG + Exonic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166831489 19:45642169-45642191 CGCGCGCGGGGCACCCCCAAGGG - Exonic
1167056215 19:47112842-47112864 CCCCCCCCACGCACCCCCGGGGG + Intronic
1168103406 19:54153011-54153033 GGGGCCCGAGGCTGCCCCGGGGG - Intronic
932112342 2:69012973-69012995 CGCCCCCGACGCACTCCCGCGGG + Intergenic
934797354 2:97113061-97113083 CGCGCCTCCTGCACCCCCGGCGG - Intergenic
935997128 2:108786706-108786728 CCCCCCCGAGGCACGCACGGCGG - Intergenic
946327883 2:218993994-218994016 CGGGCCCGAGGACACCCCGGGGG - Intergenic
948463882 2:238143097-238143119 GGAGCCCGAGGTACCCCGGGAGG + Intronic
1170847602 20:19975222-19975244 CCCGCCTGAGGCCGCCCCGGGGG + Exonic
1175994284 20:62805274-62805296 CGCGCCCGAGGCACCCCCGGGGG - Intronic
1175999142 20:62824356-62824378 AGCGCCCGCGGGACCCCAGGAGG - Intronic
1180045037 21:45301360-45301382 CGCCCCTGAGGCTCCCCAGGTGG + Intergenic
1180187246 21:46145836-46145858 CGCCACCGAGCCGCCCCCGGGGG + Exonic
1181312529 22:21952881-21952903 GGCGCCCGCGGCGCCCGCGGCGG - Intergenic
1181381578 22:22508713-22508735 CGCTCCCGGGGCACAGCCGGCGG + Exonic
1183309842 22:37103390-37103412 CGTGGCCGAGGCCCCCCAGGTGG - Exonic
1183441384 22:37825001-37825023 CGCGCCCGCGGGACCCACGGCGG - Exonic
1185015861 22:48342204-48342226 GGCAGCTGAGGCACCCCCGGGGG + Intergenic
1185161998 22:49235666-49235688 CTCGCCGGAGGCAGCCCCGCGGG + Intergenic
950282545 3:11719957-11719979 CGCCCCCGAGGCCCCGCCAGGGG + Intronic
952356937 3:32593189-32593211 GGCGCCCGAGGCAGCCTCGAGGG + Intergenic
954146089 3:48635062-48635084 CGTGCCCCACGCACCCCCGCCGG + Intronic
954400858 3:50318823-50318845 CCCACCCGAGGCATCCCTGGTGG - Intronic
968008929 3:195260445-195260467 CGTGCCCGAGGCTGCCCAGGGGG - Intronic
968662094 4:1802862-1802884 CGCCCCCGAGGCAGCCCCGCCGG - Intronic
973635934 4:52862188-52862210 CGCGCGCGCGACGCCCCCGGAGG - Intergenic
974016878 4:56656121-56656143 CGCGGCCGTGGCACCGCTGGAGG - Intronic
977693930 4:99946770-99946792 CGCGCCCTAGGGGCCCGCGGGGG - Intergenic
982157502 4:152536216-152536238 CGCGCCAGAGGCGCCCAGGGCGG - Intergenic
984734554 4:183098291-183098313 CACGCCGGAGGGACCCACGGCGG - Intergenic
989565169 5:42894455-42894477 GGAGCCCGAGGCACCCCAGTGGG + Intergenic
997718248 5:136058015-136058037 CAGGCCTGAGGCACCCCTGGGGG + Intronic
1000463523 5:161548832-161548854 GGCGCCCGAGGAGCCCGCGGCGG + Intronic
1002580894 5:180208995-180209017 CGCGGCCGAGGGACACCTGGCGG - Intronic
1006677741 6:35776522-35776544 GGCGCCCCAGGCCACCCCGGCGG - Intergenic
1013512715 6:110859066-110859088 CGCGCCCGAGGGAGCCCTGTCGG - Intronic
1013619328 6:111873027-111873049 CGCGGCCGAGGCGGCTCCGGGGG + Exonic
1019580470 7:1759388-1759410 GGCGCTCCAGGCACCCGCGGTGG - Intergenic
1020037663 7:4974439-4974461 CGGGCCCGAGGCCGCCGCGGAGG + Intergenic
1020162155 7:5781185-5781207 CGGGCCCGAGGCCGCCGCGGAGG - Intronic
1026874651 7:73872234-73872256 TGTGCCCGAGGCATCCCAGGAGG - Intergenic
1029715136 7:102321558-102321580 CGCCGCCGAGGAGCCCCCGGAGG + Exonic
1031372886 7:120988719-120988741 CGCGCCCGCTGCACGCCCGGCGG - Exonic
1032525730 7:132577184-132577206 CGCGCCCCCGGCCCCCCGGGCGG + Exonic
1033099842 7:138460604-138460626 CGCCGCCGAGGGCCCCCCGGAGG - Exonic
1034343521 7:150372258-150372280 CGCGGCCGAGCCCACCCCGGCGG + Exonic
1035292789 7:157850322-157850344 CGAGCCTGAGGCACCCACGTCGG - Intronic
1035728268 8:1838143-1838165 GGCACCCCCGGCACCCCCGGTGG - Intronic
1037809930 8:22081164-22081186 CGCATCCGATCCACCCCCGGTGG - Exonic
1039875126 8:41578430-41578452 CGCGCCCCGGGGATCCCCGGCGG + Intronic
1042591579 8:70402989-70403011 CGGGCCCGTGTCAGCCCCGGGGG - Intronic
1045305130 8:100951649-100951671 GGCGCCCTACCCACCCCCGGGGG + Intronic
1049565239 8:143334769-143334791 CGAGCCCGGGACACCCCGGGAGG + Exonic
1056539198 9:87556880-87556902 CACGCCCAAGGCAGCCCAGGAGG - Intronic
1061128198 9:128689721-128689743 CGCGCCCCGGGCCCCGCCGGCGG - Intronic
1061502016 9:131009402-131009424 CGCGCCCGCGGCGCCCACGTGGG - Exonic
1062357687 9:136172634-136172656 AGCGCCTGACGCACCCCAGGAGG + Intergenic
1062567534 9:137169956-137169978 CCCGCCCCCGGCACCCGCGGTGG + Exonic
1062574574 9:137200249-137200271 CGCGCTCGGGGCTCCCGCGGCGG + Exonic
1185610143 X:1389464-1389486 CGCGCCGGCCGCACCGCCGGAGG + Exonic
1188451104 X:30308859-30308881 AGCGCCCGAGGCACGGCCAGGGG - Exonic
1189821594 X:44873839-44873861 CGAGCCCGAGGCCCCAGCGGAGG - Intronic
1200068811 X:153517903-153517925 CGCGCCCGCGCCCACCCCGGCGG - Intronic
1200080348 X:153573139-153573161 CGGCCCGGAGGGACCCCCGGTGG - Intronic