ID: 1175995695

View in Genome Browser
Species Human (GRCh38)
Location 20:62811413-62811435
Sequence AGGCACCATCCCTGAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 354}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175995695_1175995701 4 Left 1175995695 20:62811413-62811435 CCGGGGCTTCAGGGATGGTGCCT 0: 1
1: 0
2: 3
3: 39
4: 354
Right 1175995701 20:62811440-62811462 TCTCCAAGGGGGTCTTTTCCAGG 0: 1
1: 0
2: 2
3: 12
4: 149
1175995695_1175995696 -10 Left 1175995695 20:62811413-62811435 CCGGGGCTTCAGGGATGGTGCCT 0: 1
1: 0
2: 3
3: 39
4: 354
Right 1175995696 20:62811426-62811448 GATGGTGCCTGAGCTCTCCAAGG 0: 1
1: 0
2: 6
3: 36
4: 196
1175995695_1175995704 22 Left 1175995695 20:62811413-62811435 CCGGGGCTTCAGGGATGGTGCCT 0: 1
1: 0
2: 3
3: 39
4: 354
Right 1175995704 20:62811458-62811480 CCAGGTGTTTAAAAGCTCCCAGG 0: 1
1: 0
2: 1
3: 33
4: 678
1175995695_1175995697 -9 Left 1175995695 20:62811413-62811435 CCGGGGCTTCAGGGATGGTGCCT 0: 1
1: 0
2: 3
3: 39
4: 354
Right 1175995697 20:62811427-62811449 ATGGTGCCTGAGCTCTCCAAGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1175995695_1175995698 -8 Left 1175995695 20:62811413-62811435 CCGGGGCTTCAGGGATGGTGCCT 0: 1
1: 0
2: 3
3: 39
4: 354
Right 1175995698 20:62811428-62811450 TGGTGCCTGAGCTCTCCAAGGGG 0: 1
1: 0
2: 3
3: 19
4: 222
1175995695_1175995699 -7 Left 1175995695 20:62811413-62811435 CCGGGGCTTCAGGGATGGTGCCT 0: 1
1: 0
2: 3
3: 39
4: 354
Right 1175995699 20:62811429-62811451 GGTGCCTGAGCTCTCCAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175995695 Original CRISPR AGGCACCATCCCTGAAGCCC CGG (reversed) Intronic
900609868 1:3539979-3540001 AGGCAGCAGCCCAGAAGGCCTGG - Intronic
901011632 1:6205869-6205891 TGGCACCGTCCCTGGAGCCTTGG + Intronic
901345478 1:8536973-8536995 AGGGAGGATCGCTGAAGCCCAGG + Intronic
902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG + Intronic
902410556 1:16209137-16209159 AGCCACCACCCCTGGAGGCCTGG + Intronic
902573391 1:17361157-17361179 AGGCACCACCCCGGAGCCCCAGG - Intronic
903071110 1:20727346-20727368 GGGCCCCATCCCTTATGCCCTGG - Intronic
903287298 1:22285207-22285229 AGGCACCAGCCCTGACGATCCGG - Intergenic
903610363 1:24607085-24607107 AGGGAGCATCCCTTGAGCCCAGG - Exonic
904513096 1:31030459-31030481 AGGCAAGATCACTAAAGCCCAGG + Intronic
907285410 1:53376583-53376605 AGGCTTCGTCCCTGAAGTCCAGG - Intergenic
907563488 1:55412707-55412729 AAGCACAGTCACTGAAGCCCAGG + Intergenic
912666431 1:111584424-111584446 AGGCACCATCTATGAAGAACCGG - Intronic
913382804 1:118229211-118229233 AGGCAATATCCCTTAAGGCCTGG + Intergenic
913551509 1:119921251-119921273 AGGCTCCATACCTTGAGCCCAGG - Intronic
914703990 1:150156862-150156884 AGGCACCACCTCTAAAACCCTGG + Intronic
915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG + Intergenic
916021604 1:160797250-160797272 CACCATCATCCCTGAAGCCCTGG - Intronic
916207831 1:162332427-162332449 AGGCACTATCCCAGCAGCCAGGG - Intronic
916558694 1:165914554-165914576 AGGATCCATCCCTTCAGCCCAGG - Intergenic
916799525 1:168203469-168203491 AAGCCACATCCCTGAAGGCCAGG + Intergenic
917656477 1:177131121-177131143 AGGCACATTCACTGTAGCCCAGG - Intronic
918539088 1:185607837-185607859 TGGCACCATTCCTGAAGTCAAGG + Intergenic
919314269 1:195951636-195951658 TGGAAGCATCCCTGGAGCCCTGG - Intergenic
919887643 1:201946516-201946538 CAGCAGCCTCCCTGAAGCCCAGG + Exonic
921460239 1:215416499-215416521 AGGCACCAGCTGTGTAGCCCTGG - Intergenic
921462744 1:215448145-215448167 AGGCACCAGCTGTGTAGCCCTGG + Intergenic
921587052 1:216959592-216959614 CAGCAGGATCCCTGAAGCCCAGG + Intronic
922696072 1:227731726-227731748 AGGCACAGTCCCTCAGGCCCAGG + Exonic
922994047 1:229941881-229941903 AAGCAGCATACCTGAACCCCCGG + Intergenic
924906101 1:248453831-248453853 AGTCACCACCCCTGATGCTCTGG - Intergenic
924921088 1:248629729-248629751 AGCCACCGTCGCTGCAGCCCAGG - Intergenic
924921789 1:248638206-248638228 AGTCACCACCCCTGATGCTCTGG + Intergenic
1063940410 10:11122905-11122927 AGGGAGCTTCCCTCAAGCCCTGG - Intronic
1064180928 10:13113828-13113850 AGGCAGGATCCCTTGAGCCCAGG + Intronic
1066207813 10:33207128-33207150 AGGCAACTTCCCTCAACCCCTGG - Intronic
1067415460 10:46098514-46098536 AGGCACCAGCTCAGAAGCCAGGG + Intergenic
1067558644 10:47289273-47289295 AGGCACCACCCCTGAAAGCTGGG + Intergenic
1068623856 10:59217890-59217912 TGGCAGCATACCTGAATCCCTGG - Intronic
1070548239 10:77469686-77469708 AGACACCATCACTGAATCCCTGG - Intronic
1074249746 10:111732636-111732658 AGGCCAAATCCCTGAAGCACAGG - Intergenic
1074299583 10:112221452-112221474 AGGCACCACCCCAGAAGCCCTGG + Intergenic
1074609820 10:115010730-115010752 AGGCAGGATTCCTCAAGCCCAGG + Intergenic
1074690887 10:116003184-116003206 AGGCAACTTCCCTGCAGCCCAGG + Intergenic
1076224008 10:128758836-128758858 AAGCACCATCCAGGAAGACCTGG - Intergenic
1076546597 10:131249486-131249508 AAGCAGCATCCCTGAGTCCCTGG + Intronic
1077265113 11:1644836-1644858 AGGCACCCACCCTGAAACCGAGG + Intergenic
1082013613 11:47467742-47467764 AGCCAGCCTCCCGGAAGCCCCGG + Intronic
1082843738 11:57710920-57710942 AGGCAGAATCCCTTGAGCCCAGG - Intronic
1082974640 11:59059678-59059700 AGGAGCCATCCTTGATGCCCTGG - Intergenic
1083763878 11:64833037-64833059 AGCCAGCTTCCCTGAAGCCACGG + Intronic
1084778431 11:71392796-71392818 AGGCACCTTACCTGGAGCCTTGG + Intergenic
1085302053 11:75464488-75464510 AGGCACCAGCCCTCTTGCCCAGG - Intronic
1085825802 11:79845984-79846006 AGGAACCAGCCCTGGAGCCTGGG + Intergenic
1086181722 11:83959724-83959746 AGGCCCCATCCCTGCATCCCTGG - Intronic
1086384449 11:86292798-86292820 AGGCTCAATCACTGGAGCCCAGG - Intergenic
1086895429 11:92306881-92306903 AGGCAGAATCACTTAAGCCCAGG - Intergenic
1087214236 11:95478285-95478307 AGGCAGTAGCCCTGATGCCCTGG + Intergenic
1090225714 11:125071070-125071092 AGGTAGAGTCCCTGAAGCCCAGG + Intronic
1091220947 11:133929762-133929784 AGGCACCAGCCCCCATGCCCCGG - Exonic
1091332121 11:134737886-134737908 AGGCACCATCCCAGGGGCCTGGG - Intergenic
1092471210 12:8783739-8783761 AGGCAGAATCCCTTGAGCCCGGG + Intergenic
1094619408 12:32065955-32065977 AGCCAGGATCCCTTAAGCCCAGG + Intergenic
1095482492 12:42650514-42650536 AGGGAGGATCCCTGGAGCCCAGG - Intergenic
1096252216 12:50040602-50040624 GGGCACCATCCCTGTCCCCCAGG + Intergenic
1096285255 12:50294233-50294255 AGGCAGGATCCCTTGAGCCCAGG - Intergenic
1096897298 12:54835900-54835922 TGGAACCATCCCTGCATCCCTGG + Intronic
1099231835 12:80035604-80035626 AGGCATCAACCCAGATGCCCTGG + Intergenic
1099516776 12:83606385-83606407 TTAAACCATCCCTGAAGCCCTGG - Intergenic
1099741126 12:86635767-86635789 TGGGAGCATCCCTGGAGCCCAGG - Intronic
1100883453 12:99043487-99043509 TGGCAGCATACCTGAAGTCCAGG - Intronic
1101411457 12:104472200-104472222 AGGCAAGATCCCTTGAGCCCAGG - Intronic
1102222488 12:111203962-111203984 TGCCACCAGCCCTGAGGCCCTGG - Intronic
1102238784 12:111310728-111310750 AGCCCCCAGCCCTGATGCCCTGG - Intronic
1103190104 12:118993912-118993934 AAGATCCATCCCTTAAGCCCAGG + Intronic
1103365245 12:120377539-120377561 AAGCACCCTCCCTAGAGCCCAGG + Intergenic
1103472385 12:121192285-121192307 AGAGATCATCCCTTAAGCCCAGG + Intergenic
1103852345 12:123941268-123941290 AGGGACCTCCCCCGAAGCCCTGG - Intronic
1105373587 13:19822100-19822122 AGGGAGGATCCCTGGAGCCCAGG - Intergenic
1105426334 13:20298108-20298130 AAGCTCCGTCCCTGAGGCCCAGG - Intergenic
1106732585 13:32556708-32556730 AGGGATGATCCCTTAAGCCCAGG - Intergenic
1107914956 13:45140178-45140200 AGGGAGGATCCCTTAAGCCCAGG - Intronic
1109069281 13:57743130-57743152 AGGCAGTATCACTTAAGCCCAGG + Intergenic
1109220527 13:59636750-59636772 TTGCACCATCCCTGTAGCTCAGG + Intergenic
1109974089 13:69808081-69808103 AGGCAACACCACTGAAGCCCAGG + Intronic
1110402048 13:75103523-75103545 CTGCACCAACCCTGAAGCACAGG - Intergenic
1111008144 13:82276430-82276452 AGGCACCATCCCAGTTGCCTGGG + Intergenic
1111292133 13:86184706-86184728 GGGCTCCACCCCTGCAGCCCTGG + Intergenic
1111986502 13:95071453-95071475 AAGCTCCAGCCCTGAGGCCCGGG + Intronic
1112578464 13:100658306-100658328 AGGTATCATCTCTGCAGCCCCGG + Intronic
1112585734 13:100716861-100716883 AGGCACCCACACTGATGCCCTGG + Intergenic
1113455104 13:110442988-110443010 ATGCAACATCCCTGAAGTCCTGG - Intronic
1113809629 13:113130399-113130421 AGGCACCTTTCCTGATGCCTGGG - Intronic
1116450478 14:45059268-45059290 TGGGAGGATCCCTGAAGCCCAGG - Intronic
1116877011 14:50122050-50122072 AGGCCCCATCCCTGGAGCTAAGG - Intronic
1117776567 14:59189556-59189578 AAGCGCCTGCCCTGAAGCCCTGG + Intronic
1118552849 14:66975650-66975672 AGGGAGGATCACTGAAGCCCAGG + Intronic
1120572470 14:86138507-86138529 AGGCAGAATCACTGGAGCCCGGG + Intergenic
1120746326 14:88155383-88155405 AGGCGGGATCCCTTAAGCCCAGG + Intergenic
1120940750 14:89946663-89946685 AGGCAGGATCCCTTGAGCCCAGG - Intronic
1121646131 14:95517790-95517812 AAACAGCATCCCGGAAGCCCTGG - Exonic
1122180445 14:99950615-99950637 AGGCAGCAGCCCTGTAGTCCTGG + Intergenic
1122481340 14:102049428-102049450 AGGCAAGATCCCTGCAGCCAAGG - Exonic
1123125073 14:105940633-105940655 ATGCACCATCCCTGTGCCCCTGG + Intergenic
1123701627 15:22918408-22918430 AGGCACCATGCATGAACCACAGG + Intronic
1124218918 15:27832494-27832516 AGCCAGCATCCCTGATGGCCGGG - Intronic
1125732481 15:41900971-41900993 TGGCACCCTCCCCGTAGCCCTGG + Exonic
1125932574 15:43611064-43611086 AGGCATCTTCCCTGAGGCCAGGG - Intronic
1125945672 15:43710526-43710548 AGGCATCTTCCCTGAGGCCAGGG - Intergenic
1126564853 15:50084442-50084464 AGCCACCATCCTCGAGGCCCAGG + Intronic
1127092126 15:55477930-55477952 AGGCACCTGCCATGATGCCCAGG - Intronic
1127451448 15:59120395-59120417 AGGCAGGATCCCTTGAGCCCAGG + Intronic
1127532357 15:59856213-59856235 ATGCACCATCACAGAGGCCCGGG + Intergenic
1128878098 15:71218445-71218467 AGGCACAATGCCTGCAGCACAGG - Intronic
1129704286 15:77785579-77785601 AGGTCCCAGCCCTGGAGCCCTGG - Intronic
1131150844 15:90046432-90046454 TGGCCCCTTCCCTGAGGCCCTGG - Intronic
1132010436 15:98270954-98270976 AGGCACCATTCCGGAAGGCCTGG - Intergenic
1132613131 16:827569-827591 AGGGACCCTCCCAGAATCCCTGG - Intergenic
1132620844 16:867698-867720 AGGCTCCATCCCAGAGCCCCCGG - Intronic
1132731325 16:1363680-1363702 AGGAGCCATCCCTGAGGCCATGG + Exonic
1132814928 16:1821167-1821189 AGGCACCGCCCCTCAAGCCCAGG + Intronic
1133819871 16:9226555-9226577 AGACCCAATCACTGAAGCCCAGG - Intergenic
1134753590 16:16647013-16647035 AGGCAGGATCGCTTAAGCCCAGG - Intergenic
1134992469 16:18712030-18712052 AGGCAGGATCGCTTAAGCCCAGG + Intergenic
1135467207 16:22697471-22697493 AGGCACCCACCATGATGCCCAGG + Intergenic
1135497151 16:22962683-22962705 TGGCCCCATCCCTGCAGCTCTGG + Intergenic
1135746525 16:25021650-25021672 AGGCAGAATCGCTTAAGCCCAGG + Intergenic
1136288529 16:29258181-29258203 AGCCACCATCTCTCCAGCCCGGG - Intergenic
1136377118 16:29872266-29872288 AGGGACTTTCCCTGAAGCCTGGG + Exonic
1137481695 16:48857240-48857262 AGGAACCATCCCTCAGGCTCAGG + Intergenic
1137714907 16:50592677-50592699 AGAAGCCATCCCTGGAGCCCCGG - Intronic
1138550786 16:57747234-57747256 AGGCCACCTACCTGAAGCCCTGG + Intronic
1138589289 16:57990862-57990884 AGGCCCCATTCCTGAGCCCCAGG - Intergenic
1139687348 16:68614554-68614576 AGGGAGGATCCCTGGAGCCCAGG + Intergenic
1139795930 16:69482767-69482789 AAGGCCCATCCCTTAAGCCCAGG - Intergenic
1140998660 16:80286923-80286945 GGAAACCTTCCCTGAAGCCCTGG + Intergenic
1141143036 16:81509682-81509704 AGGCAGCATTCCTGAAACCAGGG - Intronic
1141317011 16:82971958-82971980 AGGCACTAACCCTCTAGCCCAGG + Intronic
1141848402 16:86626904-86626926 AGGCACCATCACAGAGCCCCAGG + Intergenic
1143525606 17:7470303-7470325 TGGGAGCATCCCTTAAGCCCAGG + Intronic
1144765638 17:17731039-17731061 TGGCACCATGCCTGATGCTCTGG - Intronic
1144971070 17:19110307-19110329 GGGCACCATCCCTGTTGCCTGGG - Intergenic
1144991372 17:19236470-19236492 GGGCACCATCCCTGTTGCCTGGG - Intronic
1145804301 17:27715447-27715469 AGGCAATATCCCTTAAGGCCTGG + Intergenic
1147565146 17:41531398-41531420 AGGCACAGTACCAGAAGCCCTGG + Intergenic
1147724004 17:42555221-42555243 TGGCACCATTCCTTGAGCCCAGG + Intergenic
1148084877 17:44988010-44988032 AGCCTCCATCCTTGTAGCCCAGG + Intergenic
1148714766 17:49708078-49708100 TGGCTCCATCCCTGAGGGCCAGG + Exonic
1148749076 17:49934507-49934529 AGGCGCCTTTCCTGAAGCCCTGG - Intergenic
1151390986 17:73786551-73786573 AAGCTCCATTCCTGAAACCCTGG + Intergenic
1151423194 17:74012273-74012295 AGACACCATCCCCGAATCCCAGG + Intergenic
1151544792 17:74786168-74786190 ACCCACCCTCCCTGAAGCACCGG - Intronic
1152031465 17:77845958-77845980 TGACACCTTCCCTGCAGCCCCGG - Intergenic
1152659742 17:81536755-81536777 AGGCGCCGTCGCTGAAGCTCAGG - Exonic
1152845533 17:82597391-82597413 AGCCATCAGCCCTGCAGCCCCGG - Intronic
1153608942 18:6862273-6862295 AGACAGGACCCCTGAAGCCCTGG - Intronic
1155091621 18:22516623-22516645 AGCCACCAGCCCTGAGTCCCCGG + Intergenic
1155733545 18:29192463-29192485 AAGCACCACACCTGGAGCCCAGG + Intergenic
1155798183 18:30066304-30066326 AGGCACCATCCATGAAGAACAGG - Intergenic
1155867002 18:30977794-30977816 AAGCACCATACCTGAAGGCAAGG - Intergenic
1156048865 18:32907763-32907785 AGGACCGATCCCTGAAGCCTGGG + Intergenic
1157332889 18:46716413-46716435 ACACTCCATCCCAGAAGCCCAGG + Intronic
1157391070 18:47303882-47303904 AGGCCCCTTCCCTGAAACCAGGG - Intergenic
1158379025 18:56907732-56907754 AGGCACCATCCATGAGGAACAGG - Intronic
1160789195 19:915400-915422 AGGCACCCTCCACCAAGCCCGGG + Intergenic
1160859220 19:1230665-1230687 GGGCAACTTCCCTGAAGCCCAGG - Exonic
1160920714 19:1518992-1519014 AGGCCCCAACACTGAACCCCAGG + Intergenic
1161372519 19:3921122-3921144 AGCCAAGCTCCCTGAAGCCCAGG + Intronic
1161583837 19:5094582-5094604 AGGCACCACCCCTAAAACACAGG - Intronic
1161816095 19:6501149-6501171 AGGCACCAGCCCTGCATCCAGGG - Intronic
1162007892 19:7791513-7791535 AAGCTTCATCCCAGAAGCCCTGG + Intergenic
1162349619 19:10140746-10140768 AGGCTCCATCTCTGAATACCTGG - Intronic
1163669043 19:18617068-18617090 AGGCTCCCACCCTGAAGCCCTGG + Exonic
1163711631 19:18850636-18850658 AGCTCCCGTCCCTGAAGCCCCGG - Intronic
1163723246 19:18908199-18908221 AGGCAGGATCGCTTAAGCCCAGG + Intronic
1164590887 19:29506206-29506228 ATGCACCATCCCAGGACCCCCGG + Intergenic
1164735327 19:30536804-30536826 AGGCCCCCTCCCTGAACTCCCGG - Intronic
1165257404 19:34587848-34587870 AGGAACCATCCTTGCATCCCTGG + Intergenic
1165428989 19:35761306-35761328 TGGCAGGATCCCTTAAGCCCAGG + Intronic
1166309426 19:41954431-41954453 AGGCTGCATCCCTGAGGCCTTGG + Intergenic
1166673806 19:44727087-44727109 AGCCACCATCACTGAAGGCCCGG + Intergenic
1166945385 19:46393036-46393058 AGGGAACTTCCCTGAAACCCGGG - Intergenic
1167043099 19:47034353-47034375 AAGCCCCATCCTTGGAGCCCTGG + Intronic
1167711661 19:51115477-51115499 CAGCACCATCCCTGCTGCCCGGG + Intergenic
925479078 2:4250562-4250584 AAGCACCATCTCTGGTGCCCAGG - Intergenic
925949700 2:8899050-8899072 AGGCAATATCCCTTAAGACCTGG - Intronic
927296116 2:21454974-21454996 AGACACCATCCTAGAAGCCGGGG - Intergenic
927580878 2:24245704-24245726 ACGCAGGATCCCTTAAGCCCAGG - Intronic
929554459 2:42916758-42916780 ATGCACCACCCCTGACGCCCAGG + Intergenic
929655401 2:43726023-43726045 TGGAAGGATCCCTGAAGCCCAGG + Intronic
930049422 2:47203164-47203186 ATGCACCATTCCTCCAGCCCCGG - Intergenic
930673473 2:54176005-54176027 AGGCACCATCCATGAGGAACAGG + Intronic
931175391 2:59849338-59849360 AGCCACCATCCTTTAAGCACAGG + Intergenic
931213540 2:60220560-60220582 AGACACCATTCCAGAAACCCAGG + Intergenic
931238908 2:60435219-60435241 TGGCAGCAGCCCTGGAGCCCCGG - Intergenic
932800215 2:74735148-74735170 AGGCACCAGGCCTGTAGCCCAGG + Intergenic
933796946 2:85927380-85927402 AGGCAACAGCCCTGAGGGCCAGG - Intergenic
933940343 2:87239775-87239797 AAGAACCATCCCAGATGCCCTGG - Intergenic
934945644 2:98539434-98539456 TGTCACCATCCCTGAGGGCCGGG + Intronic
935215017 2:100969004-100969026 AGGCAGCATCTATGAAACCCTGG - Intronic
936513970 2:113170119-113170141 AGCCACCATGCCTGACCCCCAGG - Intronic
936521065 2:113212486-113212508 AGGCACCCTCCCTGAAGCCAAGG - Intergenic
936552716 2:113461824-113461846 AGGGAGGATCCCTTAAGCCCAGG - Intronic
937363655 2:121245747-121245769 TGGCACCATCCCTGTCTCCCAGG + Intronic
937694942 2:124798357-124798379 ATGCACCGTCCCTCCAGCCCAGG - Intronic
937976184 2:127583363-127583385 AGGCACCTGCCCTGCACCCCCGG - Intronic
938805995 2:134807752-134807774 AGGCAATATCCCTTAAGGCCTGG - Intergenic
939929057 2:148209414-148209436 AGGCACCATCTATGAAGAACAGG + Intronic
941160404 2:162028551-162028573 AGGGACCACCCCTGCAGTCCAGG + Intronic
942317974 2:174711855-174711877 AGACACCATCCCAGCAGCTCAGG - Intergenic
942441577 2:176042509-176042531 AGGCTCCACCCCTCAGGCCCAGG + Intergenic
942466228 2:176209951-176209973 AGGGAGGATCCCTGGAGCCCAGG - Intergenic
942857136 2:180562398-180562420 AAGCTCCATCCCTAAGGCCCAGG + Intergenic
943133927 2:183888992-183889014 AGGAACCAACCCTGAAGTCTGGG + Intergenic
943395112 2:187324105-187324127 AGGGAGGATCCCTGGAGCCCAGG - Intergenic
943863369 2:192895240-192895262 AGGCCTCATCCCTGAGGCCTAGG + Intergenic
945083111 2:206105964-206105986 AGGCACCAGCCACCAAGCCCAGG - Intergenic
945373759 2:209054326-209054348 TTGAACCATCCCTGAATCCCTGG - Intergenic
946057096 2:216911935-216911957 ATGCATCATTCCTGAAGCCATGG - Intergenic
948261451 2:236607133-236607155 AGGCACCACCCCAGAAGCCCAGG - Intergenic
948523867 2:238558652-238558674 GGACACCAGCCCTGGAGCCCTGG - Intergenic
948566278 2:238889079-238889101 AGTGGCCATCCCTGGAGCCCTGG + Intronic
948699196 2:239749833-239749855 AGGTAGCATCTCTGCAGCCCTGG - Intergenic
948907311 2:240986050-240986072 AGTGTCCAGCCCTGAAGCCCTGG - Intronic
1170010054 20:11713020-11713042 AGGCATCATCACAGAAGCCTTGG - Intergenic
1170150051 20:13220027-13220049 AGGCTCCATCCCGGAGGCACTGG + Intergenic
1172939386 20:38644218-38644240 AAGCCCCATCCCTGAGGCCCAGG + Intronic
1173998822 20:47359476-47359498 AGCCACATTCCATGAAGCCCAGG - Intergenic
1174260531 20:49291535-49291557 AGGGAGGATCCCTTAAGCCCAGG - Intergenic
1174267150 20:49340258-49340280 AGCAAACATCCCTGGAGCCCAGG + Intergenic
1174489784 20:50884753-50884775 AGGACCCATCTCTGAAGCTCGGG - Intergenic
1174983159 20:55420158-55420180 AGGCACAATCCCTGCATCCAAGG - Intergenic
1175821911 20:61914587-61914609 AGGCCCCATCCCTCAGGCCTGGG + Intronic
1175995695 20:62811413-62811435 AGGCACCATCCCTGAAGCCCCGG - Intronic
1176804895 21:13470948-13470970 AGGCACCCTCCATCACGCCCAGG - Intergenic
1177214491 21:18110596-18110618 AGGCACCATCACAGAAGACTGGG + Intronic
1177795657 21:25776309-25776331 AGGCACCAGCCATCAAGTCCGGG + Intergenic
1178336777 21:31750390-31750412 AGGCAGCATCGCTTGAGCCCAGG - Intergenic
1178533892 21:33396978-33397000 AGGAAGAATCCCTTAAGCCCAGG - Intergenic
1178854586 21:36239789-36239811 TGGCACCATCCGTGCAGGCCAGG - Exonic
1179230507 21:39499885-39499907 GGGCAACCTCCCTGAAGCCCAGG + Exonic
1179955303 21:44735034-44735056 TGGCACCCTCCCTGCAGCCGGGG - Intergenic
1179987964 21:44931825-44931847 AGGCAGTTTTCCTGAAGCCCGGG - Intronic
1180980782 22:19877084-19877106 AAGCGCCATCCCTGCAGGCCAGG - Exonic
1181313264 22:21956837-21956859 ATGCCCCAACCCTGAAGCCCTGG - Intergenic
1181346369 22:22222909-22222931 ATGCCCCAACCCTGAAGCCCTGG - Intergenic
1181471240 22:23141570-23141592 AGCCAACATAGCTGAAGCCCTGG - Intronic
1181484810 22:23223939-23223961 AGGCACAGGCCCTGATGCCCAGG + Intronic
1181914370 22:26267812-26267834 AGTCACCTTCCCTGCAGTCCTGG - Intronic
1183296123 22:37030498-37030520 AGGCACCATCTCAGCAGCGCAGG + Intergenic
1183951496 22:41355410-41355432 AGGCACCAGGCCTGAGGCCCTGG - Intronic
1185397118 22:50598452-50598474 AGGCACCATGCTTGGAGCCTAGG + Intronic
949869057 3:8571331-8571353 ACGAACCATCCCAGAACCCCAGG - Intergenic
951887458 3:27538367-27538389 ACTCACCATCCCAGAAGCCTGGG - Intergenic
953900645 3:46840166-46840188 AGGGAGTATCACTGAAGCCCAGG + Intergenic
953955946 3:47232172-47232194 AGGCACCACCTCTGAAGCGGAGG + Intronic
954112453 3:48442135-48442157 AGGCAGCCTCGCTTAAGCCCAGG + Intronic
954451143 3:50572303-50572325 AGGCACTGTCCCTGAAGTCATGG - Intronic
954703507 3:52465603-52465625 AGGCCTCATCCCAGAACCCCTGG + Intronic
956021843 3:64941484-64941506 TGGCACCTTCCCTGTAGCCTGGG - Intergenic
957285936 3:78217741-78217763 AGTAACCCTCCCTGAAGCACTGG - Intergenic
958147576 3:89646436-89646458 AGGCACCTGCCATCAAGCCCAGG - Intergenic
958632823 3:96703453-96703475 GGGTACCATCTCTGAAGCTCTGG - Intergenic
964858506 3:161173418-161173440 AGGCACCCGCCATCAAGCCCAGG - Intronic
966262955 3:178001909-178001931 AAGCCCCACCCCTGAGGCCCAGG - Intergenic
967451881 3:189633619-189633641 AGGCACCATGATTAAAGCCCAGG - Intronic
967708841 3:192682623-192682645 AGTCTCCATCCCAGAAGCCCAGG - Intronic
967798261 3:193623121-193623143 AGGCATCATCTATGAAGCCAAGG - Intronic
967855661 3:194115558-194115580 AAGAACCAACCCTGAAGCCCAGG + Intergenic
968123227 3:196140932-196140954 AGGGAGGATCCCTTAAGCCCAGG + Intergenic
968233253 3:197016471-197016493 AGGCACCCACCCTGAGGGCCAGG + Intronic
968526652 4:1061459-1061481 AGGCAGCTTCCCTGGAACCCTGG + Intronic
968704786 4:2072805-2072827 CTGGACCGTCCCTGAAGCCCGGG - Intronic
968705171 4:2074290-2074312 CTGCACCATCCCTGAAGGGCTGG - Intronic
969663217 4:8542495-8542517 AGCCACCGTCCCTGCAGCTCTGG - Intergenic
972535055 4:39993061-39993083 AGGCACCAGCCACCAAGCCCCGG + Intergenic
973092699 4:46157931-46157953 AAGCACCATCCCTGCAACCATGG - Intergenic
975607326 4:76168272-76168294 ATGCCCCATCCCTGAAGGGCAGG + Intronic
976141708 4:81999848-81999870 AGGCAGCATCAGTCAAGCCCTGG + Intronic
976622110 4:87139220-87139242 ATGTAGCATCCCTGAAGCCATGG - Exonic
978635155 4:110795485-110795507 AGGCTCCAACCCTGAAGCCTAGG - Intergenic
981295429 4:143125840-143125862 AGGAAGGATCCCTCAAGCCCAGG - Intergenic
981314197 4:143325617-143325639 TGGCAGCATCCCTTGAGCCCAGG + Intergenic
981325134 4:143437704-143437726 AAACACAATCCCTGAAGCACTGG - Intronic
981336130 4:143570618-143570640 AGGCAGCATTCCTGGAACCCAGG + Intergenic
986176381 5:5355544-5355566 AAGGACCATCCCAGAATCCCTGG - Intergenic
986719799 5:10552895-10552917 AGGCACCTTACCTTCAGCCCTGG - Intergenic
987108068 5:14660483-14660505 AGGCAGGATCCCTTGAGCCCAGG - Intergenic
987379540 5:17272256-17272278 TGGCACCATCCTTGTAACCCAGG + Intronic
988414672 5:30931100-30931122 GAGCAGGATCCCTGAAGCCCAGG + Intergenic
988684348 5:33513276-33513298 ATGCTCCAGCCCTGAAGCCCAGG - Intergenic
990468386 5:56090549-56090571 TGGGACAATCCCTTAAGCCCGGG + Intergenic
990867533 5:60396606-60396628 AGGCAGGATCCCTTGAGCCCAGG - Intronic
990897772 5:60717392-60717414 GGGGACCATCCCTGTAGCCAAGG + Intergenic
991090380 5:62688701-62688723 AGCCACCATGCCTGGACCCCGGG + Intergenic
991371080 5:65920614-65920636 TGGCACAATCGCTGGAGCCCAGG + Intergenic
991921701 5:71663753-71663775 TGGCAGGATCCCTGGAGCCCAGG - Intergenic
992035316 5:72768297-72768319 AGGCAGAATCCCTTAAGTCCAGG - Intergenic
996030193 5:118696205-118696227 AGGGGCGATCCCTTAAGCCCAGG - Intergenic
996519310 5:124409376-124409398 AGGCAGCCTCCCAGAAGACCAGG + Intergenic
998266499 5:140671220-140671242 AGGCCCCATCCCAGCAGGCCTGG - Exonic
998363448 5:141611461-141611483 AGGCAGGATTCCTGAAGCCCAGG + Intronic
999254997 5:150205152-150205174 AGGCTCCAATCCTGAGGCCCTGG - Intronic
1000501831 5:162061598-162061620 AGGCACAATCGCTTGAGCCCTGG + Intergenic
1000747719 5:165055926-165055948 AGGCCACATCCCTGAGTCCCAGG - Intergenic
1001255871 5:170183287-170183309 AGGCACCACTCTTGAAGGCCAGG + Intergenic
1001302320 5:170542995-170543017 AGGCACCATCTATGAAGAACTGG - Intronic
1001603852 5:172946317-172946339 AGGCCCCATCCCCACAGCCCAGG + Intronic
1002154776 5:177268199-177268221 CGGCAGGATCCCTTAAGCCCAGG - Intronic
1003232248 6:4264985-4265007 GTGCACCATCTCTGAAGCCTGGG + Intergenic
1005944512 6:30585603-30585625 AGACATCATCCAAGAAGCCCTGG - Exonic
1006153993 6:32004365-32004387 AGGTACCATCCAGGAGGCCCTGG + Intergenic
1006160300 6:32037102-32037124 AGGTACCATCCAGGAGGCCCTGG + Intergenic
1006385125 6:33726564-33726586 AGGCACAAGCCCTCAAACCCGGG - Intronic
1007081366 6:39107311-39107333 GGGCACCCTCCCTGATGCCCAGG - Intronic
1007562937 6:42825628-42825650 AGGCAGGATCCCTTGAGCCCAGG + Intronic
1008356073 6:50555132-50555154 TGTCATCATGCCTGAAGCCCAGG + Intergenic
1010981688 6:82376425-82376447 GGCCACCATCCTTGAAACCCTGG - Intergenic
1011401232 6:86964086-86964108 AGGCACCTTCCCTGGAGCAACGG + Intronic
1012486462 6:99726849-99726871 AGGCGGCATCCCTGCTGCCCAGG + Intergenic
1013979915 6:116118242-116118264 AGTCACCAACCCTTATGCCCAGG - Intronic
1015547445 6:134375906-134375928 AGGCACCATCCTAGGAGCCATGG - Intergenic
1015980288 6:138831472-138831494 AGGCAGCATCCCTGAGGAGCTGG - Intronic
1018171113 6:161143738-161143760 AGGCACCATCTCTGAAAACAGGG - Intronic
1019075691 6:169386569-169386591 AAGCAGCATCCGTGAAGCCCAGG + Intergenic
1019443049 7:1056989-1057011 GGTCACCCTCCCTGGAGCCCAGG + Intronic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1019613593 7:1948809-1948831 AGGCACAGCCCCTGGAGCCCAGG - Intronic
1020021459 7:4872011-4872033 CGTCACCATCCCTGAGACCCTGG + Intronic
1020084942 7:5305209-5305231 AGGCATCCTCCCTGGGGCCCAGG + Exonic
1020501334 7:8925203-8925225 GGGCACCATCCATGAAGACCAGG - Intergenic
1020959811 7:14788238-14788260 GAGCCCCATCCCTGAAGCTCAGG + Intronic
1022138902 7:27475351-27475373 AGGTACCATCCTTGAAGCACAGG + Intergenic
1023009817 7:35916610-35916632 AGGGAGCATCCCTTGAGCCCAGG - Intergenic
1024081017 7:45854995-45855017 AGGGAGCATCCCTTGAGCCCAGG + Intergenic
1026141849 7:67713283-67713305 AGGCACCATCCTTCTAGCCACGG - Intergenic
1026627768 7:72011454-72011476 GGACACCATCCCTGAAGCACAGG + Intronic
1028163829 7:87515340-87515362 AGGCTCAGTCCCTGAAGCACTGG + Exonic
1028495058 7:91452666-91452688 AGGCAATATCCCTTAAGGCCTGG - Intergenic
1028885557 7:95928623-95928645 CGGCACTAACACTGAAGCCCAGG - Intronic
1032275141 7:130447617-130447639 AGGTCCCATCCCCCAAGCCCAGG + Intergenic
1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG + Intergenic
1035438142 7:158874774-158874796 GGGCATCATCCCTGAATTCCAGG + Intronic
1035708711 8:1696405-1696427 AGGCAGGATCCCTTCAGCCCAGG + Intronic
1035764902 8:2098311-2098333 AGGCAGCGTCCCTGAGGGCCCGG + Intronic
1036161786 8:6395816-6395838 AGGCACCATCTGTGAAGAACAGG - Intergenic
1036752249 8:11450797-11450819 AGGCACCATCCCAGGAAGCCTGG - Intronic
1037802558 8:22043450-22043472 AGGCTCCATCCCTCAAGTCTGGG - Intronic
1038792908 8:30684422-30684444 AGGGAGGATCCCTTAAGCCCAGG + Intronic
1039424789 8:37477035-37477057 AGGCACCATCTATGAAGCAGTGG - Intergenic
1039914632 8:41850827-41850849 AGGCAATATGCCTGAAGCCTCGG + Intronic
1040336892 8:46420603-46420625 AGGCACCCTCCTTGAAAGCCTGG - Intergenic
1040569731 8:48597080-48597102 CGGGAGCATCCCTTAAGCCCGGG - Intergenic
1042059223 8:64798929-64798951 AAGAACCAGCCCTGAAGGCCTGG + Intergenic
1042137018 8:65642609-65642631 AGGCACCCGCCATGAAGCCCGGG + Intergenic
1042190941 8:66186431-66186453 GGGCAGCATCCCAGGAGCCCAGG + Intergenic
1042373194 8:68016842-68016864 AGGCAGGATCCCTTAAGGCCAGG - Intronic
1043440985 8:80276920-80276942 TGGCAGAATCCCTTAAGCCCAGG + Intergenic
1044019393 8:87085832-87085854 AAGTACCATCTCTGAAGCCCAGG - Intronic
1045064579 8:98434308-98434330 AGCCACCATCCCTGCAGCAAGGG + Intronic
1045074037 8:98542657-98542679 AGGGAGCATCCGGGAAGCCCTGG - Intronic
1047345029 8:124019503-124019525 AGGCACTATGCTTGGAGCCCAGG - Intronic
1047405361 8:124581224-124581246 CGGGAAGATCCCTGAAGCCCAGG + Intronic
1047961942 8:130017017-130017039 TGTCACCATTCCTGAAGTCCAGG - Intronic
1049017946 8:139934682-139934704 AGGCCCCATCCCTGCAGACTGGG + Intronic
1049900283 9:155357-155379 AGGGAGGATCCCTTAAGCCCAGG + Intronic
1049998322 9:1051504-1051526 AGGGACCATCCCTGAGCCTCCGG - Intronic
1051483422 9:17583459-17583481 AGGCACCATCTTTGAAGCAAAGG + Intronic
1052348110 9:27430254-27430276 GAGCACCATCCCTGCAGCACAGG - Intronic
1053743331 9:41165651-41165673 AGGGAGGATCCCTTAAGCCCAGG + Intronic
1054446335 9:65321843-65321865 AGGGAGGATCCCTTAAGCCCAGG + Intergenic
1054483939 9:65699665-65699687 AGGGAGGATCCCTTAAGCCCAGG - Intronic
1054685014 9:68265634-68265656 AGGGAGGATCCCTTAAGCCCAGG - Intronic
1056132654 9:83601193-83601215 AGGCCCAATCCTGGAAGCCCTGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1059062685 9:111050055-111050077 AGGCAGCATCGCTGGAGCCCGGG + Intergenic
1059585837 9:115605382-115605404 AGTCACCTTCCCTGAAGTCTTGG - Intergenic
1059637218 9:116182816-116182838 CGGAACCATCCCTGGAACCCTGG - Intronic
1059722918 9:116979163-116979185 AGGCAGCGTTCATGAAGCCCAGG - Intronic
1061399674 9:130361550-130361572 AGGCACCAGCCATGATGCCCAGG - Intronic
1061922031 9:133787744-133787766 CGGCCCCGTCCCTGTAGCCCTGG + Intronic
1061922060 9:133787827-133787849 AGGCCCCACCCCTGCAGCCCTGG + Intronic
1062338394 9:136082523-136082545 GGTCACCATCCATGAAGCACTGG + Intronic
1190237950 X:48631913-48631935 AGCCACCAGCCATGAAGCCCAGG + Intergenic
1191686056 X:63892211-63892233 AGGCAGCATCCCTGATGTGCTGG - Intergenic
1191758033 X:64615658-64615680 AGGAACCATCCTTGTATCCCTGG + Intergenic
1193190911 X:78570167-78570189 TGGAACCATCCTTGAATCCCTGG + Intergenic
1194197422 X:90912541-90912563 ATGCTCCATCCCTGAAGAGCTGG - Intergenic
1194680639 X:96848130-96848152 TGGCAGGATCCCTCAAGCCCAGG - Intronic
1195113390 X:101669818-101669840 AGGCACCATCTATGAAGCAGGGG + Intergenic
1195116804 X:101707401-101707423 AGGCACCATCTATGAAGCAGGGG - Intergenic
1196199318 X:112867622-112867644 AGGCACCATGCTTTAAACCCTGG + Intergenic
1198211125 X:134517166-134517188 AGCCACCATACCTGGCGCCCTGG - Intronic
1198790819 X:140343665-140343687 TGGCACCATTCCAGAAACCCTGG + Intergenic
1199358359 X:146886972-146886994 AGCCACCACCACTGCAGCCCAGG - Intergenic
1200784065 Y:7243553-7243575 AGGGACAATCCCTTAAGCCCAGG - Intergenic
1201928340 Y:19314363-19314385 AGCCACCACTCCTGAAACCCAGG + Intergenic