ID: 1175996151

View in Genome Browser
Species Human (GRCh38)
Location 20:62813156-62813178
Sequence GGTCTCCGATGGGCTCCCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175996151_1175996157 -3 Left 1175996151 20:62813156-62813178 CCCCTGGGAGCCCATCGGAGACC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1175996157 20:62813176-62813198 ACCCCAGGCCCCAGCCCAGCAGG 0: 1
1: 4
2: 10
3: 72
4: 717
1175996151_1175996163 6 Left 1175996151 20:62813156-62813178 CCCCTGGGAGCCCATCGGAGACC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1175996163 20:62813185-62813207 CCCAGCCCAGCAGGACCTGCAGG 0: 1
1: 2
2: 9
3: 64
4: 462
1175996151_1175996165 7 Left 1175996151 20:62813156-62813178 CCCCTGGGAGCCCATCGGAGACC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1175996165 20:62813186-62813208 CCAGCCCAGCAGGACCTGCAGGG 0: 1
1: 2
2: 7
3: 45
4: 435
1175996151_1175996166 8 Left 1175996151 20:62813156-62813178 CCCCTGGGAGCCCATCGGAGACC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1175996166 20:62813187-62813209 CAGCCCAGCAGGACCTGCAGGGG 0: 1
1: 3
2: 11
3: 55
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175996151 Original CRISPR GGTCTCCGATGGGCTCCCAG GGG (reversed) Exonic
900435583 1:2629188-2629210 GGTCTGCACTGGGCACCCAGGGG - Intronic
901059650 1:6466109-6466131 GCCCTCCGACGGGCGCCCAGGGG + Exonic
901493268 1:9607433-9607455 GGCCTCAGCTGGGGTCCCAGAGG - Intronic
902209181 1:14892517-14892539 GGGCTCCCATGGGCTGTCAGGGG - Intronic
904676901 1:32204307-32204329 GGTCACTGAGGGGCTGCCAGAGG + Exonic
916417713 1:164608340-164608362 GGCCTCAGCTGGGCTCTCAGAGG - Intronic
916507425 1:165440739-165440761 GGTGTGCCAGGGGCTCCCAGAGG - Intronic
920716068 1:208341616-208341638 GGTCTCAGGTGGTCTCACAGTGG - Intergenic
1063112055 10:3046255-3046277 GGCCTCCCGGGGGCTCCCAGGGG + Intergenic
1066012960 10:31210976-31210998 GGTCTCAGGTGTGCTTCCAGGGG + Intergenic
1067089144 10:43257791-43257813 GTTCTCCCCTGGGCTCCCACAGG + Intronic
1067165613 10:43864343-43864365 GATGTCCGATGGGCTCACATGGG + Intergenic
1073430009 10:103479793-103479815 CCTCTCCCATGGGCACCCAGTGG - Intergenic
1076715898 10:132363544-132363566 GGTCTCCAGTGGTCTCCCTGAGG - Intronic
1083227866 11:61295711-61295733 GGGCTCCTCTGGGCACCCAGGGG + Intergenic
1084324429 11:68391463-68391485 GCTCTCCTCAGGGCTCCCAGGGG + Intronic
1084566469 11:69931551-69931573 GCTGTCAGATGGGCTCCCAGAGG - Intergenic
1086551847 11:88061779-88061801 AGTGACAGATGGGCTCCCAGAGG - Intergenic
1090847363 11:130542011-130542033 GGTCTCCCAGCAGCTCCCAGCGG - Intergenic
1096252906 12:50044760-50044782 GGGCTCCTATGGGCTCCCATGGG - Intergenic
1097490000 12:60254913-60254935 GCTCTCCGCTAGGCTCCCACTGG - Intergenic
1097572764 12:61355253-61355275 GGGCTCTGGGGGGCTCCCAGGGG - Intergenic
1103703062 12:122857995-122858017 GGTCTCAGCTGGGCTCCAACTGG + Intronic
1106332261 13:28750058-28750080 GGACTCTGATGGGCTGACAGAGG - Intergenic
1112052536 13:95657115-95657137 ATTCTCCGAGGGGCTCCCCGAGG - Intergenic
1113812947 13:113153409-113153431 GGTCTCCGCTGGGTTCCGACAGG + Intergenic
1114519782 14:23325878-23325900 GATCTCCGTTCCGCTCCCAGCGG + Exonic
1116381596 14:44275734-44275756 GGTCTCCTATGAGGACCCAGAGG - Intergenic
1118473275 14:66094322-66094344 GGGCTCTGAGGGACTCCCAGGGG + Intergenic
1119035985 14:71231074-71231096 GGCCTCCAGGGGGCTCCCAGGGG - Intergenic
1119650053 14:76376980-76377002 GGTCTCCGTGGGGCGCCCCGAGG + Intronic
1121922941 14:97899969-97899991 GGTCTGAGATGGGATCCAAGAGG + Intergenic
1122411840 14:101529553-101529575 TGTCCCCGGTGGGCTGCCAGGGG - Intergenic
1123932633 15:25179191-25179213 GGTTTCAGATGGGCTCCCTGAGG - Intergenic
1128719878 15:69940490-69940512 GGGCTCCAAGGGGCCCCCAGAGG - Intergenic
1132978513 16:2722189-2722211 GGTCACTGATGGGATCTCAGAGG + Intergenic
1133027929 16:2996764-2996786 GGTCTGCGTGGGACTCCCAGGGG + Intergenic
1134235975 16:12466792-12466814 GGTCCTCGGTGGGCTCCGAGGGG + Intronic
1145252399 17:21303823-21303845 GGGCTGGGATGGGCACCCAGTGG - Intronic
1150765526 17:67998873-67998895 TGGCTCCCAGGGGCTCCCAGAGG + Intergenic
1152119488 17:78409520-78409542 GCTCTCCCCTGGGCACCCAGTGG + Intronic
1156300515 18:35832428-35832450 GGTCTCTGATCATCTCCCAGGGG + Intergenic
1159953470 18:74502850-74502872 AGCCTCCTGTGGGCTCCCAGTGG - Intronic
1161379295 19:3956144-3956166 GGCCTCCGGTGGGGTCCCAGAGG + Intergenic
1162000179 19:7739516-7739538 CGTCTCCCAGAGGCTCCCAGGGG - Intergenic
1163690443 19:18735689-18735711 GGTCTGAGATGGGCCACCAGGGG - Intronic
1164517725 19:28950124-28950146 GGTCTCCCATGGGCACCCTCGGG - Intergenic
927979659 2:27366758-27366780 AGCCTCCTATGTGCTCCCAGAGG - Exonic
928540234 2:32277851-32277873 GCTCTCCCATTGGCTCCCGGAGG - Intergenic
933093019 2:78145638-78145660 GGGCTCCCGGGGGCTCCCAGGGG - Intergenic
935255735 2:101308330-101308352 GGTCTCCGCCGGGCGCCCACGGG + Exonic
937429280 2:121824981-121825003 GGTCTTCCATGGACTCCCAGGGG + Intergenic
940136400 2:150440795-150440817 GATGTCCCATGGGCTCCCAGTGG - Intergenic
946145688 2:217729329-217729351 GGTTTACTATGGGCTCCCTGGGG - Intronic
947459574 2:230292209-230292231 GGTCTCAGATGGGTGCCCTGTGG - Intronic
1168962235 20:1877436-1877458 CCTCTCCAATGGGCTGCCAGGGG - Intergenic
1172624766 20:36340726-36340748 GGTCTCCGGAGGGATGCCAGAGG - Intronic
1172924373 20:38517874-38517896 GGTCTCCGAGGGGCAGGCAGTGG - Exonic
1173396575 20:42686031-42686053 GGTCTTTGAGGGGGTCCCAGAGG - Intronic
1174475468 20:50793106-50793128 GGTCTGAGACCGGCTCCCAGGGG + Intergenic
1175996151 20:62813156-62813178 GGTCTCCGATGGGCTCCCAGGGG - Exonic
1179615216 21:42579214-42579236 GGCCTCCAAGGGGCTCCCAGTGG + Intronic
1181802389 22:25356074-25356096 GCTCTCCTCAGGGCTCCCAGGGG - Intronic
1183297759 22:37041871-37041893 TGTCCTAGATGGGCTCCCAGAGG + Intergenic
1184036422 22:41920280-41920302 GGACTCCGAAGGGCGCTCAGTGG - Intergenic
1185381258 22:50508367-50508389 GGTCGCGGATGGGCTGCAAGAGG - Exonic
955371038 3:58352202-58352224 GGTTCCAGAAGGGCTCCCAGGGG + Intronic
961452100 3:127006857-127006879 GCTCTCCTCTGGGCTCACAGTGG - Intronic
961543595 3:127617205-127617227 AGTCTCCGATGAGGTCCCAATGG - Intronic
961660744 3:128467671-128467693 GGTCTGCGTTGTACTCCCAGGGG + Intergenic
961787044 3:129353525-129353547 GGACTCTGCTGGGCACCCAGGGG + Intergenic
967805079 3:193708552-193708574 GGTCAGGGAAGGGCTCCCAGAGG - Intergenic
967873414 3:194250599-194250621 GGTCGCCGATGGGCTCTCGGAGG - Intergenic
968922040 4:3527311-3527333 GGTCTCCTAGGGCCTTCCAGTGG - Intronic
969078410 4:4599073-4599095 TGTCTCTGATGGGCTGCTAGTGG + Intergenic
985613015 5:900722-900744 GGTCTCTGAGGAGCTCCCTGAGG + Intronic
994572696 5:101534847-101534869 GGTCTCTGATGGGCTGCTGGAGG + Intergenic
999186938 5:149718209-149718231 GGGCTTCTATGGGCTGCCAGAGG - Intergenic
1001555236 5:172632577-172632599 GGGCTCAGTTGGGCTCCCTGGGG - Intergenic
1002598312 5:180338696-180338718 GGTCTCCCAGGGGCTTGCAGAGG + Intronic
1003184046 6:3815192-3815214 AGTCACTGATGGACTCCCAGAGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006924955 6:37648967-37648989 GGTCTCCGGTGAGCGTCCAGTGG - Exonic
1017552117 6:155520209-155520231 GGTCTTGGATGGCCTCACAGTGG - Intergenic
1018998957 6:168730879-168730901 GGCTTTCGAAGGGCTCCCAGAGG - Intergenic
1019333538 7:471901-471923 GGTCCCCTAGGGGCTCACAGTGG + Intergenic
1019560564 7:1654478-1654500 GATCCCCGAGGGGCTCACAGAGG + Intergenic
1021434348 7:20597439-20597461 GGTCTCTGATGAGCCCACAGAGG - Intergenic
1023965689 7:44962137-44962159 GGTCTCCCAAGGCCTCCCTGTGG + Intergenic
1025237497 7:57244780-57244802 GGTCTCTGCTGGGCTCCCGCTGG - Intergenic
1026482459 7:70790414-70790436 GGTCCCGGATGGGGTCCCAGTGG - Exonic
1027612433 7:80377785-80377807 GGCCTCCTATGGTCCCCCAGTGG - Intronic
1029864771 7:103615578-103615600 GATCCCTGATGGTCTCCCAGAGG - Intronic
1031400760 7:121323966-121323988 GTCCTCTGATGGGCTGCCAGAGG + Intergenic
1034210575 7:149358889-149358911 AGGCTCCGGGGGGCTCCCAGGGG + Intergenic
1036179064 8:6567641-6567663 GGCCTCCCATTGGCTCCCCGAGG - Intronic
1037948763 8:23005422-23005444 GGTCTCCAAAGGTGTCCCAGAGG - Exonic
1037988865 8:23306537-23306559 GGCCTCAGATTGGCTCCCAGGGG + Intronic
1037992185 8:23328840-23328862 GGTCCCCAATGGGCTCCCCAGGG - Intronic
1049036009 8:140076585-140076607 AGTTTCAGATGGGCACCCAGAGG - Intronic
1049482832 8:142835015-142835037 GGTCTCCCTGGGGCTCCGAGGGG - Intronic
1049534837 8:143174335-143174357 GGTCTCCAAAGGGCACCTAGGGG - Intergenic
1051418711 9:16870451-16870473 GATCCCCGCTGCGCTCCCAGTGG - Intronic
1051771164 9:20581622-20581644 AGTCTCTGATTGGCTGCCAGGGG - Intronic
1059002645 9:110366079-110366101 GGTCTCCTATGTGGTGCCAGTGG + Exonic
1061251349 9:129428297-129428319 GGTCTCTGCTGAGCCCCCAGTGG - Intergenic
1061911732 9:133728594-133728616 GGGCTCTGATGGGGTCTCAGGGG - Intronic
1200739392 Y:6836936-6836958 GGGCTCTGATGGGATCCCAGGGG - Intergenic