ID: 1175996184

View in Genome Browser
Species Human (GRCh38)
Location 20:62813246-62813268
Sequence CCCGCCCAGCAGGACCTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 4, 2: 1, 3: 19, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175996172_1175996184 4 Left 1175996172 20:62813219-62813241 CCGAGAGCCCATCGGAGACCCCA 0: 6
1: 0
2: 2
3: 9
4: 158
Right 1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG 0: 1
1: 4
2: 1
3: 19
4: 249
1175996171_1175996184 8 Left 1175996171 20:62813215-62813237 CCAGCCGAGAGCCCATCGGAGAC 0: 6
1: 0
2: 1
3: 4
4: 60
Right 1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG 0: 1
1: 4
2: 1
3: 19
4: 249
1175996169_1175996184 23 Left 1175996169 20:62813200-62813222 CCTGCAGGGGACGAGCCAGCCGA 0: 5
1: 0
2: 0
3: 17
4: 89
Right 1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG 0: 1
1: 4
2: 1
3: 19
4: 249
1175996174_1175996184 -3 Left 1175996174 20:62813226-62813248 CCCATCGGAGACCCCAGGCCCCC 0: 4
1: 3
2: 3
3: 13
4: 161
Right 1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG 0: 1
1: 4
2: 1
3: 19
4: 249
1175996175_1175996184 -4 Left 1175996175 20:62813227-62813249 CCATCGGAGACCCCAGGCCCCCG 0: 4
1: 3
2: 3
3: 21
4: 215
Right 1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG 0: 1
1: 4
2: 1
3: 19
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175996184 Original CRISPR CCCGCCCAGCAGGACCTGCA GGG Exonic
900121777 1:1051389-1051411 CCCGCCCCGGAGGCCCTGCTGGG - Intronic
900159790 1:1218108-1218130 CCCGCCCACCTGCACCTGCTGGG + Intronic
900429840 1:2596347-2596369 CTTTCCCAGCTGGACCTGCAGGG + Intronic
900463238 1:2811256-2811278 CCAGCCCAGTGGGCCCTGCAGGG + Intergenic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
901053198 1:6436027-6436049 CCCCGGCAGGAGGACCTGCAGGG - Intronic
901275201 1:7985949-7985971 CCCGCCCAGGAGGAACTGGGTGG - Intergenic
901416808 1:9122015-9122037 CCCCTCCACCAGGACCTCCATGG - Intronic
902246233 1:15122622-15122644 CCTGCCCAGCCCCACCTGCAGGG - Intergenic
903685769 1:25130815-25130837 GCAGCCCAGCAGGGCCTTCAGGG - Intergenic
905849952 1:41266442-41266464 CCAGCCCAGCAGGACTTTCTAGG - Intergenic
908288945 1:62641632-62641654 CCAGCCCAGCAGTACCTGCTTGG + Intronic
913149928 1:116031486-116031508 CCCAGCCAACAGGAGCTGCAGGG + Exonic
919486918 1:198157309-198157331 CCCTCCCGGCAGGAGCTGCCCGG - Intronic
920314968 1:205070497-205070519 CCCGTGCAGCAGGACATGAATGG + Exonic
921917506 1:220628548-220628570 CCCGCACAGCATGACATGGAAGG - Intronic
1067232557 10:44422391-44422413 CCAGCCTAGCTGGACCTGTAGGG - Intergenic
1067836632 10:49645561-49645583 CCCACCCGGCAGGACCTGTTGGG - Intronic
1070818736 10:79342342-79342364 CCTGGTCAGCAGGACCCGCAAGG - Intergenic
1071118607 10:82252007-82252029 CCCACCCAGCCTGCCCTGCATGG + Intronic
1071708999 10:88030595-88030617 GCCACCCAGCAGGACATGGAGGG - Intergenic
1072267391 10:93743864-93743886 CCAGCCTACCAGGACCTGTATGG - Intergenic
1073509480 10:104034320-104034342 TGCGCACATCAGGACCTGCAGGG + Exonic
1074539039 10:114349858-114349880 CCCGCCAAGCCTGGCCTGCAAGG + Intronic
1074555897 10:114489663-114489685 CCTGCTCAGCAGAACCTTCACGG - Intronic
1076221092 10:128733749-128733771 CCCGCCCTGCAGCAGGTGCATGG - Intergenic
1076613699 10:131742882-131742904 CCCTCCCACAAGGACCTGCCAGG - Intergenic
1076661812 10:132060308-132060330 CCCGCCCACCAGAACCTGCCTGG - Intergenic
1077219090 11:1407481-1407503 CCTGCCCTGCATGACCTTCAAGG + Intronic
1077541257 11:3147504-3147526 CCGTCCCAGCTGGGCCTGCACGG - Intronic
1077580433 11:3413823-3413845 CACGCCCACCCGGGCCTGCATGG - Intergenic
1078670869 11:13364018-13364040 CCTGCCCAGCATTACCTCCAGGG + Intronic
1079182735 11:18208268-18208290 ACAGCCCAGCAGCAGCTGCATGG + Intronic
1079695561 11:23478010-23478032 CCCACCCATCAGGACCTGGGAGG - Intergenic
1083775176 11:64891120-64891142 GCCAGCCACCAGGACCTGCAGGG - Intergenic
1084237361 11:67796652-67796674 CACGCCCACCCGGGCCTGCATGG - Intergenic
1084835042 11:71796176-71796198 CACGCCCACCCGGGCCTGCATGG + Intronic
1089198892 11:116711425-116711447 CCAGACCAGCAGGTCCTCCATGG + Intergenic
1089200903 11:116724190-116724212 CCCGCCCCGCAGGCACTTCAGGG + Intergenic
1090282548 11:125468694-125468716 CCGGCCCAGCAGGCTCAGCAGGG + Intronic
1090387417 11:126365041-126365063 CCTGCCCAGGAGGAGCTGAAGGG - Intronic
1090389983 11:126382239-126382261 CCTGCCCAGGAGGAGCTGAAGGG - Intronic
1090837048 11:130461477-130461499 CCCACCCGGCAGGACCTGTGTGG + Exonic
1091582135 12:1796630-1796652 CCCGCGCAGCACGACGCGCAGGG + Intronic
1094828668 12:34289906-34289928 CCTACCCAGCAGTCCCTGCATGG - Intergenic
1094829811 12:34294919-34294941 CCTTCCCAGCAGGCCCTGCGTGG - Intergenic
1094829895 12:34295303-34295325 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1094831309 12:34301558-34301580 CCTTCCCAGCAGCACCTACAGGG + Intergenic
1094831688 12:34303224-34303246 CCTTCCCAGCAGTCCCTGCACGG + Intergenic
1094831836 12:34303856-34303878 GCCTCCCAGCAGCACCTGCATGG + Intergenic
1094833617 12:34312051-34312073 CCTCCCCAGCAGAACCTGTATGG - Intergenic
1094833660 12:34312262-34312284 CCTTCCCAGCAGTCCCTGCACGG - Intergenic
1094835310 12:34319415-34319437 CCTTCCCAGCAGCCCCTGCACGG - Intergenic
1094836611 12:34325066-34325088 CCTTCCCAGCAGCCCCTGCACGG - Intergenic
1094837724 12:34329965-34329987 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1095775439 12:46004594-46004616 CCTGCCCAGCAGTACTTGCTTGG + Intergenic
1095976355 12:47943155-47943177 CCAGGACAGCAGGACCTTCAGGG + Intergenic
1096244308 12:49975704-49975726 CCTGCCTTGCAGGACCTGCCTGG + Exonic
1102349724 12:112183630-112183652 CTCTCCCAGCAGGCTCTGCAAGG - Intronic
1103944474 12:124518393-124518415 CCGGCCCTGGAGGCCCTGCAGGG + Intronic
1103961092 12:124609738-124609760 CCCAGCCAGAAGGACCTGCCAGG - Intergenic
1104320351 12:127745050-127745072 CCCGCACAGCCGGTTCTGCATGG - Intergenic
1104969093 12:132523146-132523168 CACTCCCAGCAGGAGCTGGAGGG - Intronic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1119407808 14:74409639-74409661 CCCACCCAGCTGGTCCTGCCAGG - Exonic
1120555238 14:85921417-85921439 CCAGGCCAGCAGCAGCTGCATGG - Intergenic
1120881202 14:89416733-89416755 CCCTCCCCCCAGGACCTGCGGGG + Intronic
1122278704 14:100609067-100609089 GCCACCCAGCAGGACCAGCGAGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122630162 14:103104059-103104081 CCCGCCCAGCCTGACCCGCCCGG - Intronic
1122782006 14:104147650-104147672 CCTGGACAGCAGGACCTGCGAGG + Intronic
1125679192 15:41520360-41520382 TCAGCCCAGCAGGACCTGCAAGG - Intronic
1127104129 15:55595197-55595219 CCAGCACTGCAGGACCTGGAAGG + Intergenic
1127953628 15:63834032-63834054 CCCGCCCAACAGGCCCAGCGCGG + Intergenic
1129220701 15:74130148-74130170 CCTTCCCAGCACGCCCTGCAGGG + Intronic
1129458317 15:75687480-75687502 CCCATCCAGCAGGTCCTGCTGGG + Exonic
1129725464 15:77899385-77899407 CCCATCCAGCAGGTCCTGCTGGG - Intergenic
1130486848 15:84402873-84402895 CCCAACCAGCAGGTCCTGCTGGG + Intergenic
1130532738 15:84759840-84759862 CCCAGCCAGCAGGACCACCAAGG - Intronic
1132756117 16:1486302-1486324 GCCGTCCAGCAGCAGCTGCAAGG + Exonic
1132756534 16:1488003-1488025 CCCGCCCAGCCGGCCCGGCCCGG - Intronic
1132870563 16:2114024-2114046 GCCAGCCAGCAGGACCTGCCCGG + Intronic
1133284370 16:4683774-4683796 CCTGCCCAGAGGGACCTGCCGGG + Intronic
1133348975 16:5089075-5089097 CACGCCCACCCGGGCCTGCATGG - Intronic
1134521969 16:14922880-14922902 GCCAGCCAGCAGGACCTGCCCGG - Intronic
1134709639 16:16321531-16321553 GCCAGCCAGCAGGACCTGCCCGG - Intergenic
1134716852 16:16361560-16361582 GCCAGCCAGCAGGACCTGCCCGG - Intergenic
1134949964 16:18347114-18347136 GCCAGCCAGCAGGACCTGCCCGG + Intergenic
1134957900 16:18390599-18390621 GCCAGCCAGCAGGACCTGCCCGG + Intergenic
1135424529 16:22325749-22325771 CCCTCCCCGCAGGGCCTGCCGGG + Exonic
1135424531 16:22325753-22325775 CCAGCCCGGCAGGCCCTGCGGGG - Exonic
1135597204 16:23754000-23754022 GCAGCCCAGCAGGGCCTACAAGG + Intergenic
1136173404 16:28502072-28502094 CCCTCCCAGCAGGGCATGGAAGG + Exonic
1136590923 16:31217157-31217179 CCCTCCCAGCAGGAGCCACAGGG - Exonic
1137549498 16:49427589-49427611 CCCTCCCAGTAGGAGCTCCAAGG + Intergenic
1137675131 16:50300390-50300412 CCTGCCCAGCAGCACCGGCTGGG - Intronic
1138344509 16:56311770-56311792 CCCGCCCAGCACGGCCCGCTGGG + Intronic
1138352996 16:56356433-56356455 GCCCCCCAGCAGGAGCTCCAGGG - Intronic
1139388464 16:66589476-66589498 CCCCACCTGAAGGACCTGCAGGG - Intergenic
1139476309 16:67204212-67204234 CCCTCCCTGCAGGCCCAGCATGG - Intergenic
1141605039 16:85147970-85147992 CCCGCGCAGCTGGGACTGCAGGG + Intergenic
1141609121 16:85171200-85171222 CCTGCCCAGGAAGCCCTGCACGG - Intergenic
1141908192 16:87041386-87041408 CACGCCCCGCAGGACCTGCCTGG + Intergenic
1142142593 16:88479200-88479222 CCAGCCCAGCACCACCTGCGTGG - Intronic
1142187478 16:88701404-88701426 CACTCCCCGCAGAACCTGCAGGG + Exonic
1142509431 17:385079-385101 CGCGCCCACCAGGGTCTGCAGGG + Intronic
1142954602 17:3513034-3513056 GCGGCCCAGCAGGACTTGCCCGG + Intronic
1143044901 17:4070035-4070057 GCCGCCTAGCAGGACCCACACGG - Intronic
1144777717 17:17793204-17793226 CCCACACAGCAAGGCCTGCAGGG + Exonic
1145761795 17:27429674-27429696 CCAGCCCAGAAAGGCCTGCATGG + Intergenic
1146256146 17:31392275-31392297 ACCGCTCAGAAGGACCTGCATGG - Intronic
1148615755 17:48998409-48998431 GCCCTCCAGCAGGACTTGCAAGG + Intronic
1149997943 17:61414656-61414678 TCAGCCCAGCTGGGCCTGCAAGG + Intergenic
1151833399 17:76568983-76569005 CCCGCTCACCAGGACCTCCACGG + Intronic
1151946328 17:77321902-77321924 TCCGCCCAGCAGGAGCCGCAGGG + Intronic
1151975001 17:77479740-77479762 CCTCCCCAGCAGGACCTGGGGGG - Intronic
1152538996 17:80965453-80965475 CCCGCCCAGGAGGGGCCGCAGGG + Exonic
1152568131 17:81109248-81109270 ACGGCCCAGCAGGTCCTGCCTGG - Intronic
1153147270 18:2047716-2047738 CCTGCCCAGCAGGAGTAGCAGGG + Intergenic
1156308911 18:35904920-35904942 CCCGACCTGCAGCACCTGCCTGG + Intergenic
1159448180 18:68565993-68566015 CGCGACCAGCCTGACCTGCATGG + Intergenic
1160561887 18:79764155-79764177 ACCACCCACCAGGCCCTGCAGGG - Intergenic
1160566268 18:79788345-79788367 CCCGCCCGGCAGGCCCAGCTCGG + Intergenic
1160874672 19:1291476-1291498 CACCCCCAGCAAGACCTGCTGGG - Intronic
1161297482 19:3527151-3527173 CTCGCCCACCAGGACCCGCAGGG - Intronic
1161343325 19:3754227-3754249 CCCGCCCACCAGCACGCGCATGG - Exonic
1162042233 19:7977919-7977941 TCTGAGCAGCAGGACCTGCAGGG - Intronic
1162967080 19:14161115-14161137 CCCCACCTGCAGAACCTGCAGGG - Intronic
1163639658 19:18454638-18454660 CCCGACCAGCCTGGCCTGCATGG + Intronic
1164522990 19:28992882-28992904 CCTCCCCAGGAGGCCCTGCATGG + Intergenic
1165112903 19:33512641-33512663 CCCGCCCTGCAGGACCACGATGG + Exonic
1166230905 19:41425493-41425515 CCCTCCCATCAAGACCTGGAAGG + Exonic
1167149668 19:47701614-47701636 CCCGCCCATCAAGACCTACGAGG + Exonic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
925203526 2:1988117-1988139 CCAGCCCAGCTGCACCTACAGGG + Intronic
925203540 2:1988170-1988192 CCAGCCCAGCTGCACCTACAGGG + Intronic
925413241 2:3652165-3652187 GCCGCCCACCACGACCTGCAAGG + Intergenic
925684855 2:6459587-6459609 CCATCCCACCAGGACCTTCAGGG - Intergenic
927937409 2:27083483-27083505 TCAGCCCTGCAGGCCCTGCAAGG + Exonic
932083007 2:68732417-68732439 CCGGCCCAGCAGCATCTCCACGG - Intronic
932700232 2:73986428-73986450 GCCGTCCAGCCGGACCTGCCAGG + Exonic
933379583 2:81525899-81525921 CCTGACCAGCAGAACCTACAGGG - Intergenic
934033795 2:88071603-88071625 CCCTTCCAGCAGGTCCTCCAGGG + Intronic
934715683 2:96542003-96542025 CCAGGCAGGCAGGACCTGCATGG - Intronic
935541069 2:104350191-104350213 CCAGTCCAGCAGGAAGTGCAGGG + Intergenic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
938038605 2:128056951-128056973 CAAGCCCAGCAGGACCTACTGGG + Intergenic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
947167382 2:227276421-227276443 CAGGCCCACCAGGACCTCCAGGG + Exonic
947713733 2:232329878-232329900 CCGGCGCAGCAGGGCCTGCTCGG - Exonic
948701251 2:239761850-239761872 CCCTTCCTCCAGGACCTGCAAGG - Intergenic
948869831 2:240792329-240792351 CCAGCCCAGCAGGCCCTGGGAGG - Intronic
948887469 2:240891440-240891462 CCCAGCCAGGAGGATCTGCAGGG - Intronic
1169091352 20:2863079-2863101 CCTGTCCAGCAGCACCTGGATGG - Exonic
1173719805 20:45246325-45246347 GCAGCCCAGCAGCCCCTGCACGG - Intergenic
1173809669 20:45948232-45948254 CTCCCCCAGCAGGGCCTGTATGG + Intergenic
1174136942 20:48386277-48386299 CACACCCAGCAGCTCCTGCATGG + Intergenic
1174147367 20:48461292-48461314 CCCGCACAGCCGGCTCTGCATGG - Intergenic
1175188208 20:57194049-57194071 CATCCCCAGCAGGAGCTGCAGGG - Intronic
1175224750 20:57438678-57438700 CCAGCCCAGCAGGAGAGGCAGGG - Intergenic
1175396692 20:58669313-58669335 CCGGCTCGGCAGGGCCTGCACGG - Exonic
1175996165 20:62813186-62813208 CCAGCCCAGCAGGACCTGCAGGG + Exonic
1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG + Exonic
1175996205 20:62813306-62813328 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996225 20:62813366-62813388 CCAGCCCGGCAGGACCTACAAGG + Exonic
1175996245 20:62813426-62813448 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996266 20:62813486-62813508 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996286 20:62813546-62813568 CCAGCCCGGCAGGACCTACAAGG + Exonic
1176132684 20:63502936-63502958 CCCGGGCAGCAGGGCCTGGAGGG - Intergenic
1176232806 20:64040638-64040660 GCCGCCCAGGAGGTCATGCATGG - Intronic
1176429310 21:6566438-6566460 TCCCTCCAGCAGGACCTGCCCGG + Intergenic
1178414633 21:32393540-32393562 CCCGCACAGGCGGACCTGCCTGG - Exonic
1178496524 21:33090748-33090770 CCTGCCCTGGAGGACATGCAAGG - Intergenic
1179231084 21:39504375-39504397 CTAGCCCAGCGTGACCTGCAAGG - Intronic
1179704702 21:43173900-43173922 TCCCTCCAGCAGGACCTGCCCGG + Intergenic
1179800842 21:43810890-43810912 CCTGCCCTCTAGGACCTGCATGG + Intergenic
1180004611 21:45014569-45014591 CCCGCCGAGCAGGGCCTGGTTGG + Intergenic
1180083283 21:45496507-45496529 CCGGCCCCCCAGGACCTCCAGGG + Exonic
1182301722 22:29340765-29340787 CCCGCCCAGGGCGACCTGCTGGG - Exonic
1182317243 22:29456132-29456154 CCAGCCCTGCAGGACCTTCTGGG - Intergenic
1184472668 22:44704529-44704551 CCCTCCCCGCGGCACCTGCAGGG + Intronic
1185100128 22:48835903-48835925 CCCGCCCAGCGAGTCCTGGAAGG - Intronic
1185340867 22:50290537-50290559 TGCGCCCAGCAGGCCCAGCAGGG + Exonic
1185397492 22:50600486-50600508 CCCGCCCTGGAGGACCCGCGCGG - Intronic
949468549 3:4369409-4369431 CCCGACGAGTAGGCCCTGCATGG - Intronic
951813585 3:26728099-26728121 CCCACCCAGCATGTTCTGCAGGG + Intergenic
952968567 3:38636625-38636647 CCCGCCCACCAGGAGCAGCCTGG - Intronic
953947903 3:47164518-47164540 CCCGGCGGGCAGGTCCTGCAGGG - Intergenic
954361055 3:50123065-50123087 CCTGCCCAGCCTGTCCTGCAGGG + Intergenic
957053304 3:75426418-75426440 CACGCCCACCTGGGCCTGCATGG - Intergenic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
961321249 3:126078048-126078070 ACCTCCCTGAAGGACCTGCAGGG + Intronic
961886944 3:130102732-130102754 CACGCCCACCCGGGCCTGCATGG - Intronic
963917293 3:150870822-150870844 CCCCCACACCAGGGCCTGCATGG - Intergenic
966867947 3:184271095-184271117 CCAGCTCAGCAGGAGCTGGATGG - Intronic
968052640 3:195665876-195665898 CACGCCCAGCAGTACCAACAAGG - Intergenic
968103172 3:195982478-195982500 CACGCCCAGCAGTACCAACAAGG + Intergenic
968514619 4:1011045-1011067 CTCGCCCAGCCGGAGCTGCTGGG - Exonic
968585914 4:1416050-1416072 CCCCACCAGCAGGCCCAGCATGG + Intergenic
968620787 4:1602677-1602699 CCCGCCAGGCAGGAGCTGCGAGG + Intergenic
968671621 4:1855451-1855473 ACCGGCGAGCAGGACCTGCTGGG - Intronic
968911464 4:3478774-3478796 ACAGCCCAGCAGGGCCTGCTGGG - Intronic
968996102 4:3946736-3946758 CACGCCCACCCGGGCCTGCATGG - Intergenic
969757881 4:9161962-9161984 CACGCCCACCCGGGCCTGCATGG + Intergenic
972804312 4:42512472-42512494 CCTGCCCAGAAGCACCTGCTTGG - Intronic
978069365 4:104447567-104447589 CTCACCCAGCAGGATCTGCAAGG + Intergenic
979014742 4:115419093-115419115 GCTGGCCAGCAGGACATGCAGGG - Intergenic
979189180 4:117835293-117835315 CCCTCATCGCAGGACCTGCAAGG - Intergenic
983380242 4:166982097-166982119 CCCGCCCTGCTGAACCAGCAGGG + Intronic
986798875 5:11239647-11239669 CGAGCCCAGCAGGGCCTCCAAGG - Intronic
990165574 5:52989664-52989686 CCCAGCCACCAGGACCTGCTTGG + Intronic
991169487 5:63604353-63604375 CCAGCCCAGCAGCAGCTTCAGGG - Intergenic
992146982 5:73860478-73860500 CACGCCCAGCAGGACATACTTGG + Intronic
994825658 5:104710171-104710193 CCCTTCCTGCTGGACCTGCAAGG + Intergenic
1002307374 5:178291722-178291744 CTCACCCACCAGCACCTGCATGG - Intronic
1002443155 5:179274704-179274726 GCCGCCCAGCAGGCCCTGGGGGG - Intronic
1002716513 5:181231458-181231480 CCATCCCAGCAGGACCTGCTGGG - Intronic
1002756141 6:162006-162028 ACCTCACACCAGGACCTGCAGGG + Intergenic
1005463613 6:26091323-26091345 ACAGCCCAGGATGACCTGCAGGG - Exonic
1006078301 6:31548376-31548398 CCTGCCCACCAGGACCGCCATGG + Exonic
1007018588 6:38495747-38495769 CCCGCCCAGATGCACCTGCACGG - Intronic
1007622356 6:43222879-43222901 CTCACCCAGGAGGATCTGCAGGG - Exonic
1009808800 6:68635419-68635441 TCCGTCCATCAGTACCTGCAGGG + Exonic
1012265062 6:97131729-97131751 CTCCCCCAGCAGCAGCTGCAAGG - Intronic
1013164172 6:107574927-107574949 CTCACCCACAAGGACCTGCAAGG + Intronic
1016822693 6:148361400-148361422 CCAGCCCAGCCTGACCAGCATGG + Intronic
1017845575 6:158255182-158255204 CCCCTCCAGCAACACCTGCAGGG - Intronic
1017882565 6:158572090-158572112 TGCCCCCAGCAGGGCCTGCATGG - Intronic
1018728151 6:166628994-166629016 CCCTCCCAGCAGAACCTTAAAGG - Intronic
1018832770 6:167457709-167457731 CCCGCCCAGCAGGAGCTCTGGGG + Intergenic
1018905265 6:168072209-168072231 CCCTCCCAGCAGGGGGTGCAGGG - Intronic
1019429220 7:991027-991049 CCCGCCCTCCCGGCCCTGCAGGG + Intergenic
1019617767 7:1973965-1973987 CCCGCCCAGCAGCATCAGCGTGG - Intronic
1019635884 7:2075331-2075353 CCCACCCCTCAGGCCCTGCAGGG + Intronic
1019643240 7:2115764-2115786 CCTGCCGCGCATGACCTGCATGG + Intronic
1019670977 7:2278178-2278200 CCTGGCCAGCAGCTCCTGCAGGG + Exonic
1020187604 7:5970779-5970801 CCCGGCCTTCAGGACCAGCAAGG - Intergenic
1020295313 7:6753991-6754013 CCCGGCCTTCAGGACCAGCAAGG + Intergenic
1020320377 7:6935146-6935168 CACGCCCACCCGGGCCTGCATGG - Intergenic
1026586478 7:71660115-71660137 CCAGCCCAGTAGGCCCTGAATGG + Intronic
1026898068 7:74021985-74022007 CCCGCCCTGCAGGACCCGCCTGG + Intergenic
1029309130 7:99644935-99644957 CCCACCCAGCAGGAGCAGGATGG + Intergenic
1029976039 7:104834732-104834754 CTCCGCCTGCAGGACCTGCATGG - Intronic
1034878815 7:154748565-154748587 CCCGCCCCGCAGGGCTCGCAGGG - Intronic
1036710909 8:11077941-11077963 CCTGCCCAGCAGGGCCAGCCCGG - Intronic
1037897888 8:22670246-22670268 GGGGCCCAGCAGCACCTGCACGG - Intergenic
1038455405 8:27669412-27669434 CCACCCTGGCAGGACCTGCAGGG - Intronic
1040107461 8:43548786-43548808 CCTTCCCAGCAGGCCCTGCGTGG - Intergenic
1040275803 8:46013061-46013083 CCTTCCCAGCAGCCCCTGCATGG - Intergenic
1041106983 8:54453922-54453944 CCCGCACTGCAGCATCTGCAGGG + Intergenic
1041561795 8:59226495-59226517 CCAGGCCTGCAGGACCTGCCTGG - Intergenic
1042827584 8:72994154-72994176 CCCGCACAGCAGGAGGTGGACGG - Intergenic
1049374081 8:142280858-142280880 GCAGCCCAGCAGGCCCTGTATGG + Intronic
1049399493 8:142418602-142418624 CCCGCCCACCAGGAGCTTCAGGG - Intergenic
1049593020 8:143471226-143471248 CGCGCCCACCAGGCCCTCCAGGG + Intronic
1049832497 8:144710951-144710973 ACTCCCCAGCAGGGCCTGCAAGG - Intergenic
1056954718 9:91072864-91072886 CTAGCCCAGCAGGACATGTATGG + Intergenic
1057312779 9:93952314-93952336 GCCGCCCTGCAGCACCTGCACGG + Exonic
1059634396 9:116157199-116157221 CCCGCCTACCAGGAGCGGCAAGG - Intronic
1061509565 9:131052338-131052360 CCTGCACAGCAGACCCTGCAGGG - Intronic
1062036427 9:134384611-134384633 GCCCCCCAGCACGCCCTGCATGG - Intronic
1062383742 9:136299988-136300010 CCTGCCCTGCAGGGCCTGCCTGG + Intronic
1062425814 9:136505719-136505741 CCCGGCCAGCAGCCCCTGCCTGG - Exonic
1062521886 9:136961393-136961415 CCCACCCACCAGGGCCTGCAGGG + Intergenic
1062541323 9:137042959-137042981 CCCTTCCAGGAGGACCAGCAAGG - Exonic
1185931297 X:4206193-4206215 TCAGCCCAGGTGGACCTGCATGG - Intergenic
1191253452 X:58269933-58269955 CCTTCCCAGCAGCCCCTGCATGG - Intergenic
1191650150 X:63528769-63528791 ACCCCCCAGCAGCAGCTGCATGG + Intergenic
1193416957 X:81237384-81237406 CCCGACCAGCAGCAGTTGCATGG + Intronic
1194285914 X:92009903-92009925 CCAGCCCAGCCTGACCAGCATGG - Intronic
1200603468 Y:5234444-5234466 CCAGCCCAGCCTGACCAGCATGG - Intronic
1201575969 Y:15461435-15461457 CCCTCCCTCCAGGACCTGCGAGG + Intergenic