ID: 1175999144

View in Genome Browser
Species Human (GRCh38)
Location 20:62824367-62824389
Sequence ACGCAGGGGTCAGCGCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175999144_1175999151 2 Left 1175999144 20:62824367-62824389 CCCGCGGGCGCTGACCCCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1175999151 20:62824392-62824414 GACGTCCTGCTCTGTTTGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 152
1175999144_1175999150 -2 Left 1175999144 20:62824367-62824389 CCCGCGGGCGCTGACCCCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1175999150 20:62824388-62824410 GTCGGACGTCCTGCTCTGTTTGG 0: 1
1: 0
2: 0
3: 3
4: 34
1175999144_1175999156 8 Left 1175999144 20:62824367-62824389 CCCGCGGGCGCTGACCCCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1175999156 20:62824398-62824420 CTGCTCTGTTTGGCTGGGAGGGG 0: 1
1: 0
2: 4
3: 43
4: 439
1175999144_1175999152 3 Left 1175999144 20:62824367-62824389 CCCGCGGGCGCTGACCCCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1175999152 20:62824393-62824415 ACGTCCTGCTCTGTTTGGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 100
1175999144_1175999155 7 Left 1175999144 20:62824367-62824389 CCCGCGGGCGCTGACCCCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1175999155 20:62824397-62824419 CCTGCTCTGTTTGGCTGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 289
1175999144_1175999153 6 Left 1175999144 20:62824367-62824389 CCCGCGGGCGCTGACCCCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1175999153 20:62824396-62824418 TCCTGCTCTGTTTGGCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175999144 Original CRISPR ACGCAGGGGTCAGCGCCCGC GGG (reversed) Intronic
919075568 1:192808909-192808931 GGGGATGGGTCAGCGCCCGCCGG - Intergenic
921562017 1:216670534-216670556 ACGCAGGGGACGGCTCCAGCTGG - Intronic
1063117546 10:3082523-3082545 AGGCAGGGGTGAGCGAGCGCCGG - Intronic
1064769641 10:18710631-18710653 GGGCAGGGGTCAGCGTCCCCGGG - Intergenic
1070814669 10:79315196-79315218 ACGCACGGTTCAGAGCCAGCCGG - Exonic
1076060275 10:127408512-127408534 TCACAGGAGTCAGCGCCCGGCGG + Intronic
1077467490 11:2740471-2740493 ACCCAGAGGACAGCGCACGCGGG + Intronic
1078164519 11:8870939-8870961 ACGCAGAGGTAAGCGCCTCCGGG - Intronic
1079353446 11:19712599-19712621 ACGCAGGGGTGTGGGCCCCCCGG + Intronic
1087977212 11:104564995-104565017 GAGCAGGGGGCAGCGCCCGCCGG + Intergenic
1091979543 12:4854002-4854024 ACGCAGAGGGCAGGGCCAGCTGG - Intergenic
1097166562 12:57089312-57089334 GCGGAGGGGACAGCGCCCGCCGG + Exonic
1103252083 12:119508671-119508693 AGGCAGGGGCCAGAGCACGCAGG + Intronic
1110318425 13:74135032-74135054 GCGCGGGGGGCACCGCCCGCGGG - Intergenic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1118599873 14:67464453-67464475 AGGCAGGGGTCAGAGCCTGTAGG - Intronic
1121816363 14:96932041-96932063 AAGCAGCGGTCAGGGCCCGGCGG + Intergenic
1121974881 14:98393754-98393776 AAGCATGGGTCAGGGCCAGCTGG + Intergenic
1122577499 14:102751362-102751384 GTGCAGGGTGCAGCGCCCGCCGG + Intergenic
1123031806 14:105455469-105455491 ACGCAGGGCTCTGCCCCCGAGGG + Intronic
1126196589 15:45938251-45938273 AGGCAGGGGTCAGCGGCTGCAGG + Intergenic
1130224562 15:82047003-82047025 ACGCAGGCCACAGCGCCAGCGGG + Intergenic
1132510923 16:341019-341041 ACAGAGGGGTCAGCACCCGAGGG + Intronic
1132900410 16:2251250-2251272 CCGCGGGGGTCCGCGCTCGCGGG - Intronic
1132939090 16:2498204-2498226 GAGCAGGGGTCAGAGCCCGAAGG - Intronic
1137496454 16:48972777-48972799 ACTCAGGAGTCAGAGCCCACAGG + Intergenic
1141891083 16:86926811-86926833 ACTTAGGTGTCAGCGCCTGCAGG + Intergenic
1143496453 17:7315359-7315381 ACGCAGGGGCCAGGGCGCGTCGG - Exonic
1143498428 17:7325327-7325349 CCTCGGGGGACAGCGCCCGCAGG + Exonic
1147725485 17:42564083-42564105 AGGGAGGGGTCAGAGCCAGCGGG - Exonic
1150388541 17:64778344-64778366 TCGCTGAGGACAGCGCCCGCAGG - Intergenic
1157476271 18:48025481-48025503 ACCCAGGGGTCAAGGCCCACTGG + Intergenic
1160680298 19:409049-409071 ACGCAGGGGTCTCGGCGCGCAGG + Exonic
1160893056 19:1389503-1389525 ACGGAGGGGTCATCTCCAGCAGG - Intronic
1163116054 19:15189159-15189181 TCGCAGGGGTTGGCGCCTGCCGG + Exonic
1165244948 19:34493454-34493476 ACTGAGGGGTCAGCGCGGGCAGG - Intronic
1165460120 19:35939452-35939474 AGGCAGGGGCCAGCGGCAGCAGG - Exonic
1166104064 19:40589046-40589068 GGGCAGGGGTCAGGGCCAGCTGG - Intronic
1166137357 19:40785893-40785915 AGACAGGGGTCAGAGCCAGCAGG + Intronic
1166231039 19:41425980-41426002 AGGCAGGTGGCAGGGCCCGCAGG + Exonic
1166775103 19:45307668-45307690 GACCAGGGGTCAGCGCCGGCAGG + Intronic
1167430815 19:49453434-49453456 ACGCAGCGAGCAGCGCCGGCCGG - Intronic
1167647173 19:50712054-50712076 ACAGAGGGGTCAGCCCCCGACGG + Exonic
1167738834 19:51312047-51312069 ACGCCGGGGTCTGGGCCCGGGGG + Intronic
1168309652 19:55454085-55454107 ACGCAGGAGTCAGAGCCCAGAGG - Intronic
1168475475 19:56671918-56671940 CCCCAGGGGTCAGCGCCCTGCGG - Intergenic
926119881 2:10236131-10236153 AGGCAGGGGACAGTGCCCACTGG - Intergenic
927477272 2:23423405-23423427 AAGCAGGGGACAGCCCGCGCAGG - Intronic
938166005 2:129027591-129027613 ACCCAGGTGTCAGCCCCTGCAGG + Intergenic
939085724 2:137716111-137716133 GAGCAGGGGGCGGCGCCCGCTGG - Intergenic
939275152 2:139990736-139990758 AAGCAGGGGGCAGCGCTCGTTGG + Intergenic
948139233 2:235660558-235660580 AAGAAGGGGTCAGGGCCAGCAGG + Intronic
948384132 2:237571156-237571178 ACGCAGGTGTCAGGGGCGGCGGG + Intergenic
1171882730 20:30630584-30630606 GTTCAGGGGTCAGCGCCCGCTGG - Intergenic
1172837530 20:37882613-37882635 ACGGAGGGGTCAGCGCAGCCCGG + Intergenic
1175216293 20:57393070-57393092 ACGCAGGTGTCAGCAGCCACTGG - Intronic
1175999144 20:62824367-62824389 ACGCAGGGGTCAGCGCCCGCGGG - Intronic
1176118565 20:63444030-63444052 GGGCAGGGGTCAGCCCCCGGTGG - Intronic
1179968293 21:44818936-44818958 ACGCAGGGGTGTCCGCCCTCAGG - Intergenic
1180044088 21:45294880-45294902 ACTCAGCGGTCAGGGCCTGCTGG - Intergenic
1180064405 21:45405345-45405367 AGGCACGGGTCAGACCCCGCAGG - Intronic
949818781 3:8092450-8092472 AGGCAGGGGTCTGCTCCTGCTGG + Intergenic
952816467 3:37452018-37452040 GCGCAGGGCTCACGGCCCGCAGG + Intergenic
954628557 3:52036033-52036055 ACGCAGGGGTCAGGCCCAGAAGG - Intergenic
962816597 3:139006147-139006169 ACGCGGGGTTCGGGGCCCGCGGG + Exonic
967055647 3:185826164-185826186 GCGCTGGGGTCAGCGGCCGGGGG + Intergenic
969239360 4:5888749-5888771 ACGGCGCGGTCAGGGCCCGCGGG + Intronic
973817635 4:54632854-54632876 GAGCAGGGGTCAGCGCTCGTGGG - Intergenic
974016804 4:56655816-56655838 AGGCAGGGGTCGGGGCGCGCTGG + Intronic
979558564 4:122077650-122077672 ACTCAGGGGTCATCGCCAACTGG + Intergenic
979678562 4:123435406-123435428 GAGCAGGGGTCAGCGCCCGTCGG + Intergenic
982075325 4:151731911-151731933 AGGTGGGGGTCAGCCCCCGCCGG + Intronic
984805297 4:183746481-183746503 AGGCAGGGGGCCGTGCCCGCTGG + Intergenic
985545786 5:508347-508369 ACGCAGGCCTCAGCGCGCCCGGG + Intronic
996496678 5:124165066-124165088 ACGCTGGGGTCAGAGCCCACTGG - Intergenic
1001907423 5:175484526-175484548 CCGCAGGGGTCAGGGCTGGCCGG - Intronic
1002195191 5:177497400-177497422 AGGCAGGGGCCAGGGCCAGCGGG + Intronic
1002556497 5:180045996-180046018 GAGCAGGGGGCAGCGCTCGCCGG + Intronic
1002817748 6:694900-694922 AAGCAGGGGGCAGCGCTCGTCGG - Intergenic
1003498052 6:6681689-6681711 GCGCTGGGGTCAGCCCCAGCTGG + Intergenic
1014167397 6:118240890-118240912 AGGCAGGGATCAGCCCCCACAGG + Intronic
1015626255 6:135182747-135182769 GCGCGGGGACCAGCGCCCGCAGG - Intronic
1018767750 6:166947039-166947061 ACTCTGGGGTCAGCCCCGGCTGG + Intronic
1024548878 7:50543953-50543975 CGGCAGGGATCAGCGGCCGCAGG + Exonic
1029495950 7:100895594-100895616 ACGCAGGAGCCCGAGCCCGCGGG - Intronic
1029654770 7:101917009-101917031 AGGCTGGGGTCCGAGCCCGCGGG - Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1032056731 7:128689738-128689760 AGGTGGGGGTCAGCCCCCGCCGG + Intergenic
1032078190 7:128845994-128846016 ACTCAGTGGTCACCTCCCGCAGG - Exonic
1033732758 7:144195418-144195440 TCCCAGGGATCAGCCCCCGCTGG - Intronic
1033743609 7:144293998-144294020 TCCCAGGGATCAGCCCCCGCTGG - Intergenic
1033750293 7:144355599-144355621 TCCCAGGGATCAGCCCCCGCTGG + Intronic
1039484243 8:37899018-37899040 CCGGAGGGGTCCGCGCCCCCAGG + Intronic
1048472141 8:134713051-134713073 ACGCAGGCGTCTGCGCCCCGTGG - Intergenic
1049177329 8:141202215-141202237 AGGTGGGGGTCAGCCCCCGCCGG - Intergenic
1055056048 9:72025157-72025179 CTGCAGGGGACAGCGCCCTCTGG + Intergenic
1057447503 9:95127587-95127609 AAGCAGGGGTCCCCGCCCCCTGG - Intronic
1060072866 9:120565527-120565549 AGGCAGGGGCCAGCTCCTGCAGG - Intronic
1061221222 9:129253367-129253389 CCGCAGGAGTCAGCGCCCAGCGG - Intergenic
1061616624 9:131784655-131784677 AGGCAGGGGTCAGAGCTCTCTGG + Intergenic
1062101534 9:134731153-134731175 ACGCAGGGGTCTGGACCTGCTGG - Intronic