ID: 1175999611

View in Genome Browser
Species Human (GRCh38)
Location 20:62826013-62826035
Sequence TGGGGGTCCCACCTCTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175999603_1175999611 2 Left 1175999603 20:62825988-62826010 CCCAGGCACAGGAGCGCGACCTG 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG 0: 1
1: 1
2: 3
3: 25
4: 239
1175999599_1175999611 27 Left 1175999599 20:62825963-62825985 CCGGCTGGGGGGTGTTTGGCCAA 0: 1
1: 0
2: 0
3: 18
4: 229
Right 1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG 0: 1
1: 1
2: 3
3: 25
4: 239
1175999602_1175999611 8 Left 1175999602 20:62825982-62826004 CCAACACCCAGGCACAGGAGCGC 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG 0: 1
1: 1
2: 3
3: 25
4: 239
1175999604_1175999611 1 Left 1175999604 20:62825989-62826011 CCAGGCACAGGAGCGCGACCTGG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG 0: 1
1: 1
2: 3
3: 25
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175999611 Original CRISPR TGGGGGTCCCACCTCTGCCA AGG Intronic
900457943 1:2786404-2786426 TGGGGGTCCCACAGCGGCCAGGG + Intronic
900495525 1:2974326-2974348 TGGGGATGCCTCCTGTGCCATGG - Intergenic
901005198 1:6168350-6168372 TGGGGGTCCCAGCTTCCCCAGGG - Intronic
901810540 1:11764691-11764713 TGGGGGCCCCATCTTAGCCAGGG - Intronic
901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG + Intronic
902583813 1:17425959-17425981 TCTGGGTCCCACCTCTCACAGGG + Intronic
902790636 1:18765492-18765514 TGGAGCTCCCAGCTCTGCCATGG - Intergenic
903127400 1:21257366-21257388 GGGGTGTCCCTCCCCTGCCAGGG + Intronic
903736677 1:25534356-25534378 TGGGGGTGGCCCATCTGCCAAGG - Intergenic
903741918 1:25563212-25563234 GGGGGGTCCCACTCCTGCCTGGG + Intronic
904973180 1:34435007-34435029 TTGGGGTCTCACTTCTGCAAAGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906582795 1:46950311-46950333 TGGTGTTCCCTCCTCTGCCTTGG - Intergenic
906692720 1:47803184-47803206 TGGGGGTCCCACAGCCTCCATGG + Intronic
907318263 1:53586406-53586428 TGGAAGTCCCAGCTCTGCCATGG - Intronic
908731055 1:67226700-67226722 TGAGGGTGGGACCTCTGCCAGGG + Intronic
910065349 1:83144264-83144286 TGGGGACCACACTTCTGCCATGG - Intergenic
911761606 1:101623480-101623502 TGAGGGGCCCACATCTGACAAGG - Intergenic
914348856 1:146822494-146822516 CGGGCATCCCACCTCTGCCTAGG + Intergenic
915981012 1:160419999-160420021 TGGGGATCCCTCCTCTGGCCAGG - Intronic
922057226 1:222052849-222052871 TGGGCATCTCACCTCTGCCCTGG - Intergenic
1064450735 10:15439981-15440003 TCGCAGCCCCACCTCTGCCAGGG - Intergenic
1067054680 10:43043792-43043814 GGGGGCTCCCCCCTCTGCCAGGG + Intergenic
1067805123 10:49386757-49386779 AGGAGGTGTCACCTCTGCCATGG + Exonic
1069330396 10:67284944-67284966 TGGGGGTGGCACCTATGCCCAGG + Intronic
1069622569 10:69846798-69846820 TGGAGGTCCCTCCTCTGCCGTGG + Intronic
1069920514 10:71812923-71812945 GTGGGGTCCAACCTCAGCCAAGG - Intronic
1070428514 10:76313106-76313128 TTTGTGTCCCAGCTCTGCCAAGG + Intronic
1070817598 10:79335252-79335274 TGGGGGGACCACTTCTCCCAGGG + Intergenic
1072916569 10:99540653-99540675 TTGGGGCCGCGCCTCTGCCAGGG + Intergenic
1073375021 10:103026099-103026121 TGAGGGGCCCACATCTGGCAAGG - Intronic
1074929391 10:118108320-118108342 TGGAGCTGCCGCCTCTGCCAGGG - Intergenic
1075216153 10:120537922-120537944 TGGGTGTCCATCCTCAGCCAGGG + Intronic
1075604243 10:123792896-123792918 TGTGGGTCCCAGCTCTGCTCTGG - Intronic
1076365042 10:129916225-129916247 TGGTGGTCTCACCCCTGCCAGGG - Intronic
1076866242 10:133167759-133167781 TGGGGGTGCCTGCTGTGCCACGG + Intronic
1077147583 11:1052911-1052933 GGGAGGTGCCACCTCTGACACGG - Intergenic
1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG + Intergenic
1077297903 11:1834670-1834692 TGGGGGTCCCATCTCATCCCTGG - Intronic
1078417254 11:11175914-11175936 TGGAGGTCCCCACTCTCCCAGGG - Intergenic
1078935271 11:15943851-15943873 CAGGAGTCCCACCTCTGCCTAGG - Intergenic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1083596772 11:63921309-63921331 AGGGGGTCCCACCTCAGTCTGGG + Intergenic
1083705527 11:64511814-64511836 TGGGTGTCCCACCTGTGCTCAGG + Intergenic
1084502174 11:69541261-69541283 TGGGGGTCCCACATCTCCAGAGG + Intergenic
1085204433 11:74722199-74722221 TGGCGTTCCCACCTCTGCCCTGG + Intronic
1087568628 11:99895679-99895701 TGGGGATCACACTTCTGCCATGG + Intronic
1087626730 11:100604136-100604158 TTGGGGAACCACCTCTGCCTGGG - Intergenic
1089493504 11:118897524-118897546 TGGGGGTCTCAGCCCTGCTAGGG + Exonic
1089849921 11:121487075-121487097 TGCGAGGCCCACCTCTTCCATGG + Intronic
1090430495 11:126642131-126642153 TGGAGGTCCCTCCCCTCCCATGG - Intronic
1090981379 11:131725534-131725556 TGGGGCTGCCTCCTCTGCCTGGG - Intronic
1092262385 12:6959614-6959636 TGGGGGTCCCAGGTCTTCCGGGG + Intronic
1093320246 12:17705084-17705106 TGGGGCACCCACCATTGCCAAGG - Intergenic
1095073836 12:37892841-37892863 AGGGGTGCCCACCTTTGCCAAGG + Intergenic
1095835151 12:46629664-46629686 TGAGGTACCCACCTCTCCCATGG - Intergenic
1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG + Exonic
1099883332 12:88496498-88496520 TTGGAGTCTCCCCTCTGCCAAGG + Intronic
1100888550 12:99099322-99099344 TGGGGGTCCCCTGTCTGCTATGG + Intronic
1103427633 12:120850890-120850912 TGGTGTGCCCACCTCTTCCAAGG + Intronic
1103437031 12:120934728-120934750 TGGTGTGCCCACCTCTTCCAAGG - Intergenic
1104074101 12:125374144-125374166 TGTGTGTCACACATCTGCCAAGG - Intronic
1104852515 12:131884078-131884100 TGGGGGTCCATCCTCTCCCGTGG - Intergenic
1106480523 13:30133798-30133820 TGGGGCTCCCAGCTCTGGCCCGG - Intergenic
1106534875 13:30631591-30631613 TGGGAGGCCCACCTGAGCCAGGG - Intronic
1108624373 13:52212656-52212678 TGAGGGTCTCACCTCTGCTTGGG + Intergenic
1109622092 13:64924577-64924599 CCTGGGTCCCACGTCTGCCAAGG + Intergenic
1111074724 13:83218505-83218527 TGGGGGTTCCACCTTATCCAGGG + Intergenic
1111746238 13:92273017-92273039 TGGTGGTGTCACCTCTCCCAGGG - Intronic
1112632814 13:101180683-101180705 TGGGGGCCCCACATGGGCCAGGG - Intronic
1114139354 14:19893745-19893767 AGGGGGGTCCAGCTCTGCCAAGG - Intergenic
1115217632 14:31028268-31028290 TGGGAGGACCACCTCAGCCAGGG - Intronic
1117433976 14:55699060-55699082 TGTGAGTCCCACCTCCGTCAAGG + Intronic
1119476809 14:74935131-74935153 CGGGGAACCCACCTCTGCGAGGG + Intergenic
1122793369 14:104193673-104193695 TGAGGGTCCCGACCCTGCCATGG - Intergenic
1123397180 15:19948656-19948678 AGGGGGGCCCACCATTGCCAAGG + Intergenic
1124400159 15:29340979-29341001 TGTGTGTCCCAGCTCTCCCATGG - Intronic
1124409471 15:29424251-29424273 TGGGGCTCCCACCGCTGACTGGG + Intronic
1125726650 15:41871653-41871675 AGGAGGCCCCACCTCAGCCAGGG + Intronic
1126759061 15:51952657-51952679 TGGGGGACACACCTCTGCAGTGG + Intronic
1127191260 15:56533001-56533023 TGCTGTTCCAACCTCTGCCAAGG - Intergenic
1128892370 15:71342696-71342718 AGGGGATCCCACCTCAGCCATGG + Intronic
1135742865 16:24991668-24991690 TGGGCTTCCCACCACTGCTAAGG + Intronic
1135763084 16:25153356-25153378 TGAGGGGCCCACATCTGGCAAGG + Intronic
1136710755 16:32234656-32234678 TGAGGCTCCCAGCTCTGCAAGGG + Intergenic
1136757156 16:32694755-32694777 TGAGGCTCCCAGCTCTGCAAGGG - Intergenic
1136810953 16:33175620-33175642 TGAGGCTCCCAGCTCTGCAAGGG + Intergenic
1136817429 16:33285700-33285722 TGAGGCTCCCAGCTCTGCAAGGG + Intronic
1136823993 16:33342229-33342251 TGAGGCTCCCAGCTCTGCAAGGG + Intergenic
1137003376 16:35250941-35250963 TGAGGCTCCCAGCTCTGCAAGGG - Intergenic
1137285693 16:47014193-47014215 TGGGGGGCCCTCCTCTGGCGCGG - Intergenic
1137331734 16:47504811-47504833 TCGGGATCCCACCTCAGCCAGGG - Intronic
1139985180 16:70893061-70893083 CGGGCATCCCACCTCTGCCTAGG - Intronic
1140827781 16:78723748-78723770 TTGCTTTCCCACCTCTGCCAAGG + Intronic
1141935849 16:87237220-87237242 TGGGGGTCCCTCCCCTGCCCGGG - Intronic
1142146815 16:88496229-88496251 TGGGCCTCTCACCTCTGCCCAGG - Intronic
1203059305 16_KI270728v1_random:955106-955128 TGAGGCTCCCAGCTCTGCAAGGG - Intergenic
1142763580 17:2054461-2054483 TGTGGGTAACACCTCTGCCCAGG + Intronic
1142806602 17:2374482-2374504 TGGGGGGACCACCTGAGCCATGG + Intronic
1143118978 17:4595712-4595734 TGGGGCTCCCAGCTCTGGCCAGG - Intronic
1143399912 17:6637373-6637395 TGAGGGGCCCACAGCTGCCAGGG - Intronic
1144626853 17:16848226-16848248 TAGGGGAACCTCCTCTGCCAGGG - Intergenic
1144879585 17:18424486-18424508 TAGGGGAACCTCCTCTGCCAGGG + Intergenic
1145766351 17:27460690-27460712 TGGGACTCTGACCTCTGCCACGG - Intronic
1145779426 17:27552595-27552617 TGGGGGCACCAACTCTCCCAGGG - Intronic
1146607468 17:34273048-34273070 GAGGGGTCTTACCTCTGCCATGG + Intergenic
1147135159 17:38429861-38429883 TGTGGTTCTCCCCTCTGCCAGGG + Intronic
1147183852 17:38703401-38703423 TTTGGGGCCCACCGCTGCCAAGG - Intergenic
1147196105 17:38767911-38767933 TGGGGGTCAAACCACTGCCTTGG - Exonic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1147580994 17:41626919-41626941 TAGGGGAACCTCCTCTGCCAGGG - Intergenic
1150577347 17:66441992-66442014 TTAGGGCCCCAACTCTGCCAAGG + Intronic
1152693117 17:81730288-81730310 TGCGTGACCCAGCTCTGCCAAGG - Intergenic
1152893911 17:82898933-82898955 TGGAGCTCCCACCACTTCCACGG + Intronic
1153997177 18:10453562-10453584 GGAAGGTCCCTCCTCTGCCAAGG - Intergenic
1154122003 18:11659544-11659566 CGGGGATGCCTCCTCTGCCATGG - Intergenic
1155998498 18:32358233-32358255 TGGGAGTCCCACCTGTGAGATGG - Intronic
1156481736 18:37440585-37440607 TGTGGGCCCCACCTCCTCCAAGG - Intronic
1157596841 18:48869417-48869439 CGGGGCTCCCACAGCTGCCAGGG + Intergenic
1157614804 18:48979961-48979983 GGGGGCTCCCACAGCTGCCAGGG - Intergenic
1159550943 18:69894982-69895004 TGGGGCTTCCACCTCCTCCAAGG - Intronic
1160392847 18:78548040-78548062 CGGGGGCCCCAGCTCTGCCCAGG + Intergenic
1160763834 19:798298-798320 GGGGGCTCCCACCTCTCCCAAGG - Intronic
1161262260 19:3344536-3344558 TGGGGGTTACACCTCTGAGAAGG - Intergenic
1161739099 19:6009382-6009404 TGGTGGTGCCATCTCTGCCCCGG - Intronic
1162109748 19:8393614-8393636 TGGGGGTCCCTCCAGTGCCCTGG + Intronic
1162915714 19:13873382-13873404 TGGGGGTCCCTCATCTACCTTGG + Intronic
1163402139 19:17100674-17100696 TGGTGGTCCCAAGACTGCCAAGG - Intronic
1163700082 19:18782536-18782558 TCGGGGTCTCAGCTCTTCCATGG + Intergenic
1164876317 19:31693310-31693332 TGGGGTTCCTGCCTCCGCCAGGG - Intergenic
1164905600 19:31964965-31964987 TTGGGGTCTGACCTTTGCCAAGG - Intergenic
1165384183 19:35500808-35500830 TGGGGCTGCCAACTCTCCCACGG - Intronic
1165660736 19:37578411-37578433 TGGGGGTTCCTCCTGTGCCCAGG - Intronic
1165750951 19:38259383-38259405 TAGCAGTCCCATCTCTGCCAGGG + Intronic
1166046927 19:40235322-40235344 TGGGGGGCCCAGCGATGCCAAGG - Exonic
1166077661 19:40423124-40423146 TGGTGGCCCCTCGTCTGCCAAGG + Exonic
1166546468 19:43637049-43637071 TGCGGGTCCCATTTCTGCCTGGG + Intronic
1166720836 19:44994836-44994858 TGGGGGTCTCACCTCTTCATTGG + Intergenic
1166792022 19:45404300-45404322 AGGGGAGCCCACCTCCGCCAGGG + Intronic
1167055827 19:47111465-47111487 TGGGGTTCCCCCCTCTGTCGGGG - Intronic
1167381303 19:49139801-49139823 TGGGGGTCCCCCATCTTCCAGGG - Exonic
1167444272 19:49528223-49528245 GGGGGGTCCCAGACCTGCCAGGG - Intronic
1168126589 19:54286727-54286749 CGGGGGTTCCAGCTCTGCCCAGG + Intergenic
1168175301 19:54624136-54624158 CGGGGGTTCCAGCTCTGCCCAGG - Intronic
1202653139 1_KI270707v1_random:24610-24632 TGTGGATCCCACACCTGCCAAGG - Intergenic
925237175 2:2289996-2290018 TGGGGATCCCAGCCCTGCTATGG - Intronic
925275054 2:2643001-2643023 TGGGGCTGCCACCTCTGGCTGGG - Intergenic
925693721 2:6552041-6552063 TCGGGGCACCACCTCTCCCAGGG - Intergenic
926141474 2:10370962-10370984 TGGAGGTGCCAGCTCTGCCTCGG - Intronic
930259271 2:49126225-49126247 TGAGGGTCCCATGTCTGTCAAGG + Intronic
932621615 2:73268189-73268211 TCGGGTTTCCACCTCTACCAGGG - Intronic
933686751 2:85147596-85147618 TGGTGGTCCCAGCTGGGCCAGGG + Intronic
933992530 2:87643800-87643822 TGGGGGTGACCCCTCAGCCATGG - Intergenic
934107756 2:88711376-88711398 TGGAAGTCCCAACTCTGCCCTGG - Intronic
934533531 2:95113085-95113107 TGGTTGTCCCACCCCTGCCTCGG - Intronic
935677570 2:105609228-105609250 GGGGGTCCCCAACTCTGCCAAGG + Intergenic
936301323 2:111307041-111307063 TGGGGGTGACCCCTCAGCCATGG + Intergenic
936462333 2:112722637-112722659 TGAGGGTCCCAGCTCTGTCCTGG + Intronic
936519215 2:113201322-113201344 TGAGGCTCCCACCACGGCCAAGG + Exonic
937224463 2:120360259-120360281 TGGGGGTTCCGCCTCTGCTTAGG - Intergenic
938062230 2:128262817-128262839 TAGGGCTCCCACCTTTGCGAGGG + Intronic
944436884 2:199699359-199699381 TGGGGGGCTCACCTATGCCTGGG + Intergenic
944901665 2:204222579-204222601 TCTGGATCCCACGTCTGCCAAGG + Intergenic
945990486 2:216391952-216391974 TGGCAGTCCCACCTATCCCAAGG - Intergenic
946406092 2:219492821-219492843 TGGGGTTCCCACCAATGCCACGG + Exonic
948271656 2:236678514-236678536 TGGGGGTCACTGCTCTGCCAGGG - Intergenic
948686625 2:239674492-239674514 TGGGGGTCCCATCTCTGGGCTGG + Intergenic
1169145127 20:3247588-3247610 TGGGGGGCCCACCTCTCAGATGG + Intergenic
1175499600 20:59440550-59440572 TGGGCATTCCACCTCTACCAAGG - Intergenic
1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG + Intronic
1176413903 21:6463833-6463855 TGTGGGCCCCACTTCTGCCTGGG + Intergenic
1176599012 21:8775041-8775063 TGTGGATCCCACACCTGCCAAGG + Intergenic
1178361581 21:31952928-31952950 TGGGAATCCCATGTCTGCCACGG + Intronic
1179112156 21:38456705-38456727 TGAGGGTCCAATCCCTGCCAAGG + Intronic
1179689401 21:43072155-43072177 TGTGGGCCCCACTTCTGCCTGGG + Exonic
1179947610 21:44688758-44688780 GGTGGGTCCCACCTCTGCCCTGG - Intronic
1180419419 22:12799860-12799882 TGTGGATCCCACACCTGCCAAGG - Intergenic
1180853676 22:19033743-19033765 TGGGGCTCCTGCCTCTGCCTAGG + Intergenic
1181546151 22:23603700-23603722 AGGGGGTCCCCCCTCTGCAGTGG - Intergenic
1181630955 22:24151110-24151132 TGGAGGTACCAGCTCTGCCTAGG + Intronic
1181749142 22:24976729-24976751 TGGGGGACCTACCTCTGGCTGGG + Intronic
1181902336 22:26166992-26167014 GGGGGGTCCCAACCCAGCCAAGG - Intergenic
1182584768 22:31338484-31338506 TGTGGGCCCCACGTCAGCCAGGG + Intronic
1182702466 22:32251593-32251615 TGAGGGACCCACATCTGGCAAGG - Intronic
1182723448 22:32423322-32423344 TGGGGTTTCCTCCTCTGGCAGGG + Intronic
1184273595 22:43398311-43398333 TCCTGGTCCCAGCTCTGCCATGG + Intergenic
1185281041 22:49970031-49970053 TGGGGAGCCCACCTGTGCAAAGG - Intergenic
1185324687 22:50219917-50219939 TGGGGGTCCCACAGCAGGCAGGG - Intronic
1185344718 22:50306239-50306261 TGGGGGGCCCACCTCTGTCCCGG - Intronic
949145090 3:690614-690636 TGGGGGCCCCACATCTGCCATGG + Intergenic
952256812 3:31702671-31702693 TGGGGGTCGGACCTGTGCCTTGG + Intronic
953576995 3:44120841-44120863 TGTGGGACCCATCTCTGCCAAGG + Intergenic
953611844 3:44453754-44453776 TGGGACTGCCAACTCTGCCAGGG + Intronic
953812925 3:46129954-46129976 TTTGAGTCCCACCTCTCCCATGG - Intergenic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
960974001 3:123157975-123157997 TGGGGGCCCCACCTCTGCCATGG + Intronic
961448621 3:126992486-126992508 GGGGCCTCCCATCTCTGCCATGG + Intronic
962385748 3:134930805-134930827 TGGGGCACCCACCCCAGCCATGG - Intronic
963056992 3:141193970-141193992 TTGGGGTACCACTTCTGCCCTGG - Intergenic
964405015 3:156339777-156339799 GGGGGCTCCCACGTCTTCCAGGG + Intronic
964902053 3:161671373-161671395 AGTGGGTCCCAACTCTGCCCGGG + Intergenic
968549068 4:1213196-1213218 TGGGGGTCCCCACGCTGCAAGGG - Intronic
968974151 4:3812299-3812321 AGGGGGTCCCACCTCTGAGTGGG - Intergenic
969718151 4:8878265-8878287 TTTGGGTCCCAGCTCTGCCATGG + Intergenic
973362367 4:49177413-49177435 TGTGGATCCCACACCTGCCAAGG + Intergenic
973398732 4:49619448-49619470 TGTGGATCCCACACCTGCCAAGG - Intergenic
977645793 4:99410268-99410290 TCTGGGTCCCACACCTGCCAAGG + Intergenic
978336256 4:107672520-107672542 AGGGGTGCCCACCACTGCCAAGG + Intronic
985635857 5:1035646-1035668 TTGGGGGCCCAGCTCAGCCAGGG - Intronic
985794077 5:1949278-1949300 TGGGTGTCCCACCCCGGCTAGGG + Intergenic
985962551 5:3313648-3313670 TGGAGGTCCCAGGTCTACCATGG + Intergenic
994287847 5:97991752-97991774 TGGGGTGCCCACCATTGCCAAGG + Intergenic
997950544 5:138239347-138239369 TGGGAGTCCCACCTGTGCCCTGG - Intergenic
999751185 5:154629163-154629185 GGGTCCTCCCACCTCTGCCATGG + Intergenic
1000895759 5:166853700-166853722 TGAGGGGCCCACATCTGGCAAGG - Intergenic
1001787276 5:174424574-174424596 TGGGGCTCCAGCCTCTGGCATGG - Intergenic
1003020578 6:2505589-2505611 TGGTGGGGCCACCCCTGCCAGGG - Intergenic
1005455140 6:26012418-26012440 CGAGGGGCCCACCTCTGGCAAGG - Intergenic
1005716211 6:28550809-28550831 TGAGGGTGCCACATCTGGCATGG - Intergenic
1006632776 6:35441390-35441412 TGTGGGTCACACCTCTTCCCCGG - Intergenic
1007624137 6:43233375-43233397 TGGGGGCCACACCTCTGCTCTGG + Intergenic
1013349169 6:109290473-109290495 CGGGGTTTCCACCTCTGGCAGGG + Intergenic
1015812693 6:137177291-137177313 TAGGGGCTCCACCTCAGCCATGG + Intergenic
1016721749 6:147306358-147306380 GGGGGCCCCCAACTCTGCCAGGG + Intronic
1019270345 7:143627-143649 AGGGGGTCCCAGCCCTGCCAGGG + Intergenic
1019703848 7:2488159-2488181 TGGGGGCCCCATCCCTGCCGAGG - Intergenic
1020212024 7:6164794-6164816 TGGGGATACCACCTGGGCCACGG + Exonic
1021375906 7:19906224-19906246 AGGGGCGCCCACCACTGCCAAGG - Intergenic
1023082177 7:36536086-36536108 TGGGTGTCTCACTCCTGCCAGGG - Intronic
1024055893 7:45659658-45659680 TGGGAGTCCCTCCCCAGCCATGG - Intronic
1024253563 7:47523597-47523619 TGGGGGTCCCTCCTCGGGGATGG + Intronic
1026308640 7:69165258-69165280 TGAGGGTCCCCACTCTGCCCAGG - Intergenic
1026849381 7:73715563-73715585 GGGCTGCCCCACCTCTGCCAGGG - Intronic
1027189293 7:75988397-75988419 TGGGCGTCCCACCCCGGCCGAGG - Intronic
1027278757 7:76590482-76590504 TGGGGACCACACTTCTGCCATGG + Intergenic
1028761984 7:94507437-94507459 TAGTGGTCCCACCACTGCCATGG - Intergenic
1031906373 7:127464507-127464529 TTTGGGTGTCACCTCTGCCAGGG - Intergenic
1034303582 7:150035206-150035228 GGTGCCTCCCACCTCTGCCATGG + Intergenic
1034991493 7:155550511-155550533 TGGGGGCCCTACCTGTCCCAAGG + Intergenic
1035016024 7:155766665-155766687 TGGGGGTGGCATCTGTGCCACGG + Intronic
1035744642 8:1952789-1952811 TGCCGGTCCCACGTCTGCAAGGG + Exonic
1037681440 8:21100926-21100948 TGGGAGGCCCCCCTCTGCCCTGG - Intergenic
1037744343 8:21630955-21630977 TGGGGGGCCTGCCTCTGCCCTGG + Intergenic
1038618235 8:29115716-29115738 TGGGGGTCCTGCCTGTGCCAAGG - Intronic
1041110435 8:54477929-54477951 AGGGTGTCCCTCCTCTTCCATGG - Intergenic
1045568471 8:103345509-103345531 TGGGAGTCACAGCTCTGCAATGG + Intergenic
1046620635 8:116525981-116526003 TGGGGTTGGCACCTCTGCCTGGG - Intergenic
1048183568 8:132218176-132218198 TGTGGGTTGCACCTATGCCAGGG - Intronic
1048313733 8:133346700-133346722 TGGGGGACCCTCCTCTGAGATGG - Intergenic
1049255601 8:141612089-141612111 TGAGGGTCCCACATCCGCCTTGG + Intergenic
1049273451 8:141708119-141708141 TGGGGGCCCCACCCCAGCCGTGG - Intergenic
1049359454 8:142205439-142205461 TGGGGGCCCCACCTGAGCCCTGG + Intergenic
1049361970 8:142216189-142216211 AGAAGCTCCCACCTCTGCCATGG + Intronic
1049536815 8:143186304-143186326 CGGGCGTGCCTCCTCTGCCAGGG + Intergenic
1050540989 9:6670009-6670031 TGAGGCTCCCACCCCAGCCAGGG + Intergenic
1053412110 9:37922639-37922661 TGCTGGTCCCAGCTCTGCCTTGG - Intronic
1060774701 9:126364472-126364494 TGCTGGCCCCACCTCTGCCCTGG - Intronic
1061951815 9:133940483-133940505 TGGGGGACCCTCCGCTCCCAGGG - Intronic
1061973029 9:134054967-134054989 TGGGGCGCCCACCTGTGCCAGGG + Intronic
1189561541 X:42195997-42196019 TGAGGGTCCAACCTCTGCCACGG - Intergenic
1190253680 X:48746771-48746793 TGGAGGTCCGAAGTCTGCCATGG + Intergenic
1190375146 X:49782021-49782043 TGGGGGTCACATGGCTGCCATGG + Intergenic
1195196671 X:102503699-102503721 TGGGGGTCCTCTCACTGCCAAGG - Intergenic
1198109211 X:133487850-133487872 TGGGGGTCCCAGACATGCCATGG + Intergenic
1198840643 X:140853653-140853675 TGGGTGTTCCACTTCTGCTATGG + Intergenic
1200059182 X:153476720-153476742 TTGGGCTCCCAGTTCTGCCATGG - Intronic
1200207414 X:154327127-154327149 TGTGGGTCCCAGCCCTGCCCTGG + Intronic
1200427013 Y:3032534-3032556 AGGGGGGCCCACCATTGCCAAGG - Intergenic
1200740925 Y:6852863-6852885 TGGGGGTCCCGCCATTGCCCAGG + Intergenic