ID: 1175999935

View in Genome Browser
Species Human (GRCh38)
Location 20:62827192-62827214
Sequence CAGAGTTAACACCATGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175999935_1175999947 21 Left 1175999935 20:62827192-62827214 CCAACTCCATGGTGTTAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1175999947 20:62827236-62827258 TCCAGGGTGACCGAGGCGAGAGG 0: 1
1: 0
2: 1
3: 12
4: 174
1175999935_1175999939 4 Left 1175999935 20:62827192-62827214 CCAACTCCATGGTGTTAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1175999939 20:62827219-62827241 TGCCCCACCTCATCCTTTCCAGG 0: 1
1: 0
2: 3
3: 33
4: 308
1175999935_1175999950 23 Left 1175999935 20:62827192-62827214 CCAACTCCATGGTGTTAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1175999950 20:62827238-62827260 CAGGGTGACCGAGGCGAGAGGGG 0: 1
1: 1
2: 0
3: 18
4: 340
1175999935_1175999945 14 Left 1175999935 20:62827192-62827214 CCAACTCCATGGTGTTAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1175999945 20:62827229-62827251 CATCCTTTCCAGGGTGACCGAGG 0: 1
1: 0
2: 0
3: 7
4: 121
1175999935_1175999940 5 Left 1175999935 20:62827192-62827214 CCAACTCCATGGTGTTAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1175999940 20:62827220-62827242 GCCCCACCTCATCCTTTCCAGGG 0: 1
1: 0
2: 0
3: 32
4: 289
1175999935_1175999949 22 Left 1175999935 20:62827192-62827214 CCAACTCCATGGTGTTAACTCTG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1175999949 20:62827237-62827259 CCAGGGTGACCGAGGCGAGAGGG 0: 1
1: 0
2: 3
3: 15
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175999935 Original CRISPR CAGAGTTAACACCATGGAGT TGG (reversed) Intronic
904314480 1:29651445-29651467 AAGAGCTGACACCATGGAATGGG - Intergenic
904349632 1:29896547-29896569 CACAGTTAAGAGCATGGACTTGG - Intergenic
904384689 1:30133535-30133557 AGGAGCTGACACCATGGAGTGGG + Intergenic
904832878 1:33316593-33316615 CAGGGGCAACACCAGGGAGTTGG + Intronic
904910183 1:33928827-33928849 CAAATTTAACAACATGGAGAAGG - Intronic
907116644 1:51974779-51974801 CACAATTAACACTATGAAGTAGG - Intronic
907808710 1:57846546-57846568 CAGAGTAAACAGCACAGAGTAGG - Intronic
911474296 1:98357261-98357283 GACAGTTCACTCCATGGAGTTGG - Intergenic
911665904 1:100551344-100551366 CAGTGTTAACATCATGTGGTAGG + Intergenic
915585050 1:156840012-156840034 CAGTGTTAACACCATGTAGATGG + Intronic
916609382 1:166375814-166375836 CAGATTTACCTCCATGGAATTGG - Intergenic
922868799 1:228883589-228883611 CAGGGTTAGCACCATGGTGCTGG - Intergenic
923019012 1:230148529-230148551 CGGAGTTAACTCCAGGGTGTGGG + Intronic
923339659 1:232996498-232996520 CAGAGTAAACAGCATGGGGTGGG + Intronic
923931416 1:238702961-238702983 CAGAGTAAACTCCATAGATTCGG - Intergenic
1062808600 10:444462-444484 TTGAGTGAACACCATGGCGTGGG - Intronic
1067222983 10:44357230-44357252 CAGGATTAACACCCCGGAGTTGG + Intergenic
1067758882 10:49027931-49027953 CAGAGTAAATACCCAGGAGTGGG + Intronic
1067839472 10:49664552-49664574 CAGATTGCACACCAGGGAGTGGG + Intronic
1069217997 10:65846135-65846157 CAGGCTTAACATAATGGAGTTGG - Intergenic
1072205705 10:93203580-93203602 CAGAGTTACCAGCATGGATGTGG - Intergenic
1072868425 10:99089115-99089137 CAGAGTAAACAGCATAGAGTGGG - Intronic
1074285848 10:112097588-112097610 CAAAGCTAACACCATGAAGATGG + Intergenic
1075314037 10:121437892-121437914 CAGAGTTTGCACCGTGAAGTGGG + Intergenic
1075878190 10:125824966-125824988 TAGAGGTGACACCATGGTGTGGG + Intronic
1076098188 10:127750699-127750721 CAGAGTTAAGAAAATGGACTGGG + Intergenic
1077781235 11:5332062-5332084 CAGAGTTTTCACCAAGTAGTAGG + Intronic
1085266263 11:75239918-75239940 CAGATTTTGCAGCATGGAGTTGG - Intergenic
1088651174 11:111958949-111958971 CAGAGTGAAGACCCTGGAGTGGG - Intronic
1090055730 11:123422850-123422872 CAGAGTGAACACGAGGGAGAAGG - Intergenic
1102850208 12:116235679-116235701 CTGAGTTAACAAAAAGGAGTAGG - Intronic
1105041914 12:132967384-132967406 CAGAGAGAACACCCTGGAGTCGG - Intergenic
1106227167 13:27794163-27794185 CAGTGTTCACAGCTTGGAGTTGG - Exonic
1111007613 13:82268920-82268942 CTGGGTTAACATCATGGTGTTGG + Intergenic
1112382615 13:98906508-98906530 CACAGTTAAGTCTATGGAGTCGG + Intronic
1115640408 14:35332212-35332234 CAGAGTTAACACAGTGGTTTAGG + Intergenic
1115791371 14:36882658-36882680 CATAGTTGAAACCATGGATTTGG - Intronic
1121877256 14:97464614-97464636 CAGAGATAGCAACATGCAGTCGG + Intergenic
1123139656 14:106062595-106062617 CAGAGGACTCACCATGGAGTTGG - Intergenic
1123187972 14:106538256-106538278 CAGAGGACTCACCATGGAGTTGG - Intergenic
1125477880 15:40059856-40059878 CAGGGTTACCACCATGTAGATGG + Intergenic
1126068309 15:44843314-44843336 CAGAGATAACACCATCTTGTTGG - Intergenic
1126090525 15:45047491-45047513 CAGAGATAACACCATCTTGTTGG + Intronic
1126693245 15:51304246-51304268 CAAATTTAGCACCAGGGAGTGGG - Intronic
1127548166 15:60009377-60009399 AAGAGACAACACCATGGAGTGGG + Intronic
1127993886 15:64141168-64141190 AAGAGTTAACAACATGGAAAAGG - Intronic
1128965330 15:72052244-72052266 CAGAGTGGAGACCGTGGAGTGGG - Intronic
1129361319 15:75026362-75026384 CTGAGTTTACCCCAGGGAGTGGG - Intronic
1131313649 15:91313017-91313039 GAGGCTTAACACTATGGAGTAGG + Intergenic
1132874677 16:2131099-2131121 CGGAGGTGACACCATGGAGGTGG + Intronic
1133949248 16:10376625-10376647 CAGAGTTAAAATCATAGGGTAGG + Intronic
1135968749 16:27056690-27056712 CAGAGTTAACCCACTTGAGTAGG - Intergenic
1137276849 16:46940520-46940542 CAAAGTAAACACAATGGAGAAGG + Intergenic
1137675762 16:50303160-50303182 CAGAGTTGTCACAATGGAGGAGG + Intronic
1140270098 16:73457815-73457837 CTGAGTCATCACCATGAAGTAGG - Intergenic
1141039619 16:80661643-80661665 CAGAGCCAACACCATGAAGAGGG - Intronic
1141994144 16:87626292-87626314 CACAGTTATCACCATGGAGCTGG + Intronic
1143301014 17:5910731-5910753 CCAAGTGAACCCCATGGAGTTGG + Intronic
1143563452 17:7708353-7708375 CAGTGTTCACACCAGGGTGTGGG + Intronic
1145971436 17:28958737-28958759 CAGAGATCACACCATGGTCTGGG + Intronic
1148018981 17:44541371-44541393 CTGAGGCCACACCATGGAGTGGG - Intergenic
1150867372 17:68867528-68867550 CACAGGTAACACCATGATGTAGG - Exonic
1151010840 17:70494091-70494113 CATTGTTAACAACATGGAGGAGG + Intergenic
1151120965 17:71792478-71792500 CATAGTTAAGAACATGGAGATGG - Intergenic
1152029773 17:77834827-77834849 CAGAGGCAAAACCATGGAGCAGG + Intergenic
1159123509 18:64196933-64196955 CAGAGTTATCACTAATGAGTAGG - Intergenic
1159454810 18:68647677-68647699 TAGAGTGAACACTTTGGAGTAGG + Intergenic
1159671096 18:71221884-71221906 CAGAGCTGACAGCATGGATTGGG + Intergenic
1162849837 19:13422483-13422505 AAGAGTTAACTCCTTGGGGTTGG + Intronic
1164490369 19:28706925-28706947 CAGTGTTGACTCCATTGAGTTGG - Intergenic
925186317 2:1848973-1848995 CAGGGTTAAGTCAATGGAGTTGG - Intronic
925376769 2:3391759-3391781 CAGAGACAAGACCAGGGAGTGGG - Intronic
926117398 2:10222098-10222120 CAGAGCTCACCCCATGTAGTGGG + Intergenic
927613533 2:24566264-24566286 CAGAGAGGAGACCATGGAGTTGG + Intronic
928045821 2:27930595-27930617 CAAAATTAAAAACATGGAGTTGG + Intronic
928840514 2:35599381-35599403 CAGAGAGTAGACCATGGAGTGGG - Intergenic
928840522 2:35599451-35599473 CAGAGATGAGACCCTGGAGTAGG - Intergenic
929036006 2:37692457-37692479 CAGAGCAAACAGCATGGATTTGG - Intronic
929377903 2:41312944-41312966 CATATTTCACACCATGAAGTTGG + Intergenic
929439722 2:41955484-41955506 CAGAGTTAGCACCATGGCTCAGG + Intergenic
930802902 2:55461154-55461176 CAGAGTTAAGACCATTGCCTTGG + Intergenic
932679734 2:73814717-73814739 AACAGTTTACACCATGGACTAGG - Intronic
933323454 2:80806368-80806390 GAGAGATAACACCATGTAGGAGG + Intergenic
936787316 2:116109509-116109531 CAGAGATAATAACATGCAGTTGG + Intergenic
937118673 2:119427269-119427291 CAGAGGTAATAGCAGGGAGTTGG - Intergenic
938988639 2:136605155-136605177 CAGAGATAAGCCCATGGAGTAGG - Intergenic
939811241 2:146835419-146835441 CGGAGTTAACACCATTGAACTGG + Intergenic
940123370 2:150293927-150293949 CAGATTCAACACCATGGCCTTGG - Intergenic
941826939 2:169909160-169909182 CAGAGTAAACAAGTTGGAGTTGG + Intronic
941863510 2:170309641-170309663 CAGAACTAGCACCATGGAGCAGG - Intronic
943023448 2:182601776-182601798 CAGAGTAGAGACCCTGGAGTGGG + Intergenic
945977949 2:216285229-216285251 CAGAGTTAACAAAATGGATGTGG - Intronic
946605336 2:221398515-221398537 CAGATTAAACACCATCGTGTTGG - Intergenic
948133500 2:235619299-235619321 CCGAGTTCACATCATGAAGTGGG + Intronic
1169193001 20:3669579-3669601 CGGCGTTCACCCCATGGAGTTGG - Exonic
1170983657 20:21238692-21238714 CAGAATAAACACCATGAAATTGG - Intronic
1172974396 20:38895421-38895443 CAGTGTGAACATCATGGAGCTGG + Intronic
1175999935 20:62827192-62827214 CAGAGTTAACACCATGGAGTTGG - Intronic
1176865345 21:14048529-14048551 CAGAGATTACAGCATGGGGTTGG + Intergenic
1177133040 21:17280133-17280155 CAGAGATGCCACCTTGGAGTTGG - Intergenic
1181278485 22:21702365-21702387 CACAGTTCACACCATGGAAACGG - Intronic
951503108 3:23412812-23412834 CAGAATTAACAACTTTGAGTGGG + Intronic
951856923 3:27207657-27207679 CAGAATTAACACATTGCAGTGGG - Intronic
952934564 3:38386072-38386094 CAGAATGAACCCCATGGTGTTGG - Intronic
954129744 3:48554367-48554389 CAGGGTTCACAGCAGGGAGTGGG - Intronic
954699715 3:52444961-52444983 CAGAGCTACCCCCATGGAGCAGG + Exonic
954837991 3:53487421-53487443 GCGAGTTAGCACCATGGGGTAGG + Intergenic
954933332 3:54303600-54303622 CAGAGTTAACACCCTGGGTGAGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
956409139 3:68960830-68960852 AAAAGATAACACCATGCAGTTGG - Intergenic
957738964 3:84237868-84237890 CAGATTAAACACCATGGAATGGG + Intergenic
958780129 3:98531045-98531067 AAGAGTTAACATCATTGATTAGG - Intronic
959548186 3:107622431-107622453 CAGGGTTAATACCTAGGAGTGGG + Intronic
960231605 3:115234624-115234646 CAGAGTTAAGACCTAGGATTTGG + Intergenic
961228603 3:125278774-125278796 CAGAGTTTAAAACATGGATTTGG - Intronic
962461787 3:135620978-135621000 CACAGTTAACATCTTGGAATAGG - Intergenic
965529098 3:169753112-169753134 CAGAGTTAACACCAGGAAAAAGG + Intergenic
967277283 3:187788707-187788729 GAGAATTAACACCATAGAATTGG + Intergenic
969695503 4:8731984-8732006 CATAATAAACACCATGGACTTGG - Intergenic
973084201 4:46033834-46033856 TCAAGTTAACACCATAGAGTAGG - Intergenic
974485914 4:62505834-62505856 GAGAGCTCACACCATGGAGAAGG + Intergenic
975881064 4:78908567-78908589 GGGAGTTATCACCATGCAGTTGG - Intronic
976785863 4:88819989-88820011 CAGAGTTTCCAGGATGGAGTTGG - Intronic
977471908 4:97452805-97452827 CAGAGAGAAGACCCTGGAGTGGG - Intronic
981639153 4:146915501-146915523 TAGAGTTTACACCCTTGAGTGGG - Intronic
982527872 4:156502584-156502606 CAGAGGTTCCACCAGGGAGTAGG - Intergenic
982732017 4:158966125-158966147 CAGAGCTGAGACCATGTAGTGGG + Intronic
983850058 4:172569564-172569586 CCGAGTAAACTCCTTGGAGTAGG - Intronic
984643177 4:182192805-182192827 CACAGTTAAGTCCATGGATTTGG + Intronic
984979094 4:185260470-185260492 GAGTGTTTACACCATGGAATGGG + Intronic
986261269 5:6148587-6148609 CAGAGTTTTCACCATGGTGATGG + Intergenic
986924551 5:12731215-12731237 CAGAGTTCAGACCCTGAAGTGGG + Intergenic
993645697 5:90457847-90457869 CATATTTAACACCTTGGAATGGG - Intergenic
997035382 5:130184723-130184745 CAGAGTTAACCCCATGCACGGGG + Exonic
998758270 5:145404472-145404494 CAGAGTGAACACCAAGGTGAAGG + Intergenic
998881997 5:146654183-146654205 AGGAGATAACACCTTGGAGTTGG - Intronic
999506813 5:152207053-152207075 AAGAGTTAACTACAGGGAGTTGG + Intergenic
1002948814 6:1788216-1788238 CAGAGTTCAGACCAGGGAGGTGG + Intronic
1005407788 6:25509247-25509269 GAGAGTTTACACCTTGGAATCGG + Intronic
1005710405 6:28498880-28498902 GAGAGTTAATACCCTGGAGAAGG - Intergenic
1007898482 6:45387025-45387047 TAGAGTTAAGTCAATGGAGTAGG + Intronic
1008531956 6:52469911-52469933 AATAGTTAAGAGCATGGAGTTGG + Intronic
1010977899 6:82337267-82337289 CAGAGCAAACCCCATGGTGTTGG + Intergenic
1011751673 6:90460653-90460675 CAGAGTAAACCCCAGGGAGAAGG - Intergenic
1014946425 6:127503986-127504008 CACAGTTAATAACATGGACTTGG + Intronic
1016668445 6:146671981-146672003 CTGAGATAACACCATGGTTTTGG + Intronic
1016785486 6:148006456-148006478 CAGAAATAACAGCAAGGAGTAGG + Intergenic
1022354907 7:29604989-29605011 CAAAGTTAACTACATGGAGGAGG + Intergenic
1023699991 7:42883294-42883316 CAGAGATGAGACCATGGAGTAGG + Intergenic
1024687910 7:51768002-51768024 CACAGTTAACACCTGGGAGCTGG - Intergenic
1032840843 7:135712351-135712373 CAGAGGTAACATCACTGAGTGGG + Intronic
1042293326 8:67192772-67192794 CGGAGTTAACAAAATGCAGTGGG - Intronic
1043082504 8:75784326-75784348 CAGAGGAAAGACCCTGGAGTGGG + Intergenic
1044488429 8:92782413-92782435 CACAGTGAAAACCATGGTGTTGG + Intergenic
1052268601 9:26603222-26603244 CAGAGTGTACACAATGAAGTGGG - Intergenic
1055400805 9:75921988-75922010 CACAGTTGACACCAAGGGGTTGG + Intronic
1056858952 9:90161964-90161986 CAGAGTGCACACCATGGTTTGGG - Intergenic
1058205514 9:102100949-102100971 CAGAGTTAACACCATTTCCTAGG - Intergenic
1187715238 X:22096051-22096073 CATAGTTCAAACCATGGAGGTGG + Intronic
1189023918 X:37371243-37371265 CAGAGAGGACACCCTGGAGTGGG - Intronic
1191927248 X:66326828-66326850 CAGAGTTAATAGCATGGATGGGG + Intergenic
1193554168 X:82932747-82932769 CAGAGAGAAGACCATGGGGTAGG - Intergenic
1194537230 X:95119851-95119873 CAGAGTTCTGACCATGGAGGTGG + Intergenic
1194767636 X:97860561-97860583 CTGATTTAACACCAGGGACTGGG - Intergenic
1200164372 X:154026044-154026066 TAGAGTTCCTACCATGGAGTGGG - Intronic
1201796936 Y:17906049-17906071 CAGAGTGAAGACCCTGGAGTGGG - Intergenic
1201804617 Y:17999936-17999958 CAGAGTGAAGACCCTGGAGTGGG + Intergenic
1202358312 Y:24075108-24075130 CAGAGTGAAGACCCTGGAGTGGG - Intergenic
1202512466 Y:25595005-25595027 CAGAGTGAAGACCCTGGAGTGGG + Intergenic