ID: 1176000390

View in Genome Browser
Species Human (GRCh38)
Location 20:62828947-62828969
Sequence CCGTTGGGGCCCTTCTCTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 116}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176000390_1176000398 -1 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000398 20:62828969-62828991 GGCTGCCGGTGAGTGCCCGGCGG 0: 1
1: 1
2: 1
3: 8
4: 147
1176000390_1176000397 -4 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000397 20:62828966-62828988 ACGGGCTGCCGGTGAGTGCCCGG 0: 1
1: 0
2: 2
3: 11
4: 151
1176000390_1176000400 3 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000400 20:62828973-62828995 GCCGGTGAGTGCCCGGCGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 164
1176000390_1176000408 16 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000408 20:62828986-62829008 CGGCGGGTGGGGCCAGCCTGGGG 0: 1
1: 0
2: 3
3: 37
4: 325
1176000390_1176000402 4 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000402 20:62828974-62828996 CCGGTGAGTGCCCGGCGGGTGGG 0: 1
1: 0
2: 1
3: 4
4: 99
1176000390_1176000405 14 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000405 20:62828984-62829006 CCCGGCGGGTGGGGCCAGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 410
1176000390_1176000407 15 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000407 20:62828985-62829007 CCGGCGGGTGGGGCCAGCCTGGG 0: 1
1: 0
2: 1
3: 22
4: 308
1176000390_1176000399 0 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000399 20:62828970-62828992 GCTGCCGGTGAGTGCCCGGCGGG 0: 1
1: 0
2: 1
3: 12
4: 135
1176000390_1176000403 5 Left 1176000390 20:62828947-62828969 CCGGGAGAGAAGGGCCCCAACGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1176000403 20:62828975-62828997 CGGTGAGTGCCCGGCGGGTGGGG 0: 1
1: 0
2: 0
3: 20
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176000390 Original CRISPR CCGTTGGGGCCCTTCTCTCC CGG (reversed) Exonic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900791812 1:4685731-4685753 CCATGGGGGACCTTCTTTCCAGG + Intronic
903023378 1:20410179-20410201 CAGCAGGGGCCCTTCCCTCCTGG + Intergenic
903061068 1:20669156-20669178 CCGCTGGTGCCCTTCTGTCTGGG + Intronic
904008040 1:27373973-27373995 CCCTTGGGGCCCATCTTGCCTGG + Exonic
904194525 1:28775260-28775282 CCTTTAGGGCCCTTGGCTCCGGG + Intergenic
905221351 1:36450257-36450279 CCTTTGCGGGCCTTGTCTCCCGG + Exonic
906501151 1:46342523-46342545 GCATTGAGTCCCTTCTCTCCTGG + Intronic
910989130 1:93036856-93036878 AGGTTGGAGCCCTCCTCTCCTGG - Intergenic
912777227 1:112513414-112513436 CTGATGGGGCCCATCTGTCCCGG - Intronic
913083572 1:115413028-115413050 CCATTTGGGCTCTGCTCTCCTGG - Intergenic
914247300 1:145895862-145895884 CTCTTGGGGCTCTTCTCTCTGGG - Intronic
916588395 1:166166930-166166952 CCGTTGGGGCTCTCCACCCCGGG - Exonic
919876718 1:201874739-201874761 CCTTTGGGGCCCTTCTATTCTGG + Intronic
922153398 1:223023322-223023344 CATTAGAGGCCCTTCTCTCCTGG + Intergenic
923429510 1:233906247-233906269 CCGTTCACGCCCTTCTCCCCTGG + Intronic
924537906 1:244953215-244953237 CCGTTGGGGCCTTTCGCCCCTGG - Intergenic
1063173281 10:3529025-3529047 CTGTTGGGGACATTCCCTCCCGG + Intergenic
1064243141 10:13648498-13648520 CCGTTGGGTTCCTTGTCCCCTGG - Intronic
1067568910 10:47357451-47357473 CCTATGGGGCCCTTCCCTACAGG - Exonic
1071520912 10:86331024-86331046 CCCTGGTGGCCCTTCTCTCATGG - Intronic
1074852639 10:117451079-117451101 CCATTGCGGCCCTCCTCTCCTGG - Intergenic
1075003147 10:118812525-118812547 CAGTTGGGAACCTGCTCTCCAGG + Intergenic
1077106507 11:844649-844671 GGGTGGGGGCCCCTCTCTCCTGG + Intronic
1080179299 11:29404539-29404561 CCTTTGGGGCCTTTCTTTTCTGG - Intergenic
1083304495 11:61755396-61755418 CCGGTGGGTCCCCTCTCTGCAGG - Intronic
1091084679 11:132709758-132709780 GCCTTGGTGCCCCTCTCTCCTGG - Intronic
1092492223 12:8956031-8956053 CCTTTGGGTCCCCTCTCTGCTGG + Intronic
1095981147 12:47975499-47975521 GGGTCGGGGCCCTTCTCTCTCGG + Exonic
1104165951 12:126230013-126230035 CCTTTGGGGCTCTGCTCTTCAGG - Intergenic
1104594558 12:130112327-130112349 CCGGGAGGGCCCGTCTCTCCAGG - Intergenic
1106132615 13:26952479-26952501 CCATCTGGCCCCTTCTCTCCAGG - Intergenic
1108020920 13:46127040-46127062 CCGGGGGGGCCCATCTCTTCTGG - Exonic
1113456142 13:110450322-110450344 CCCTTGGGTCCCATCTCACCCGG - Exonic
1115864564 14:37730025-37730047 CTGTTGGATCCTTTCTCTCCTGG - Intronic
1119329489 14:73783478-73783500 CAGTTAGGGCCCTTCTCCACAGG - Intronic
1121253700 14:92516753-92516775 CCCTTGGTGCCCCTCTATCCTGG + Intronic
1121418268 14:93794189-93794211 GGGTTGGGGCACTGCTCTCCTGG + Intergenic
1121440377 14:93945093-93945115 CAGTGGGGCTCCTTCTCTCCTGG + Intronic
1121511292 14:94515087-94515109 CCCTTGGGGACCATCACTCCAGG - Intronic
1122378544 14:101285719-101285741 CCGATGCCGCCCTTCTCTCCTGG - Intergenic
1124723492 15:32133835-32133857 CCGGAGGGGGACTTCTCTCCAGG - Intronic
1125675241 15:41498703-41498725 GCCTGGGGGCCCTTCTCTACTGG - Intronic
1129110775 15:73335841-73335863 CCAGTGGGGCCCTTCTTTCCTGG + Intronic
1132314803 15:100881759-100881781 CAGTTGGGGCCTTTATCGCCTGG - Intronic
1137952932 16:52800727-52800749 AAGGTGGGTCCCTTCTCTCCTGG - Intergenic
1140122291 16:72094015-72094037 CTCTTGGGACCCTTCTGTCCCGG - Exonic
1142591367 17:1007477-1007499 TGGCTGGGGCCCTGCTCTCCTGG - Intronic
1148123479 17:45225280-45225302 CAGCTGGGGCCCTTCCCTTCTGG + Intronic
1150652293 17:67017981-67018003 CCTTTGGGGCATATCTCTCCCGG + Intronic
1151192140 17:72406374-72406396 CCACTGGTGCCCTTCTCTCTGGG - Intergenic
1151516381 17:74598889-74598911 CCTCTGGAGCCCTTCTCTCCAGG - Intergenic
1151705159 17:75763508-75763530 CCGTTGCTGCCCTTCCCGCCAGG - Intronic
1151978234 17:77494296-77494318 ACGTTCGGGCCCATCCCTCCCGG - Intronic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152848392 17:82616488-82616510 CGGGTGGGGACGTTCTCTCCAGG + Intronic
1153338307 18:3947839-3947861 CCTTTGAGGCCCTGATCTCCTGG - Intronic
1156399104 18:36724800-36724822 CCGTAGTAGCCCTTCTCCCCTGG - Intronic
1161327850 19:3672025-3672047 CCGCTGGGGCCCCTCTCTCCTGG + Intronic
1161723328 19:5915386-5915408 TCCCTGGGCCCCTTCTCTCCTGG + Exonic
1161800899 19:6416334-6416356 CCAATGGGGCCCTTCAATCCTGG - Exonic
1161828739 19:6587689-6587711 CCGTTGGCCCTCTTCTCTCTAGG + Intronic
1164160437 19:22622948-22622970 CCGCAGGGGCCCTGCCCTCCAGG - Intergenic
1164882159 19:31741564-31741586 GCTTTGGGGCCCTTCTGTGCTGG - Intergenic
932433416 2:71688830-71688852 CTGTTGGGCCACTTCCCTCCAGG - Intergenic
934036379 2:88092029-88092051 CTGTTGGGGGCCCTCTATCCCGG - Intronic
937078725 2:119125449-119125471 GGGTTGGGGTCCCTCTCTCCCGG + Intergenic
938021459 2:127909013-127909035 CAGTCTGTGCCCTTCTCTCCTGG - Intergenic
939606928 2:144264889-144264911 CCATTGCGCTCCTTCTCTCCTGG - Intronic
944484155 2:200185980-200186002 CCCTTTGTTCCCTTCTCTCCCGG - Intergenic
946337753 2:219049734-219049756 CCGCTGGGGCATTTCCCTCCAGG + Intergenic
948271926 2:236680965-236680987 CCGATGGGCCCCATCACTCCTGG - Intergenic
1170493520 20:16901981-16902003 CAGTTGGGGCCCCACTGTCCGGG - Intergenic
1172925163 20:38527340-38527362 CCGTTGTGACCCATCTCTTCAGG - Intronic
1173615869 20:44402676-44402698 CCGATGGGGCTCTTCCCTCCAGG - Intronic
1174142052 20:48422061-48422083 CTGTAGGGTCCCTGCTCTCCTGG + Intergenic
1174520498 20:51126432-51126454 CTGTAAGCGCCCTTCTCTCCAGG - Intergenic
1176000390 20:62828947-62828969 CCGTTGGGGCCCTTCTCTCCCGG - Exonic
1184089181 22:42283508-42283530 CCCTCGGGCCCCTCCTCTCCCGG + Intronic
1184554877 22:45227715-45227737 CAGTGGGGCCCGTTCTCTCCCGG - Intronic
951056211 3:18149198-18149220 CAGTTGGGGCCCTTTTCCTCAGG - Intronic
954274061 3:49531269-49531291 AGAATGGGGCCCTTCTCTCCTGG + Exonic
954658407 3:52212349-52212371 CCGTAGGAGCTCTTCTCCCCGGG - Exonic
954934982 3:54318208-54318230 CCGTCTGTGCTCTTCTCTCCTGG - Intronic
956459166 3:69454368-69454390 CCGTGGGAGCCCCTCTCTCTGGG + Intronic
968491726 4:893776-893798 CCCTTGGGGCACTGCTCACCTGG - Intronic
968662394 4:1804129-1804151 CTGCTGGGCTCCTTCTCTCCAGG + Intronic
970332622 4:15002252-15002274 CCGTTGGGTCTCTCCGCTCCCGG - Intergenic
973176272 4:47209903-47209925 CTGTTGTGCCCCTTCCCTCCTGG + Intronic
976281967 4:83334703-83334725 CCGCTGGGTCCCCTCTCCCCTGG - Exonic
976698491 4:87943627-87943649 CTGTTGGGGCACTTCTATCATGG + Intergenic
978055013 4:104252835-104252857 CAGTTGGGGACCTTTTCTGCAGG - Intergenic
981348253 4:143699968-143699990 CGGTGGGGGCCCCTCTCCCCAGG - Exonic
982164885 4:152605299-152605321 CCTGTGGAGCCCTTTTCTCCAGG + Intergenic
988702614 5:33690173-33690195 CCCGAGGGGCCCATCTCTCCAGG + Intronic
989167600 5:38446347-38446369 CCGGTGGCTGCCTTCTCTCCCGG + Intronic
989379289 5:40797957-40797979 CCGCTGCGTCCCTTCTTTCCAGG - Intronic
999088294 5:148912542-148912564 CCGTTAGGACCCTCCTCACCTGG - Intergenic
999663348 5:153888497-153888519 CCGTTGGGCCCCACATCTCCTGG - Intergenic
1000350597 5:160349637-160349659 CCCTTGGGCCCCTTCTTGCCTGG + Exonic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002774872 6:320204-320226 CAGCTGGGGACCTTCTCTCTAGG + Intronic
1002961073 6:1915353-1915375 CCTCAGGGGCCCTACTCTCCTGG - Intronic
1004181137 6:13381456-13381478 CCGCTGGGACCCTTTTCTCAGGG - Intronic
1006271390 6:32969349-32969371 CCGATGGATCCCTTCTCACCTGG - Intronic
1006296231 6:33171287-33171309 CCTTTGGTGCCCTTCTGTCCGGG + Exonic
1007397500 6:41586048-41586070 CCCTGGAGGCCCTTCTCCCCTGG + Intronic
1009931793 6:70184886-70184908 CCTTTGGGGCCTCTGTCTCCAGG - Exonic
1010937760 6:81882240-81882262 CTGTTGGGACCTTTTTCTCCTGG - Intergenic
1011971684 6:93232708-93232730 CTGTTCTGACCCTTCTCTCCAGG - Intergenic
1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG + Intronic
1041944753 8:63428334-63428356 CTATTGGAGCCCTTCTGTCCTGG - Intergenic
1046395165 8:113631993-113632015 CCTTTTGGGCCCTTCATTCCTGG - Intergenic
1047156189 8:122321232-122321254 GCATTGGGGCCCTACTCTCCTGG + Intergenic
1047330960 8:123886328-123886350 CCTTTGGTGCCATTCTCCCCGGG + Intronic
1048271038 8:133028220-133028242 CAGTTGGTGCCCTGCTTTCCTGG + Intronic
1048454497 8:134565720-134565742 CCCTTGATGCCCTTCTCTCTGGG - Intronic
1049387955 8:142353763-142353785 ACCCTGGGGCCCTTCTCTGCTGG - Intronic
1049387972 8:142353826-142353848 GCCGTGGGGCCCTTCTCTGCTGG - Intronic
1049651355 8:143771372-143771394 CCGTTTGGGTCCTTCTGTCGGGG + Intergenic
1051284292 9:15480178-15480200 CATTTGGGGCCATTCTCTCCAGG - Intronic
1058951165 9:109905392-109905414 CCTTTGGGGCCCTTTTCTGGTGG - Intronic
1059434212 9:114266598-114266620 ACCTTGGGTCCCATCTCTCCTGG - Exonic
1060895323 9:127213289-127213311 CTGCTGGGGCCCATCACTCCAGG + Intronic
1061267034 9:129512230-129512252 CAGATGGGGCCCTTATCACCTGG - Intergenic
1062255147 9:135617396-135617418 CCCTTCGAGCCCTTCTCTCATGG - Intergenic
1185461284 X:333757-333779 CCCTCGGGGCCGTTCCCTCCCGG - Intergenic
1190376794 X:49796191-49796213 CCTTGGGGGCCTTTCTCTCAGGG + Intergenic
1192915142 X:75643968-75643990 CAGTTGGGGCTCTCCACTCCTGG + Intergenic