ID: 1176002639

View in Genome Browser
Species Human (GRCh38)
Location 20:62839853-62839875
Sequence GTGTGTGCGTGGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1751
Summary {0: 1, 1: 0, 2: 23, 3: 199, 4: 1528}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176002639_1176002646 6 Left 1176002639 20:62839853-62839875 CCTTCTCCCCTCCACGCACACAC 0: 1
1: 0
2: 23
3: 199
4: 1528
Right 1176002646 20:62839882-62839904 CTCTGGGTGCCCCATGCTCCTGG 0: 1
1: 0
2: 3
3: 56
4: 325
1176002639_1176002645 -10 Left 1176002639 20:62839853-62839875 CCTTCTCCCCTCCACGCACACAC 0: 1
1: 0
2: 23
3: 199
4: 1528
Right 1176002645 20:62839866-62839888 ACGCACACACACTGCTCTCTGGG 0: 1
1: 1
2: 0
3: 34
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176002639 Original CRISPR GTGTGTGCGTGGAGGGGAGA AGG (reversed) Intronic
900320845 1:2082870-2082892 GTGTGAGGGTGCAAGGGAGAGGG + Intronic
900337111 1:2169738-2169760 GGGTGTGCGCAGAGGGGAGGTGG + Intronic
900489073 1:2937315-2937337 GTGAGCTCGTGGAGGGGAGGTGG + Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900891840 1:5455059-5455081 GTGTGAGGGTGGATGGGAGCTGG - Intergenic
900977679 1:6027264-6027286 GTGTGTGTGTGGACGGCTGAAGG + Intronic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
901179980 1:7335130-7335152 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
901318851 1:8327020-8327042 GTATGAGCGTGGAGACGAGAAGG + Intronic
901436532 1:9250368-9250390 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901436569 1:9250482-9250504 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901559690 1:10060079-10060101 GTGTGTGTGTGGAGGGGGTTGGG + Intronic
901758088 1:11453554-11453576 GTGGGTGATGGGAGGGGAGAGGG + Intergenic
901831798 1:11897300-11897322 GTGTGTGTGTCGGGGGGAGGGGG - Intergenic
901831800 1:11897302-11897324 GTGTGTGTGTGTCGGGGGGAGGG - Intergenic
901895477 1:12308184-12308206 GTCTGTGCTTGGAGTGGAGGCGG + Intronic
901908733 1:12437056-12437078 GTGTGTGTGTGGCGGCGGGAGGG + Intronic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902071377 1:13741754-13741776 GTGTGTGTGTGTAGGGGTGGGGG + Intronic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
902721691 1:18308434-18308456 GTGTGTGTGTGGAGGGGCTCTGG - Intronic
902744504 1:18464456-18464478 GTGTGTGTGTGCAGAGCAGAGGG - Intergenic
902772176 1:18651806-18651828 GGGGGGGCGGGGAGGGGAGAGGG - Intronic
903151020 1:21408812-21408834 GTGTGTGTGTGAAAGAGAGAGGG - Intergenic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903188496 1:21642865-21642887 GTGTGTGTGTGTAGTGGGGAAGG - Intronic
903622458 1:24707811-24707833 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
903969010 1:27107088-27107110 GTGTGTGTGTGGAGGGGCTGGGG - Intronic
904250183 1:29217808-29217830 GTGTGGGCGTAATGGGGAGATGG + Intronic
904297021 1:29526478-29526500 GTGGTGGCCTGGAGGGGAGAAGG - Intergenic
904321854 1:29703015-29703037 GTGGGTGCGTGGGGTGGAGTTGG + Intergenic
904470388 1:30732256-30732278 GTGAGTGTGTGGAGGGGTGTGGG + Intergenic
904470416 1:30732352-30732374 GTGAGTGTGTGGAGGGGTGTGGG + Intergenic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
904710555 1:32426829-32426851 GGGTCTGCGTGGTGGGGGGAGGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905174406 1:36126799-36126821 GTATGTGCGTGGGGGGGTGTGGG + Intergenic
905184742 1:36188199-36188221 GTGTGTGTGTTGAGGGGCGGGGG - Intergenic
905297679 1:36964422-36964444 GCATGTGTGAGGAGGGGAGAGGG - Intronic
905546884 1:38807281-38807303 GTGTGTGTGTGTCAGGGAGAAGG - Intergenic
905615118 1:39391413-39391435 ATGTGTGTGTGGAGAGGAGGAGG + Intronic
905770564 1:40635629-40635651 GTGTGTGCGTGGTGGGAGGTGGG + Intronic
905971737 1:42146820-42146842 GGGGGTGCGGGGAGGGGAGGTGG - Intergenic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906103028 1:43275200-43275222 GTGTGTGCATGGCAGGGGGAAGG - Intergenic
906147578 1:43569130-43569152 GTGTGTGCGGACAGGGGAGAGGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906306981 1:44725598-44725620 TTGTGTGTGTGGAGGGGGAAGGG + Intergenic
906554794 1:46701001-46701023 GTGTGTGTGTGCATGTGAGATGG + Intronic
906783242 1:48591087-48591109 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
906793470 1:48678414-48678436 GTGTGTGAGTGGAAGGGACTGGG - Intronic
907637223 1:56147643-56147665 GTGTGTGGGTGGGGTGGAGGGGG + Intergenic
907663475 1:56414553-56414575 GTGTGTGTGTGGTGGGGGGCAGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907745573 1:57209824-57209846 GTGTGTGTGTGAGGGGGAGAGGG - Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
907869921 1:58433643-58433665 GTGTCTGTGTGGAGGGGGGGAGG + Intronic
907914815 1:58859015-58859037 GTGTGTGTGTGGGGGGGTGGCGG + Intergenic
908014301 1:59815181-59815203 GTGAGTGCGAGGAGGCGAGAGGG + Intronic
908127286 1:61043817-61043839 GTGTGTGTGTTGGGGGGAAATGG - Intronic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
908384355 1:63627054-63627076 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
908486294 1:64597075-64597097 GTGTGTGAGTGGGGGGGTGCTGG + Intronic
908574046 1:65440483-65440505 GTGTGGGCGTGAACGGGTGACGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909195505 1:72616826-72616848 GTGTGTGTGCGGGGGGGAGGGGG - Intergenic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909463690 1:75948332-75948354 ATGTGTGGGTGGAGTGGAGAGGG + Intergenic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
909907335 1:81214127-81214149 GTGTGTGTGTGTTGGAGAGAGGG + Intergenic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
910170319 1:84370187-84370209 GTGTGTGTGTGTAGGGGAATGGG - Intronic
910201240 1:84701859-84701881 GTGTGTGTGTGGGGGGGGGTGGG + Intergenic
910340999 1:86187309-86187331 GTGTGTGTGTGTAAGGGAGCTGG - Intergenic
910351480 1:86303726-86303748 GTGAGTGCATGGGGGAGAGATGG - Intergenic
910737673 1:90479467-90479489 GTGTGTGTGTGGATTGGAGGGGG - Intergenic
910828184 1:91431432-91431454 GTGAGTGGGTGAAGTGGAGATGG + Intergenic
910873019 1:91852285-91852307 GTGTGTGTGTGGAGGTGGGGTGG - Intronic
911261695 1:95693989-95694011 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
911266425 1:95750084-95750106 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
911311109 1:96293091-96293113 GTGTGTGTGGGCAGTGGAGAGGG + Intergenic
911473248 1:98344477-98344499 GTGTGTGTGTGGAGGCGGGGTGG - Intergenic
912296956 1:108478987-108479009 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
912449228 1:109759173-109759195 GTGTGTGTGTGGTGGGGTGATGG + Intronic
912499764 1:110114105-110114127 GTGTGTGAGTGGGAGGGAGTGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912758059 1:112341284-112341306 GTGGGTGGGAGGAGGGGGGAGGG + Intergenic
912880810 1:113412014-113412036 GGGGGTGGGGGGAGGGGAGAGGG - Intronic
912973839 1:114309957-114309979 TGGGGTGCGGGGAGGGGAGAGGG + Intergenic
912973881 1:114310361-114310383 TGGGGTGCGGGGAGGGGAGAGGG + Intergenic
913433537 1:118822891-118822913 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
914434154 1:147645417-147645439 GTGGGTGAGTGTAGGGGAAAAGG + Exonic
914743562 1:150484973-150484995 GTGTGTGTGTGGTTTGGAGAAGG - Intergenic
914812272 1:151037671-151037693 GTGTGAGGGTGGCTGGGAGAAGG + Intronic
915102856 1:153513234-153513256 GTGGGTGCTTGGAGCAGAGAAGG - Intergenic
915162058 1:153927633-153927655 GTGTGTGTGTTTAGGAGAGACGG + Intergenic
915217510 1:154349909-154349931 GTGTGTGTGTTGGGGGCAGAGGG - Exonic
915479143 1:156173297-156173319 GTGAGTGGGTGGAGGGGAGCTGG + Intronic
915780564 1:158545327-158545349 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
915841795 1:159218995-159219017 GTGTGTGCGTGTCGGGGAAGGGG + Intergenic
915852697 1:159343041-159343063 GTGTGTGTGTGGGGGGGGGGCGG + Intergenic
915874409 1:159597252-159597274 GTGTGTGCTTGTAAGGGGGATGG + Intergenic
916116922 1:161492897-161492919 GAGTGTGTGTGGTGGGGGGATGG + Intergenic
916801471 1:168220349-168220371 GTGTGTGTGTGTAGGGGTGGGGG - Intergenic
917122435 1:171656105-171656127 GTGTGTGTGTATAGGGGAGGAGG - Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917693156 1:177489883-177489905 GTGTGTGTGTGGGGGGGGCAGGG - Intergenic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
917956213 1:180101669-180101691 ATGTGTGTGTGGAGGGGGCAGGG - Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
918274907 1:182944398-182944420 GTTAGTGCTTGGATGGGAGATGG - Intronic
918326640 1:183417329-183417351 GCGTGTGCGTGTTGGGGGGAGGG - Intronic
918480835 1:184974873-184974895 GTGTGTGTGTAGAGGGGTGGTGG - Intergenic
918766010 1:188484472-188484494 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
919061240 1:192635549-192635571 GTGTGTGTGGGGAGGGGTGGGGG - Intergenic
919165114 1:193882116-193882138 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
919403984 1:197152793-197152815 GTGTGTGTGTGGAGGGGTGGGGG + Intergenic
919422683 1:197390171-197390193 GTGTTTGTGTGGGGGGGAGGGGG + Intronic
919470080 1:197967348-197967370 GTGTGTGCGTGTGTGGGATAAGG + Intergenic
919578760 1:199344621-199344643 GTGTGTGTGTGTAGTAGAGATGG - Intergenic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
919667223 1:200303757-200303779 ATATGTGCGTGGATGGGACAGGG - Intergenic
919749001 1:201024940-201024962 GGGTGTGAGTGGAGGAGGGAAGG - Intergenic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920269878 1:204754899-204754921 GTGTGTGCGTTGTGGGGGGAAGG + Intergenic
920305217 1:205014278-205014300 GTGTGTGCGTGTAGGGGTGCAGG - Intronic
920548118 1:206835612-206835634 GTGTGGCCGTGGAGGAGAGGAGG - Intronic
920680154 1:208066056-208066078 GTGTGTGTGTGGTGGGGATGTGG + Intronic
920744819 1:208616761-208616783 GGGTGGGCGTGGTGGGGAGGTGG + Intergenic
920823861 1:209406053-209406075 GAGTGTGCTTGCTGGGGAGAGGG - Intergenic
921249226 1:213281019-213281041 GTGTGTGGGTGGGGAGGGGAGGG - Intergenic
921257951 1:213359444-213359466 GTGTGTCTCTGCAGGGGAGATGG + Intergenic
921348767 1:214214160-214214182 GTGTGTGTGTGGTGGGGGGGGGG - Intergenic
921584274 1:216929472-216929494 GTGCGTGTGTGGAGGGGAGCTGG + Intronic
921628295 1:217402678-217402700 GTATGTGTGTGGAAGGGCGATGG + Intergenic
921744511 1:218724078-218724100 GTGTGTGCTTTTAGTGGAGATGG - Intergenic
921918948 1:220644450-220644472 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
921926189 1:220711720-220711742 ATGTGTGTGTTGAGGGGAGTGGG - Intergenic
921973178 1:221173338-221173360 GTGTGTGTGTGGGGGGGGGGAGG + Intergenic
922434805 1:225593391-225593413 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
922465896 1:225845478-225845500 GAGTGAGCTTGGAGGGGTGAGGG - Exonic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
922780747 1:228250397-228250419 GGGTGTGCATGGGAGGGAGAGGG + Intronic
922782586 1:228264548-228264570 GGGTGTGCATGGGAGGGAGAGGG + Intronic
922896233 1:229102647-229102669 AGGTGAGCGGGGAGGGGAGAAGG - Intergenic
922987281 1:229875511-229875533 GTGTGTGTGTGTAGGGGGAAGGG - Intergenic
923051653 1:230394628-230394650 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923051685 1:230394741-230394763 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923374497 1:233347048-233347070 GTGTGTGTGTGTAGAGGAGCGGG + Intronic
923445493 1:234066819-234066841 GTGTGTGTGTGGGAGAGAGAGGG - Intronic
923624139 1:235600444-235600466 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924333297 1:242962335-242962357 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic
924608072 1:245552161-245552183 GTGTGTGTGTGGAGTGGGGGTGG + Intronic
924832608 1:247614153-247614175 GTGTTTGGCTGGAGTGGAGAAGG - Intergenic
1062974388 10:1672661-1672683 GTGCGTGCGTGGAGGGAGGCAGG - Intronic
1062974411 10:1672742-1672764 GTGTGTGCGTGGAGGGAGGGAGG - Intronic
1063039240 10:2319980-2320002 GTGTGTGTGTGGTGGGGGGAGGG - Intergenic
1063221139 10:3969088-3969110 GTGTGTGTGTGGTGGGGTGGGGG + Intergenic
1063588972 10:7377970-7377992 TTGTGTGTGTGGGGGGGAGGTGG + Intronic
1063589046 10:7378346-7378368 GTGTATGTGTGGATGGGTGATGG + Intronic
1063589067 10:7378445-7378467 GTGTATGTGTGGATGGGTGATGG + Intronic
1063722096 10:8594506-8594528 TCGTGTTCGTGGAGGGGGGAGGG - Intergenic
1063727810 10:8658109-8658131 TTGTGTGTGTGGAGGGGTGTGGG + Intergenic
1063752361 10:8965007-8965029 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1063898628 10:10708835-10708857 GTGTGTGTTTGGAGGGGTCAAGG - Intergenic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1063984496 10:11487805-11487827 GTGTGTGTGTGGAAGAGTGAGGG - Intronic
1064451342 10:15444846-15444868 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1064762256 10:18633263-18633285 GTGGGAGCGGGGAGGGGGGAGGG + Intronic
1064806572 10:19141370-19141392 GGGTTTGAGGGGAGGGGAGATGG + Intronic
1064876554 10:20001467-20001489 GTGTGCGTGTGGAGGGGGCAAGG + Intronic
1064936091 10:20680536-20680558 GTGTGTGTGTGGAGGCGGGGGGG + Intergenic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065264186 10:23957769-23957791 GTGTATGCCTGGATGGGAGGAGG - Intronic
1065446032 10:25800529-25800551 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1065651504 10:27897222-27897244 GAGTGTAGGTGGAAGGGAGAAGG - Intronic
1065661695 10:28010153-28010175 GTGTGTGGGTAGAGTGGGGAAGG + Intergenic
1065773939 10:29102179-29102201 GTGTGTGTGTGGGGCGGCGAGGG - Intergenic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1066159074 10:32709320-32709342 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1066287187 10:33979773-33979795 GGGTGTGGGGGGAGAGGAGAAGG - Intergenic
1066360724 10:34727803-34727825 GTGTGTGTGTGGTGGAGGGAGGG - Intronic
1066360733 10:34727867-34727889 GTGTGTGTGTGGCGGAGGGAGGG - Intronic
1066578809 10:36857182-36857204 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067477763 10:46578004-46578026 GTGTGTGTGTGGGGGGGGGGAGG - Intergenic
1067511537 10:46898904-46898926 GTGTGTGTGGGAAGGGGAGGTGG + Intergenic
1067570320 10:47366807-47366829 GTGTGTAGGTGGTGGGGAGGGGG + Exonic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067616978 10:47763783-47763805 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1067711569 10:48655247-48655269 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1067878061 10:50021511-50021533 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1068019035 10:51557343-51557365 GTGTGTGGGTGGTGGGGGGGTGG - Intronic
1068131904 10:52905671-52905693 GTGTGTGGGTCGAGGGGAGGAGG + Intergenic
1069040675 10:63692639-63692661 GTGTGTGTGTGTAAGAGAGAGGG - Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069794949 10:71046110-71046132 GTCTGTGAGTGGCAGGGAGACGG + Intergenic
1069927349 10:71859942-71859964 GTGGGGGCGGGGAGGGGAGGTGG + Intergenic
1070524825 10:77286759-77286781 GTGTGTGCGGGGGGGGGGGGGGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070751225 10:78965205-78965227 GTGTGTGCTGGCAGGGGAGGGGG - Intergenic
1070776798 10:79114531-79114553 GTGTGTGTGTGAAGGTGGGAGGG + Intronic
1070857862 10:79621927-79621949 GTGTGTCCCTGCAGGTGAGATGG - Intergenic
1070937441 10:80312035-80312057 GTGTGTGTGTTGGGGGGAGGGGG - Intergenic
1070937443 10:80312037-80312059 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1071009622 10:80922798-80922820 GTGTGTGGGTGGAGGGGTAAGGG + Intergenic
1071181525 10:82989984-82990006 GTGTGTGTGTTGCGGGGAAAGGG + Intergenic
1071277952 10:84073597-84073619 AAGTGTGCGTGGATGGGAAAAGG + Intergenic
1071290656 10:84186395-84186417 GTGTGTGTGTGGTGTGCAGAGGG + Intergenic
1071512250 10:86269435-86269457 GTGTGTGGGTGAAGGGGCAAGGG - Intronic
1072187866 10:93059944-93059966 GGGTGTGTGTGGAGGGGTGCAGG - Intergenic
1072587263 10:96793658-96793680 GTGGGGGCGTGGCGGGGACAGGG - Intergenic
1072712288 10:97723731-97723753 GTGTGTGTGTGTAGTAGAGATGG - Intergenic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072756491 10:98024784-98024806 GTGTGTGTGTGGTGGAGAGGTGG - Intronic
1072808811 10:98444255-98444277 GTGTGTGTGTGGCGGGGGGGTGG - Intronic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1072987584 10:100155171-100155193 GAGAGTGGGTGGAGGAGAGAAGG - Intronic
1073035804 10:100563433-100563455 GTGTGTGGATGTAGGGGTGAGGG - Intergenic
1073036532 10:100567662-100567684 GTGTGTGTGTTGCGGGGAGGTGG - Intergenic
1073090008 10:100928034-100928056 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1073093820 10:100968178-100968200 GGATGTGTGTGGCGGGGAGAGGG - Intergenic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073332834 10:102681925-102681947 GTCTGTGGGTGGAGGAGGGATGG + Intronic
1073403779 10:103278859-103278881 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1073595976 10:104800564-104800586 GTGTGTGTGTGTTGGGGAGGCGG + Intronic
1074058883 10:109946827-109946849 GAGTGAGAGTGGAGTGGAGAAGG + Intronic
1074454620 10:113586466-113586488 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1074465404 10:113677398-113677420 GCGGGTGGGGGGAGGGGAGAGGG + Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074871866 10:117583254-117583276 GTGTGTGCATGGTGAGGACAGGG + Intergenic
1075138228 10:119806751-119806773 GGGTGGGCTTGGAGGTGAGAGGG - Intronic
1075242681 10:120792899-120792921 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075490468 10:122863584-122863606 GTGTATGTGAGCAGGGGAGAGGG - Intronic
1075530048 10:123221420-123221442 GTTTGTGAGTGGAGGGGGGCAGG + Intergenic
1075539791 10:123302509-123302531 GTGTGTGCATGGTGGGGGTAGGG + Intergenic
1075834242 10:125439979-125440001 GTGTGTGTGTGGGGGGGTGGGGG + Intergenic
1075957444 10:126536180-126536202 GTGTGTGTGTGGAGGGGGTTGGG - Intronic
1076189312 10:128471431-128471453 GTGTGTGTGTGTGGGGGGGATGG - Intergenic
1076599144 10:131645869-131645891 GTGTGTGCCTTGAGGGGAGAGGG + Intergenic
1076896689 10:133316678-133316700 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1076902645 10:133347538-133347560 GTGTGCGGGTGGGAGGGAGAAGG + Intronic
1077159503 11:1106276-1106298 GTGGGTGGGTGGATGGTAGATGG - Intergenic
1077489566 11:2854433-2854455 GTGTGTGTGTGTAGGGGTGTCGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077642871 11:3897653-3897675 GGGTGGGCGTGGCGGGGGGAGGG - Intronic
1077789762 11:5425521-5425543 GTGTGTGTGGCGAGGGGAGGAGG + Intronic
1077908789 11:6557033-6557055 TAGTGTGGGTGGAGGGGTGAAGG - Exonic
1078173439 11:8949032-8949054 GTGTGTGTGTTGAGGGTACAGGG - Intronic
1078188733 11:9074414-9074436 GTGTGCGCGTGCAAGGGAGAGGG + Intronic
1078293480 11:10040730-10040752 GTGTGTGTGTATGGGGGAGATGG + Intronic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1078738058 11:14039428-14039450 GTATGTGTGTGTAGGGGTGAAGG + Intronic
1078933795 11:15934981-15935003 GTGTGTGTGTGGTGTAGAGAGGG - Intergenic
1078955583 11:16190782-16190804 GTGTGTGCGTGGCAGTGGGAGGG + Intronic
1079158323 11:17969520-17969542 GAGTGTGGGTGGAGGGGTGAGGG + Intronic
1079391159 11:20023272-20023294 GTGTGTGAGTGGGGGTGGGAGGG + Intronic
1079394096 11:20046585-20046607 GTGTGTGTGTGATGGGGAGGGGG - Intronic
1080019594 11:27546108-27546130 GTCTGTGTGAGGAGAGGAGATGG + Intergenic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080136867 11:28865312-28865334 GTGTGTGTGTGGTCGGGGGAGGG + Intergenic
1080216479 11:29847652-29847674 GTGTGTGTGTGGCAGGGATAAGG - Intergenic
1080231192 11:30018502-30018524 GTGTGGGAGTGGGGTGGAGATGG - Intergenic
1080455058 11:32411058-32411080 GTGTGTGTGTGTATTGGAGAGGG - Intronic
1080695884 11:34602692-34602714 GTATGCTAGTGGAGGGGAGACGG + Intergenic
1080935261 11:36856835-36856857 GTGTGTGCGGGGGGGGGGGGTGG - Intergenic
1081326902 11:41756201-41756223 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081565314 11:44257281-44257303 GTGTGTGTGTTGAGAGGACAGGG - Intergenic
1081626076 11:44655977-44655999 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
1081628945 11:44674404-44674426 GTGTGTGAGTGGGGGTGTGAGGG + Intergenic
1081654977 11:44851139-44851161 GTGAGTGCGTGGAGAGAAGAGGG + Intronic
1081977496 11:47244954-47244976 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
1082089197 11:48075601-48075623 GTGTGTGTGTGTGGTGGAGATGG + Intronic
1082675467 11:56095391-56095413 GTGTGTGTGGGGTGGAGAGATGG + Intergenic
1082743532 11:56937800-56937822 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1082811758 11:57482807-57482829 GAGGGTGCGTGGCGGGGAGGAGG - Intergenic
1082822274 11:57552202-57552224 GTGTGTGTGTGGTGGAGGGAAGG - Exonic
1083115765 11:60457794-60457816 GTGAGTGGGTGGAGAGGAGGTGG + Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083732107 11:64658017-64658039 GTGTGCCCATGGAGAGGAGAGGG + Intronic
1083809672 11:65096500-65096522 GGGGGTGCGGGGAGGGGGGAAGG + Intronic
1083873688 11:65508328-65508350 GTGTGTGTGTGTAGTAGAGACGG - Intergenic
1084329388 11:68421738-68421760 GTGTGTGTGTGTATGGGGGAGGG + Intronic
1084451406 11:69241016-69241038 GTGTGTGTGTGGTGGGGGCAGGG + Intergenic
1084458798 11:69284880-69284902 GTGTGTGGGTGCAGGAGAGGAGG - Intergenic
1084598163 11:70129508-70129530 GTGTGTGTGTGCATGGGAGCAGG - Intronic
1084742267 11:71147335-71147357 GTGTCTTCGAGGTGGGGAGAAGG + Intronic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085089725 11:73700600-73700622 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1085204001 11:74719369-74719391 GTGTGTGTGTACAGGGGAGGGGG - Intronic
1085294644 11:75424187-75424209 GTGTGTGTGTTGAGGGGTGAGGG - Intronic
1085329982 11:75640184-75640206 GTGTGTGTGTGGGGGGGTGGGGG - Intronic
1085417331 11:76328091-76328113 GGGTGTGGGTGGAGGAGGGAAGG + Intergenic
1085448274 11:76615539-76615561 GTGTGTGTGTGTTGGGGGGATGG - Intergenic
1085536729 11:77225504-77225526 GCGTGTGCGTGCATGTGAGAGGG - Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1086164745 11:83764458-83764480 GGGTGTGCAGGGAAGGGAGAAGG + Intronic
1086497228 11:87416941-87416963 GTGTGTGTGTGGAGGGGCTAAGG + Intergenic
1086639114 11:89128823-89128845 GTGTGTGTGTGGGGGGGCGGTGG + Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086905971 11:92418423-92418445 GTGTGTGTGTGGGGGGGTGGGGG - Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1087034757 11:93743964-93743986 GTGTGTTGGAGGTGGGGAGAGGG - Intronic
1087452426 11:98342265-98342287 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1087478561 11:98669560-98669582 GTGTGTGTGTTGGAGGGAGAAGG - Intergenic
1087719406 11:101644886-101644908 GTGGGTGGGGGGATGGGAGAGGG + Intronic
1087934629 11:104018137-104018159 GGGTGTGTGTGGAGGGGGGTGGG - Intronic
1088920586 11:114257653-114257675 GTGTGTGTGTGTCGGGGAGTTGG - Intergenic
1088990314 11:114948053-114948075 GTGTGTTGGTGGTGGGGAGGGGG - Intergenic
1089125242 11:116172176-116172198 ATGTTTGGGTGGAGGGGAGAGGG - Intergenic
1089184456 11:116605456-116605478 GTGTGTGGGCGGAGGGGGGGGGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089324945 11:117650705-117650727 GTGTGTGTGTGGTGGGGATTGGG + Intronic
1089325371 11:117653188-117653210 GGGTGTGTGTGTAGGGGAAATGG + Intronic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1089599666 11:119605560-119605582 GGGTGTGCGCGGAGAGGTGAGGG + Intergenic
1090252369 11:125260729-125260751 GTGTGTGCATGGAGAGGTGGGGG - Intronic
1090287745 11:125514700-125514722 GTGTGTGTGTGGCGGGGGGTGGG + Intergenic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090887598 11:130892956-130892978 TTGAGTCCGTGGAGGGGAAAGGG + Intronic
1091277209 11:134360598-134360620 GTGGGTGCCTGGAGGTGGGAGGG - Intronic
1091332966 11:134744877-134744899 GTGTGTGTGTGGTGGGGGGGAGG - Intergenic
1091381962 12:67435-67457 GAGTGAGCGGGGAGAGGAGATGG + Exonic
1091446390 12:546216-546238 GGGTGTGGGAGGAGGGGAGTGGG + Intronic
1091799515 12:3316093-3316115 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
1091857903 12:3753701-3753723 GTGTGTGTGTGAGGGAGAGAGGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092016191 12:5160986-5161008 GTATGTGTGTGGTGGGGAGTGGG - Intergenic
1092172398 12:6382282-6382304 GTGTGTGCGTTGGTGGGGGAGGG + Intronic
1092278668 12:7082183-7082205 GAGTGTGCTTGATGGGGAGAGGG + Intronic
1092282584 12:7108979-7109001 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1092385508 12:8033212-8033234 GTGTGTGTTTGGAGGGGCGGGGG - Exonic
1092408131 12:8234875-8234897 GAGTGTGCTTGCAGGGGTGAGGG + Intergenic
1092913718 12:13171164-13171186 GTGGGTGGGTGGGGGGAAGAGGG + Intergenic
1093010358 12:14100982-14101004 TTGTTTGAGTGGAGGGCAGAGGG + Intergenic
1093214527 12:16347711-16347733 GTGCGTACTGGGAGGGGAGAAGG + Intronic
1093244192 12:16715155-16715177 GTGTGGGAGAGGAGTGGAGAGGG + Intergenic
1093519247 12:20028914-20028936 GTGTGTGTGTGGTGGGGACTGGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094078822 12:26509994-26510016 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
1094092023 12:26661266-26661288 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1094467787 12:30771957-30771979 GTGTGTGGGGGGGGGGGAGGGGG - Intergenic
1094797298 12:33990384-33990406 GTGTGTGGGCGGTGGGGAGCGGG - Intergenic
1094840416 12:34340477-34340499 GGGGGTGCGTGGCGGGGAGCAGG - Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095342418 12:41107163-41107185 GTGTTTGGGTGTTGGGGAGATGG - Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095737880 12:45577318-45577340 GTGTGTGTGTGTAGGAGAGGTGG - Intergenic
1095994121 12:48064679-48064701 GTGTGTGTGTGTATGTGAGATGG + Intronic
1096067900 12:48755648-48755670 GTGTGTGCTTGGAGGTGTGCTGG - Intergenic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096181668 12:49554568-49554590 GTATGTGCTTGGAGGGGATGGGG + Intronic
1096197195 12:49656354-49656376 GTGTGTGTTTGCGGGGGAGAAGG - Intronic
1096254952 12:50057339-50057361 GTGTGTGCGCGCAGGAGGGAGGG - Intergenic
1096451593 12:51747121-51747143 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1096525332 12:52206971-52206993 GTGTGTGTGTGTAGGGTGGATGG + Intergenic
1096532271 12:52249449-52249471 GTGTGTGTGTGCATGGGAGGAGG + Intronic
1096796844 12:54083028-54083050 TTGTGTGCGTGTTGGGGAGAGGG + Intergenic
1097039084 12:56143634-56143656 GTGTCTGCGTGGGTGGGGGATGG + Intronic
1097059580 12:56272595-56272617 GTGTTTGTGTGCATGGGAGAGGG + Exonic
1097124548 12:56763471-56763493 GTGTGTGTGTGTAGGGGATATGG + Intronic
1097190586 12:57217581-57217603 GTGAGGTCGTGCAGGGGAGATGG - Intronic
1097237691 12:57550923-57550945 GTGTGTGTGTTGTGGGGAGTAGG + Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1097424495 12:59426236-59426258 GTGTGTGTGTGGCGGGGGGGGGG - Intergenic
1097588102 12:61539687-61539709 GGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1097708498 12:62893627-62893649 GTGTGTGTGCGGGGGGGAGGGGG + Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097921025 12:65073871-65073893 GTGTGTGTGGGGTGGGGTGAGGG + Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098350677 12:69555996-69556018 GTGTGTGTGTGGCGGGGGGGGGG + Intronic
1099291417 12:80780926-80780948 GTGTGTGCGATGAGGGGATGAGG - Intergenic
1099889612 12:88574689-88574711 GTGTGTGCATGGAGTTGAAATGG - Intronic
1100004296 12:89875324-89875346 GTGTGTGGGTGGGGGGGTGGAGG + Intergenic
1100021257 12:90072002-90072024 GTGTGTGTGTGTGTGGGAGAGGG + Intergenic
1100132383 12:91512240-91512262 GTGTGTGTGTGGCAGGGAGGCGG + Intergenic
1100418625 12:94406481-94406503 GTGTGTGTGTGGTGGGGGCAGGG + Intronic
1100494804 12:95114433-95114455 GTGTGTGTGTGTAGTAGAGATGG - Intronic
1100535319 12:95503438-95503460 GTGAGGGAGTGGAGGGGAAAGGG + Intronic
1100728349 12:97434819-97434841 GTGTGTGTGTGCAGGGGAAGGGG - Intergenic
1100829223 12:98502828-98502850 GTGTGTGTGTGGGGGGGGGGAGG - Intronic
1100926857 12:99558445-99558467 GTGTGTGTGTCAAGGGGGGAGGG + Intronic
1101093635 12:101313710-101313732 GGGTGTGTGTGGTGGGGAGTGGG + Intronic
1101244234 12:102870147-102870169 GTGGGTGGGTTTAGGGGAGAGGG + Intronic
1101332580 12:103769107-103769129 GTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101660688 12:106762847-106762869 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1101816443 12:108149666-108149688 GTGTGTGTGTGGCGGGGTGGGGG - Intronic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102004389 12:109579947-109579969 GTGTGTGCGTGGTCTGGGGAAGG + Intronic
1102181130 12:110913180-110913202 GTGTGTGTGTAGGGGGGACAGGG + Intronic
1102214574 12:111151578-111151600 CTGAATGCGTGGAGGGCAGACGG + Intronic
1102224950 12:111221806-111221828 GTGTGTGCGTGCCGGTGGGAGGG + Intronic
1102547080 12:113665034-113665056 GTCTGTGTGTGCAAGGGAGACGG - Intergenic
1102576925 12:113861504-113861526 GTGTGTGTGTGAAGGAGAGAAGG + Intronic
1102821546 12:115913217-115913239 GTGTGTGTGTGGTGGGGTGGAGG - Intergenic
1102863901 12:116359323-116359345 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1103297291 12:119898750-119898772 GGGGGTGGGTGGAGGGGGGAGGG - Intergenic
1103542135 12:121673321-121673343 GTGTGTGGCTGGAGCAGAGACGG - Intergenic
1104179073 12:126360698-126360720 GTGGGTGACTGGTGGGGAGAAGG + Intergenic
1104214862 12:126725674-126725696 GTGTGTGTGTGGGGGGGACTGGG + Intergenic
1104614010 12:130253666-130253688 GTGTGTGCTTGGGTGGAAGAGGG + Intergenic
1104843216 12:131834428-131834450 GGGTGGGCGTGGAGGGGGGCAGG + Intronic
1105453497 13:20520658-20520680 GTGTGGGCGTGAAGGGGTGGGGG - Intronic
1105662577 13:22514826-22514848 GTGTGTGTGTGGCAGGGAGGAGG + Intergenic
1105700673 13:22933505-22933527 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1105853468 13:24355660-24355682 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1106002598 13:25738335-25738357 GTGTGTGGGGGGGGGGGAGGGGG - Intronic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106675860 13:31957460-31957482 GTGTGTGGGAGGAAGGGAAATGG + Intergenic
1106993958 13:35459006-35459028 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1107484461 13:40813123-40813145 GTGTGTGGGTGGGGGGGGGGGGG - Intergenic
1107501436 13:40981336-40981358 GTGTGTGTGTTGTGGGGAGGGGG + Intronic
1107552574 13:41491069-41491091 GTGTGTGTGTGGAGTGGGGGAGG + Intergenic
1108035520 13:46286514-46286536 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1108138502 13:47392323-47392345 GTGGGTGCGTGGAGGGGACCTGG + Intergenic
1108342935 13:49515445-49515467 GTGTGTGTGTGTATAGGAGATGG - Intronic
1108458497 13:50641646-50641668 GTGTGTGTGTGGTGAGGTGAGGG + Intronic
1108625863 13:52228374-52228396 GTGTCTGTGTGGAGGGGATGGGG - Intergenic
1109106179 13:58253437-58253459 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1109163550 13:59005421-59005443 GTGTGTGTGTGTAAGGGAGTGGG - Intergenic
1109290531 13:60469409-60469431 GTGTGTGTGTGTTGGTGAGAAGG - Intronic
1109370837 13:61417104-61417126 GTGTGTGTGGGGTGGGGAGGAGG - Intronic
1109725703 13:66338632-66338654 GTGTGTGTGTAGAGGGGTGGGGG + Intronic
1110003552 13:70236824-70236846 GTGTGTGTGTGTAAGGGGGAGGG - Intergenic
1110086261 13:71384702-71384724 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1110089149 13:71423430-71423452 GTTAGTGGGTGGAGGGGTGAGGG + Intergenic
1110518539 13:76445917-76445939 GTGTGTGTGTTTAGTGGAGATGG - Intergenic
1110788998 13:79566861-79566883 GTGAGAGGGAGGAGGGGAGAAGG - Intergenic
1110944736 13:81397860-81397882 GTGTGTGTGTGAGGGAGAGAAGG + Intergenic
1110979750 13:81881147-81881169 AAGTCTGCTTGGAGGGGAGAGGG - Intergenic
1110993985 13:82081663-82081685 GTGTGTGCGTGGATGTGTGGGGG + Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111136155 13:84047018-84047040 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1111368207 13:87278894-87278916 GTGTGTGTGTGTATGTGAGATGG - Intergenic
1112012927 13:95307248-95307270 GTGGGTGGGGGGAGGGGGGACGG + Intergenic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112151454 13:96769113-96769135 GTGTGTGTTTGGTGGGGAGGTGG - Intronic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112447375 13:99476578-99476600 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1112714278 13:102165664-102165686 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1112726496 13:102310687-102310709 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1113039188 13:106085703-106085725 GTGTGTGGGGGGTGGGGAGGGGG + Intergenic
1113103658 13:106749387-106749409 GCGTGTGTGTGGCGGGGAGGGGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113426616 13:110213659-110213681 GTGTGAGCTGGGAGAGGAGATGG + Intronic
1113454545 13:110438799-110438821 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
1113473679 13:110564486-110564508 GTGTGTGTGTGGCGGGGGGCAGG - Intergenic
1113547625 13:111166372-111166394 GTGTTTGGGCAGAGGGGAGAAGG + Intronic
1113571048 13:111358293-111358315 GTGTGTGTGTGGTGGGGAATAGG + Intergenic
1113657186 13:112074123-112074145 GAGTGTGGGTGAAGAGGAGAGGG + Intergenic
1113795501 13:113055371-113055393 GTGTGTGTGTGGCGGGGGGGGGG - Intronic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113874146 13:113584308-113584330 GTGTGTGCATGTGGGGGAGCGGG - Intergenic
1113901353 13:113800086-113800108 GTGTGTGTGTGGGGGGGGGTAGG + Intronic
1113901376 13:113800185-113800207 GTGTGTGTGTGGGGGGGGGTAGG + Intronic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114069540 14:19096602-19096624 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1114092722 14:19303401-19303423 GTGAGTGTGTGGGGGGGAGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114363785 14:22005142-22005164 GTGGGTGGGAGGAGGGGGGAGGG - Intergenic
1114377094 14:22158671-22158693 GTGTGTGTGTGGGGCGGGGAGGG + Intergenic
1114479744 14:23025356-23025378 GCATATGTGTGGAGGGGAGAGGG - Intronic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1115389648 14:32840742-32840764 GTGTGTGTGTGGGGGGGGGTGGG - Intergenic
1115398441 14:32934340-32934362 GTGTGTGTGTAGAGGGGGGCGGG + Intergenic
1115400014 14:32946323-32946345 GTGTGTGTGTGTTGGGGGGATGG - Intronic
1115426867 14:33270471-33270493 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115545683 14:34462879-34462901 GTGTGTGCATGGGTGGGGGAAGG - Intergenic
1115888728 14:38003717-38003739 GTGTGTGTGTGGTGGGGGGCGGG + Intronic
1116167121 14:41349101-41349123 GTGCGTGTGTGTAAGGGAGAGGG - Intergenic
1116673892 14:47879992-47880014 GTGTGTGTGTGGTGGGGGAATGG + Intergenic
1116676518 14:47912693-47912715 GTGTGTGTGTGGCGGGGGGTGGG + Intergenic
1117002208 14:51382244-51382266 GTGTGTACATGGAGGGGGAAGGG + Intergenic
1117136642 14:52741440-52741462 GTGTGTGTGTGTATGAGAGATGG + Intronic
1117417475 14:55510493-55510515 GTGTGTGTGTGTAGGGGATGGGG - Intergenic
1117593403 14:57300512-57300534 GTGTGTGTGTGTAGGTGAGGTGG - Intergenic
1117730575 14:58718045-58718067 GTGTGTGTGTGGTGAGGGGAAGG + Intergenic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1117895863 14:60485861-60485883 GCGTGTGCGTGGGTGGGAGGGGG - Intronic
1118019355 14:61695442-61695464 GGGCGCGCGGGGAGGGGAGAGGG - Intergenic
1118138461 14:63053098-63053120 GGGTGTGCTTGGTGGGAAGAAGG + Intronic
1118167863 14:63355859-63355881 GTGTGTGTGTGCAGGGAACAGGG - Intergenic
1118181041 14:63493494-63493516 GCGTGTGTGTGGTGGGGGGAGGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118366689 14:65102426-65102448 GTGTGTGTGTGGGGGGGACTCGG - Exonic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1119153065 14:72383230-72383252 GTATGTGTGTGGATGGGAGAGGG + Intronic
1119157896 14:72428349-72428371 GTGGGTGGGTGGATGGTAGATGG + Intronic
1119187116 14:72650840-72650862 GGGTGTCTGTGGAGGAGAGATGG - Intronic
1119431725 14:74572732-74572754 GTGTGTGTGTGGCGGGGCGTGGG - Intronic
1119519290 14:75273930-75273952 GTGTGTGTGTGGGGGGGGGGTGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119648509 14:76366595-76366617 GTGTGCACGTGAAGGGGAGATGG + Intronic
1119668031 14:76498777-76498799 GTGGCTCGGTGGAGGGGAGAGGG - Intronic
1119688308 14:76650899-76650921 GTGGGTGCGTTCAGGGGAGCTGG - Intergenic
1119735392 14:76978146-76978168 TTGTGTGGGTGGAGGTGGGAGGG + Intergenic
1119748179 14:77059239-77059261 GAGTGTGGGAGGAGGGGACAGGG - Intergenic
1119914298 14:78382912-78382934 GTGTGTGTGTGGGGAGGAGGGGG + Intronic
1119965790 14:78914180-78914202 GTGTGTGCATGGATTGGTGAGGG + Intronic
1120008120 14:79382986-79383008 GTGTGTGGGTGGGTGGGTGAGGG + Intronic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120560115 14:85981013-85981035 GTGTGTGTGTGTAGGTGAGTTGG - Intergenic
1120711952 14:87801876-87801898 GTGTGTGGATGTAGGGGACAAGG - Intergenic
1120838877 14:89065244-89065266 GGGTGAGCCTGGATGGGAGATGG + Intergenic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1121539918 14:94717829-94717851 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1121616855 14:95319466-95319488 GTGTGTGTGTTGTGGGGCGAGGG - Intronic
1121647216 14:95526656-95526678 GTGTGTGCGTGGTGGGGGTGGGG + Intergenic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1121843393 14:97153017-97153039 GTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1121843681 14:97155246-97155268 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
1122160886 14:99783133-99783155 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1122214038 14:100192084-100192106 GTGGGTGGGTGGTGGGGGGAGGG - Intergenic
1122231613 14:100308919-100308941 GTGTGTGTGTGGTCGGGGGAGGG + Intergenic
1122253116 14:100454365-100454387 GTGTGAGGGTGGAGGTGAGGAGG + Intronic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122419497 14:101566574-101566596 GTGTGTGGGTGGGGGGGTGGTGG - Intergenic
1122606033 14:102948192-102948214 GGGTGGGCGTGGAGGTGACAGGG + Intronic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122690099 14:103528219-103528241 GAGTGTGTGTGCAGGGGAGCGGG - Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123181326 14:106473227-106473249 GGGGGTGAGTGGAGGGGAAATGG - Intergenic
1202945569 14_KI270726v1_random:23473-23495 GGGGGTGAGTGGAGGGGAAATGG + Intergenic
1123633736 15:22281194-22281216 TTTTGTGTGTGGGGGGGAGAGGG - Intergenic
1123938951 15:25207495-25207517 GTGTGTGCTTGGAGAGGGGCAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124272464 15:28295303-28295325 GTGTGTGGGGGGGGGGGAGTGGG + Intronic
1124563879 15:30797901-30797923 GTGGGTGGATGGAAGGGAGAGGG + Intergenic
1124707014 15:31974609-31974631 CTGGGTGCTTGGAGAGGAGACGG + Intergenic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1124845984 15:33290412-33290434 GTGTGTGGTGGGAGGAGAGAGGG - Intergenic
1124857162 15:33400363-33400385 GTGTGTGTGTGGCGGGGGGAAGG - Intronic
1124884230 15:33669834-33669856 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1125083786 15:35706072-35706094 GTGTGTGGGTGGAGAGGTGAAGG + Intergenic
1125419325 15:39488315-39488337 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1125471473 15:40008604-40008626 GTGTGTGTGTGGGGTGGGGAGGG - Intronic
1126257761 15:46647947-46647969 GTGTGTGAGTGGGTGGGAGGTGG + Intergenic
1126393880 15:48191086-48191108 GTGTTTGTGTGGAAGAGAGAAGG + Intergenic
1126702168 15:51378172-51378194 GTATGTGAATGGAGGTGAGATGG + Intronic
1127077626 15:55343439-55343461 TTGTGTGCCTGGAGGGGACGGGG + Intronic
1127283012 15:57508186-57508208 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1127841315 15:62834630-62834652 TTGTGTGCCAGGTGGGGAGACGG - Intronic
1128065815 15:64763798-64763820 GTGTGTGTGTGTAGGGGTGGGGG + Intronic
1128067504 15:64774400-64774422 GTGTGTGCGGGGTGGGGTGCTGG - Intronic
1128212722 15:65913688-65913710 ATGTGTGTGTGGAGGGGAAGAGG + Intronic
1128416561 15:67452112-67452134 GTGTGTGCCTGCACGTGAGATGG + Intronic
1128455530 15:67829473-67829495 GTGTGTGCGTGTGGTGGAGAGGG - Intronic
1128570821 15:68731540-68731562 GTGGGTGGGAGGAGGGGATAGGG + Intergenic
1128585256 15:68843869-68843891 GTATGTGTGTGGGGGGTAGAGGG - Intronic
1128650516 15:69409213-69409235 GTGTGTGTGTGTTGGGGAGTTGG - Intergenic
1129425995 15:75463424-75463446 TAATGTGCGGGGAGGGGAGACGG + Exonic
1129427679 15:75476058-75476080 GTGTGTGCCTGGAGAGGCCAAGG + Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1130025409 15:80266886-80266908 GTGTGTGCGTGCAGGGCATGGGG + Intergenic
1130059558 15:80559753-80559775 GTGCCTGAGTGGAGAGGAGACGG - Intronic
1130311035 15:82754521-82754543 GTGTGTGCTTGGGGAGTAGAAGG - Intergenic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1130764743 15:86858486-86858508 GTGTGTGTGTGTAAGGGAGCAGG + Intronic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131094571 15:89647358-89647380 GTGTGAGCTTGGACGGGAGAGGG - Intronic
1131345898 15:91647812-91647834 GTGTGTTTGTGGAAAGGAGAAGG + Intergenic
1131353003 15:91718590-91718612 GAGTGTGTGTTGAAGGGAGAAGG + Intergenic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1131783066 15:95881090-95881112 GTGTGTGCGTGGAGTGGAGGGGG + Intergenic
1131808477 15:96147892-96147914 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1132026110 15:98405703-98405725 GTGTGTGTGTGTATGAGAGAGGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132159925 15:99531231-99531253 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1132166956 15:99602720-99602742 GTGTGTGTGTGGGGGGGTGGGGG + Intronic
1132296380 15:100737753-100737775 GTGTGTGTGTAGTGGGGACAAGG - Intergenic
1132316703 15:100895545-100895567 GTGTATGCGTTAAGGGGAGAGGG - Intronic
1132360072 15:101204898-101204920 TTGTGTGTGTGGCGGGGGGATGG - Intronic
1132636421 16:952064-952086 ATGTGTGCGTGGAGGGGTCCTGG + Intronic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1133252009 16:4488754-4488776 GTGTATGCGTTGAGTGGAGAAGG + Intronic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1133715117 16:8440427-8440449 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1133738448 16:8633158-8633180 GCTTGTGCGTGGAGGGGAAGGGG - Intronic
1134001515 16:10786660-10786682 GAGTGTGCGGGGATGGGAGGGGG + Intronic
1134006570 16:10822225-10822247 GTGGGTAGGGGGAGGGGAGAGGG - Intergenic
1134185591 16:12082718-12082740 GTGTGTGGGTGGCTGGGACAAGG + Intronic
1134224813 16:12381684-12381706 GTGGGTGGGTGGTGGGGGGATGG - Intronic
1134232567 16:12439957-12439979 GTGTGTGGGTGCAGGGGACGTGG + Intronic
1134293166 16:12920171-12920193 GTGGGTACGGGGAGGGGGGAGGG + Intronic
1134395835 16:13862499-13862521 GTGTGTGTGTGGAGTGGTGTGGG - Intergenic
1134427441 16:14164447-14164469 GTGTGTGCGGGGGTGGGGGATGG + Intronic
1134608212 16:15587506-15587528 GTGTGTGCCTGGAGGGGGCCTGG + Exonic
1134644908 16:15858199-15858221 GTGCGTGCGTGGACAGGAGCGGG - Intergenic
1134661994 16:15991275-15991297 GTGTGTGTGTGGTGGGGTGCGGG + Intronic
1134665229 16:16013881-16013903 GTGTGTGGCTGGAGCAGAGATGG + Intronic
1134859568 16:17549017-17549039 GTATGTGCGTGGAGGGGTTGTGG + Intergenic
1135111033 16:19691098-19691120 ATGTGTGCGTGGCGGGGAGCGGG - Intronic
1135274853 16:21103345-21103367 GTGTGTGTGTGGGGGGGGGCAGG + Intronic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135828857 16:25755121-25755143 ATGTGTGGGTGGAGGGGTGGAGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136225957 16:28860720-28860742 GTGTGTGTGTCGGGGGGAAATGG - Intronic
1136445477 16:30315145-30315167 GTGTGTATGGGGAGGGGAGGTGG - Intergenic
1136554860 16:31001677-31001699 GTGTGTGCATAGCAGGGAGAGGG - Intronic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1138214766 16:55193934-55193956 GTGTGTGTGGGCAGGGGACAGGG - Intergenic
1138350190 16:56342209-56342231 GTGTGGGCCTGGAGTGGGGAAGG + Intronic
1138478074 16:57283844-57283866 GAGTGTGCGTGTTGGGGAGTCGG + Intronic
1138565894 16:57832647-57832669 GTGTGTGTGTGTTGGGGAAAGGG - Intronic
1138608741 16:58106211-58106233 GTGTGTGGGTGGGTGGGAGTGGG - Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139420720 16:66848052-66848074 GTATTTGTGGGGAGGGGAGAAGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139968785 16:70761013-70761035 GTGTGTGCATGGGGGGGCGGGGG + Intronic
1140002639 16:71040489-71040511 TTGTGTGTGTGGGGGGGAGGGGG - Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140608553 16:76570536-76570558 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
1140799871 16:78476456-78476478 TGGGGTGCGGGGAGGGGAGAGGG + Intronic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141173377 16:81704558-81704580 GTGAGTGGGTGGGGGGGTGAGGG - Intronic
1141271058 16:82541642-82541664 GTGGGTGCCAGGAGGGGAGGAGG - Intergenic
1141280068 16:82623410-82623432 GTGTGTGTGTGCTGGGGGGAGGG - Intergenic
1141542423 16:84736086-84736108 GTGTGTGAGTGGCGAGGGGAGGG + Intronic
1141588157 16:85048967-85048989 GTGTGTGTGTGAGAGGGAGAGGG + Intronic
1141599086 16:85114404-85114426 GTGTGTTGGAGGAGGGGAAAGGG - Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1141928977 16:87188142-87188164 ATGTGTGCGTGGGGGGGTGTGGG + Intronic
1141944093 16:87297846-87297868 GTGGCTGGGTGGAAGGGAGATGG + Intronic
1142172605 16:88630753-88630775 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
1142363654 16:89638796-89638818 GTGTGTGTGTGCAGGGGTGGGGG - Intergenic
1142363710 16:89639032-89639054 GTGTGTGCGTGCAGGGGTGGGGG - Intergenic
1142363753 16:89639201-89639223 GTGTGTGCGTGCAGGGGTGGGGG - Intergenic
1142363768 16:89639263-89639285 GTGTGTGCGTGCAGGGGTGGGGG - Intergenic
1203095541 16_KI270728v1_random:1252700-1252722 GTGTGTGTGTGGGGGGGGGGTGG + Intergenic
1142478546 17:204365-204387 GTGGGTGGGTGGAGGACAGATGG - Intergenic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1143107890 17:4538495-4538517 GTGTGTGCATGGATGGGAGGTGG - Exonic
1143168128 17:4909279-4909301 GTCTTTGTGTGGAGTGGAGAGGG - Intergenic
1143225515 17:5299114-5299136 GTGTGTGTGTGGAGGGGGTGTGG + Intronic
1143353795 17:6309379-6309401 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1143997456 17:11019605-11019627 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
1144341110 17:14310894-14310916 GTGTGTGGGTGGATGGGTGTGGG + Intronic
1144700239 17:17332875-17332897 GTGTGGGAGTGGAGGGTATATGG + Intronic
1145257835 17:21337326-21337348 GTGTGTGTGTGGAGGGGGAGAGG + Intergenic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1145318798 17:21750681-21750703 GTGTGTGTGTGGAGGGGGAGAGG - Intergenic
1145684044 17:26637413-26637435 GTGTGTGCATGGAGGGGGTGGGG + Intergenic
1145936100 17:28715747-28715769 GGGTGTGGGTGCTGGGGAGAAGG + Intronic
1146200136 17:30850297-30850319 GTGGGAGAGGGGAGGGGAGAGGG - Intronic
1146419934 17:32674157-32674179 GTGTGGGGGTGGAGTGGAAACGG + Intronic
1146665279 17:34698122-34698144 GTGTGTGTGTGTTGGGGAAAGGG - Intergenic
1146710998 17:35041282-35041304 GTGTGTGTGTTGAGGGGAGGAGG - Intronic
1146723912 17:35142233-35142255 GGGTGTGCGTGGATGGGGGCGGG - Intronic
1146742841 17:35301447-35301469 GTGTGAGCTTGGTGGGGGGAGGG + Intergenic
1147063455 17:37902213-37902235 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1147149906 17:38508718-38508740 GGCTGTGGGTGGAGGAGAGAGGG + Intronic
1147241148 17:39091300-39091322 GGGTGTGTGTTGCGGGGAGATGG - Intronic
1147258732 17:39196815-39196837 GGGTGTGGGGGGAGGGGAGCAGG + Intronic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147365217 17:39954574-39954596 GTGTGTCCGTGGAGGGGAAGTGG - Intergenic
1147923578 17:43933241-43933263 GTGGGTGGGTGGAGGTGGGAGGG - Intergenic
1148110918 17:45144357-45144379 GCCTCTGTGTGGAGGGGAGAGGG + Intergenic
1148201618 17:45753365-45753387 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201625 17:45753396-45753418 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201633 17:45753427-45753449 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201641 17:45753458-45753480 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201648 17:45753489-45753511 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148340982 17:46873292-46873314 GTGGGTGGGTGGAGTGGGGAGGG - Intronic
1148350527 17:46938809-46938831 GTGTGTGTGTGAAAGAGAGAGGG + Intronic
1148553881 17:48566358-48566380 GTCTGTGCGTGTTGGGGAAAGGG + Intronic
1148654843 17:49275546-49275568 GTGTGTGTGTGGTGGGGTGGGGG + Intergenic
1148695962 17:49558435-49558457 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1149345353 17:55728794-55728816 GTGTGTGTGTGTAGGGGGTAGGG + Intronic
1149427630 17:56570285-56570307 GGCTGTGAGAGGAGGGGAGATGG - Intergenic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149661584 17:58336943-58336965 GTGTATGTGTGGCGGGGACAGGG + Intergenic
1150004699 17:61462541-61462563 GAGGGTGCAGGGAGGGGAGAGGG + Intronic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150643614 17:66965149-66965171 GTGTGTGTGTGGGGCGGCGAGGG - Intronic
1150810727 17:68354949-68354971 GTGTGTGCATGTAGGTGTGATGG + Intronic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151376483 17:73692303-73692325 GTGTGTGTGTGGTGGGGATGGGG - Intergenic
1151381296 17:73727471-73727493 GGGTGTGTGTGGAGGAGAAAGGG + Intergenic
1151391693 17:73791499-73791521 GTGTGTGTGTGGAGGGGGTGTGG - Intergenic
1151446025 17:74164633-74164655 GTGTGTGTGTTGTGGGGGGATGG - Intergenic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151784070 17:76266403-76266425 GTGTGTGTGTGGAGGGGGAGGGG - Intronic
1151954495 17:77373625-77373647 GGGGGTGCGCTGAGGGGAGACGG + Intronic
1151954500 17:77373646-77373668 GGGAGTGCGCTGAGGGGAGACGG + Intronic
1152053387 17:78000619-78000641 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152371604 17:79891914-79891936 GTGGGGGCTTGGAGGGGAGGTGG - Intergenic
1152388277 17:79988106-79988128 GTGTGTGTTTAGAAGGGAGAGGG + Intronic
1152426900 17:80222931-80222953 GTGTGTGCGTGTTGGGGTGTGGG + Intronic
1152466692 17:80470685-80470707 GTGTGCGTGTGCAGGGGCGACGG + Exonic
1152615271 17:81334924-81334946 GTGAGGGCGTGGATGGCAGAGGG - Intergenic
1152721485 17:81926018-81926040 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
1152767251 17:82148191-82148213 ATGGGTGCGTGGATGGTAGATGG + Intronic
1152767466 17:82148936-82148958 GTGGGTGGGTGGATGGTAGATGG + Intronic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1152884353 17:82840649-82840671 GTGTGTGGGTGCGGGGGAGGGGG + Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153541740 18:6163250-6163272 GTGTGTGTGTGGGGGGGGGGTGG + Intronic
1153742627 18:8144899-8144921 GTGAGTTCATGGATGGGAGAAGG + Intronic
1153829672 18:8911151-8911173 GTGTATGTGTGGAGGGGTGGAGG - Intergenic
1153844767 18:9039304-9039326 GTGTGTGTGTGGCGGGGCGGGGG - Intergenic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154354218 18:13612547-13612569 GTGTGAGCGTGGAGGGGGGGGGG - Intronic
1154961148 18:21309897-21309919 GTGTGTGTGGGGAGGGGATGGGG - Intronic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155838818 18:30622560-30622582 GTGTGTGTGTGTAGGGGGCAGGG + Intergenic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156281003 18:35638455-35638477 GTGTGTGTGTGGGGTGGGGAAGG - Intronic
1156343560 18:36235273-36235295 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1156463657 18:37335503-37335525 GTGTGTGTGTGGAGGTGTGGGGG + Intronic
1156627819 18:38931017-38931039 GTGTGTGTGTGGAGGTGGGGAGG + Intergenic
1157142457 18:45123393-45123415 GTGTGTGTGTGGCGGGGGCAGGG + Intergenic
1157184625 18:45528175-45528197 GTGTGTGCGGGGGGGGGGGGGGG + Intronic
1157469358 18:47976701-47976723 GTGTGTGTGTGGAGGGGCGGGGG + Intergenic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1158262425 18:55622893-55622915 GTGTGTGTGTGTTGTGGAGATGG + Intronic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158416936 18:57256946-57256968 GTGGTTGAGAGGAGGGGAGAGGG + Intergenic
1158514288 18:58118630-58118652 GTGTGTGTGTGGCGGGGTGGTGG + Intronic
1158591421 18:58782095-58782117 GTGTGTGCGTGAGTGGCAGAGGG - Intergenic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1158828943 18:61257021-61257043 GTGTTTGCATTGAGAGGAGAGGG + Intergenic
1159121844 18:64180036-64180058 GTGTGTGGGTCTAGGGGAGCTGG - Intergenic
1159652235 18:70990572-70990594 GTGGGTGGGGGGAGGGGAGAGGG + Intergenic
1159688929 18:71460714-71460736 GTGTGTGTGTGGAGGTGGGGTGG + Intergenic
1159778366 18:72630538-72630560 GTGTGTGTGTGTGGGGGGGAGGG - Intronic
1159793087 18:72808458-72808480 GTGTGTGTGTGGTGAGGAGATGG + Intronic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160409756 18:78667747-78667769 GTGGGAGGGTGGATGGGAGAGGG - Intergenic
1160409775 18:78667789-78667811 GTGGGAGGGTGGATGGGAGAGGG - Intergenic
1160514860 18:79472638-79472660 GTGTGTGGGGTGAGGGGAGGGGG - Intronic
1161104474 19:2436660-2436682 GGGTGGCCGTGGAGGCGAGAGGG - Intronic
1161125922 19:2557000-2557022 GTGTGTGTGTAGAGGTGGGAGGG - Intronic
1161258636 19:3323404-3323426 GTGTGTGTGTGGTGGGGTGTGGG - Intergenic
1161643076 19:5436370-5436392 GCGCGTGCGGGGAGGGGAGGGGG + Intergenic
1162105019 19:8364852-8364874 GTGTGTGTGTGTAGAAGAGACGG - Intronic
1162412632 19:10515621-10515643 GTGTGTGTTTGGTGGGGAGGGGG - Intronic
1163009730 19:14417485-14417507 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1163627331 19:18397640-18397662 GTGTCTGGGTGGAGTGCAGAGGG + Intergenic
1163672180 19:18636024-18636046 GGGTGTGCAGGGTGGGGAGAGGG + Intergenic
1163672253 19:18636318-18636340 GTGTGTGCGTGGAGGGGGCGAGG - Intergenic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1164678239 19:30117402-30117424 GTGTGTGTGTGGCGGGGGGAAGG + Intergenic
1164685974 19:30167185-30167207 GTGGGTGGGTGGAGGCCAGAAGG + Intergenic
1164745645 19:30610754-30610776 GTGTGTGTGTGGAGGCGGGTGGG + Intronic
1165149786 19:33753774-33753796 GTGTGTGGGTGGTGTGGGGATGG - Intronic
1165723106 19:38093614-38093636 GTGTGTGTGTGGATATGAGAAGG - Intronic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166101989 19:40576536-40576558 GTGGGTGCGGGGTGGGGAGAGGG + Intergenic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166547318 19:43640969-43640991 GTCTGGGCGGGGAGGGGGGAGGG - Intergenic
1166783206 19:45352899-45352921 GTGTCTGAGTTGGGGGGAGAGGG + Intronic
1166917655 19:46206476-46206498 GTGTGTGTGGGGCGGGGTGAGGG + Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167112353 19:47469797-47469819 GTGGGAGCGGGGAGGGCAGATGG + Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1167768149 19:51497879-51497901 GTGAGTGCGGGGTGGGGAGAGGG - Intronic
1167807716 19:51800071-51800093 GTGTGTCAGTGAAGGGGAGCTGG + Intronic
1168103852 19:54155173-54155195 GTGTGTGCGTGCAGGGCAGCTGG + Exonic
1168333202 19:55581134-55581156 GTGTGTGCATGTTGGGGAGCCGG - Intergenic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1168679947 19:58307623-58307645 GTGTGTGTGTTGGGGGGAGCGGG - Intronic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
925055185 2:851802-851824 GTGTGTGTGTGTAGGGGCAAGGG + Intergenic
925059194 2:878165-878187 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059207 2:878211-878233 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059228 2:878326-878348 GCGTGTGTGTGTAGGGGTGAGGG - Intergenic
925160158 2:1677928-1677950 GTGTGTGTGTGCAGCGGAGATGG + Intronic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925999304 2:9317373-9317395 GTGTGTGTGTGGATGTGAGTTGG - Intronic
926096897 2:10087221-10087243 GTGTGTGTGTTTAGGGGAGAGGG - Intergenic
926124343 2:10262738-10262760 GTGTGTCCAAGGAGAGGAGATGG + Intergenic
926327332 2:11796726-11796748 GAGTGTGCTTGGAAGGGAGAAGG + Intronic
926637923 2:15203920-15203942 GTGTGTGAGTGGGGAGGAGGAGG + Intronic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
927011770 2:18911634-18911656 GTGTGTGTGTGTTGGTGAGAAGG + Intergenic
927040571 2:19226545-19226567 GTGTGTGCGGGATGGGGAGCTGG - Intergenic
927168601 2:20350386-20350408 GTGTGCGCGTGCGGGGGAGGGGG - Intronic
927245458 2:20953951-20953973 GTGTGTGTGTGGGGGGGTGTTGG + Intergenic
927291833 2:21412357-21412379 GTGTGTGTGTGGAGGGGGGGTGG - Intergenic
927463541 2:23320443-23320465 GTGTGTGTGTGGGGGGGCGGGGG - Intergenic
927475592 2:23412110-23412132 GTGTGTGCGTGAAGGGGGGGGGG + Intronic
927477978 2:23428599-23428621 GTGTGTGTGTGGCGGGGGGTAGG - Intronic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927721708 2:25387414-25387436 GGGTGAGCGTGGAGAAGAGACGG + Intronic
927735607 2:25518566-25518588 GTGTGTGTGTGTTGGGGTGAGGG - Intronic
927748205 2:25642217-25642239 GTGTGTGTGTTGATAGGAGAAGG + Intronic
927863028 2:26572164-26572186 GGGGGTGGGTGGAGGGGAGATGG - Intronic
927864888 2:26582023-26582045 GAGTGAGCGTGGAGGGGCGATGG + Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928349331 2:30534263-30534285 GTGTGTGTGTGTTTGGGAGACGG + Intronic
928493490 2:31807498-31807520 GGGGGTGGGTGGAGGGGGGAGGG + Intergenic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
928688383 2:33773684-33773706 GTGTGTGGGTGGCGGGGGGTGGG + Intergenic
928887548 2:36167370-36167392 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929356330 2:41029146-41029168 GTGTGTGTGTGGAGGGGGCTGGG + Intergenic
929414041 2:41729512-41729534 GTGTGTGTGTTGGGGGGAGTAGG - Intergenic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
929918683 2:46156856-46156878 GTGTGTGGGAGGTGGGCAGATGG - Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930070031 2:47358812-47358834 CTGTCTGCGTGGGGGGGAAAAGG + Intronic
930241214 2:48937577-48937599 GTGTGTGCTGGAAGGGTAGATGG - Intergenic
930361867 2:50390746-50390768 ATGTGTGTGTTGAGGGGAGGTGG - Intronic
930471097 2:51814840-51814862 TTGTGTGGGTGGGTGGGAGAGGG + Intergenic
930889386 2:56365328-56365350 TTATGTGCCTGGAGTGGAGAAGG + Intronic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931797745 2:65727933-65727955 GTGTGTGGGGGCAGGGGGGAAGG + Intergenic
931957783 2:67447393-67447415 GTGTCTAAGTGGAAGGGAGATGG - Intergenic
931991664 2:67796675-67796697 GTATGTGCGTGATGGGGAGAGGG - Intergenic
932030768 2:68182077-68182099 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932049000 2:68380581-68380603 GGGTGTGGGTGGTGGTGAGAGGG - Intronic
932067461 2:68580821-68580843 GTGTGTGCATGTGGGGGAGGGGG + Intronic
932134464 2:69216079-69216101 GTGTGTGCCAGGAGGTGAAAAGG + Intronic
932156547 2:69423199-69423221 GTGTGTGTGTGGGGGGGGGCGGG + Intronic
932236587 2:70125368-70125390 GTGTGGGCGTCAGGGGGAGACGG - Intergenic
932429306 2:71664435-71664457 GTGTGTACGTGGATGGGGGCTGG + Exonic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932482642 2:72055974-72055996 GGGGGTGGGGGGAGGGGAGAAGG - Intergenic
932495571 2:72144312-72144334 GAGTGTGTTTGGTGGGGAGAGGG - Intronic
932809301 2:74810843-74810865 GTGTGTGGGTGTTGGGGAGGGGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933562565 2:83906639-83906661 GTTTGTGTGTTGAGGGGAAAAGG - Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
933778676 2:85787050-85787072 GGGTGAGGGCGGAGGGGAGAGGG - Exonic
934176431 2:89583043-89583065 GTGTGTGCTGGGATGGGAGGTGG - Intergenic
935354061 2:102181776-102181798 GTGTGTGTGTGGGGGGGGGCGGG + Intergenic
935401446 2:102664551-102664573 GTGTGGGCGGGGAGAGGAGGTGG + Intronic
935467879 2:103420863-103420885 GTGTGTTGGGGGAGGGGATAGGG + Intergenic
935510070 2:103960652-103960674 GTGTGTGTGTGTTGGGGATAGGG + Intergenic
935732374 2:106074634-106074656 GGGTGCACGTGGAGGTGAGACGG + Intronic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
935998333 2:108798690-108798712 GTGTAGGCGTGGAGAGGAGGAGG - Intronic
936321099 2:111467751-111467773 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936519006 2:113200187-113200209 GAGTGTGGGTGGATGGGTGAGGG - Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937019080 2:118633835-118633857 GTGTGTGTGTGGGAGGGAGTGGG - Intergenic
937051260 2:118893024-118893046 GTGAGTGTGTGGAGGGGACCTGG + Intergenic
937212317 2:120282547-120282569 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
937664970 2:124476440-124476462 GTTTGTGGGTGGGTGGGAGAGGG + Intronic
937681961 2:124653914-124653936 GTGTGTGTGTGGCGGGGGGGGGG - Intronic
937708372 2:124948787-124948809 GTGTGTGTGTGAAAGAGAGAGGG + Intergenic
937802963 2:126102263-126102285 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
937863685 2:126732375-126732397 GTGTGTGCGTGGTGATGGGAGGG + Intergenic
937880372 2:126859863-126859885 CTGTATGCATGGAGGGGAGGTGG + Intergenic
937977387 2:127589888-127589910 GTGTGTGAGTGGATGGGTGAAGG + Intronic
938090359 2:128427327-128427349 GTGTGTGTGTGAAGGGTAGGAGG + Intergenic
938308636 2:130270366-130270388 GTGAGTGCATGAAGTGGAGAGGG + Intergenic
938408754 2:131046797-131046819 GTGTGTGTGTGTAGCGGAAAAGG + Exonic
938446697 2:131386471-131386493 GTGAGTGCATGAAGTGGAGAGGG - Intergenic
938719935 2:134057970-134057992 GTGTGTGTGTGGTGAGGGGATGG - Intergenic
939064692 2:137468612-137468634 TTGTGTGTGTGGAGGGGTGGGGG + Intronic
939358043 2:141129567-141129589 GTGTGTGGGGGGAGGGGCGGGGG + Intronic
939519139 2:143207465-143207487 GTGTGTGTGTCAATGGGAGAGGG - Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
939704259 2:145432457-145432479 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
939970684 2:148656015-148656037 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
939996820 2:148927502-148927524 GTGTGTGTGTATAGGGGGGATGG + Intronic
940113735 2:150184359-150184381 GTGTGTGTGTGTTGGAGAGATGG - Intergenic
940122469 2:150282083-150282105 GTGTGGGCGTGGAGTGGATCAGG - Intergenic
940897487 2:159094765-159094787 GTGTGTGTGTGGGGGGGGGGTGG + Intronic
941026859 2:160465833-160465855 GTGTGTGTGTGGTGTGGGGAGGG - Intronic
941225189 2:162839050-162839072 GTGTGTGTGTTAGGGGGAGAGGG - Intergenic
941268267 2:163391631-163391653 GTGTGTGTGTGTAGTAGAGATGG + Intergenic
941427762 2:165369654-165369676 GTGTGTGTGTGGAGGCGGGTGGG - Intronic
941584968 2:167346736-167346758 GTGTGTGTGTGGGGGGGGGGTGG + Intergenic
941812091 2:169765327-169765349 GTGTGTGTGTGAAGGAGGGAGGG - Intronic
942264724 2:174211168-174211190 GTGTGTGTGTTGTGGGGAGGAGG - Intronic
942371869 2:175294144-175294166 CTGTGTGCCTGGAGGGGGCATGG - Intergenic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943212458 2:184985603-184985625 GTGTGTGTGTGGGGGGGTGCGGG + Intergenic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
944238360 2:197461587-197461609 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
944542308 2:200765862-200765884 GTGTGTGCCTGGAGAGGTCAGGG - Intergenic
944629038 2:201604159-201604181 GTGTGTGTGTGAAAGAGAGAGGG + Intronic
944995403 2:205288192-205288214 GTGTCTGGGTGGACGGGACAGGG - Intronic
945034062 2:205689005-205689027 GTGTGTACAGGGAGTGGAGAAGG + Intronic
945067191 2:205957249-205957271 GTGTGTGTGTGGGGAGGAGTGGG + Intergenic
945207027 2:207343171-207343193 GTGTGTGCCTGGTGGGGGTAGGG + Intergenic
945570105 2:211456679-211456701 GGATGTGGGAGGAGGGGAGAGGG + Intronic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
946092625 2:217243499-217243521 GTGTGTGTGTGTTGGGGAAAGGG - Intergenic
946410616 2:219513531-219513553 GTGGGGGCGTGGAAGGGAGCAGG - Intergenic
946759677 2:222981107-222981129 GTGTGTGTGTGGTGTTGAGAAGG - Intergenic
946976614 2:225160039-225160061 GTGTGTGTGTGGAGGGGTGGGGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947333449 2:229054710-229054732 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
947391215 2:229641506-229641528 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
947508905 2:230732772-230732794 GTGTGTGCCTGTAGGAGAAATGG + Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947718026 2:232351591-232351613 ATGTGTGCAGGGAGGGGACAGGG - Intergenic
947741491 2:232486937-232486959 GTGTGTGCAGGGAGGGGACAGGG - Intronic
948264226 2:236625586-236625608 GTGTGTGTGTGGGGGGGGGCGGG + Intergenic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948313417 2:237007789-237007811 GTGTGTGGCTGGGGTGGAGAGGG + Intergenic
948542330 2:238699531-238699553 GAGTGGGCGGTGAGGGGAGAGGG + Intergenic
948564645 2:238876131-238876153 GGGTGTGGGTGGAGGGCGGATGG + Intronic
948870285 2:240794422-240794444 GTGTGTGGGTAAAGGGCAGATGG - Intronic
949042521 2:241855857-241855879 GTGTGTGTGTGGAGGTGGGAAGG + Intronic
1168937737 20:1681420-1681442 GTGTGTGTGTGGTGGGGGGCAGG + Intergenic
1168961250 20:1871492-1871514 GTGTGTGTGTGGAGAGGGGGTGG - Intergenic
1169689799 20:8317520-8317542 GTGTGTGTGTGTCGGGGGGATGG - Intronic
1169781190 20:9312343-9312365 GTGTGTGTGTGTAGGGTGGAAGG - Intronic
1169808368 20:9582681-9582703 GTGTGTGTGTGGTGGGGGTAGGG + Intronic
1169867440 20:10217341-10217363 GTGTGTGTGTGGTGGGGCGGGGG + Intergenic
1169870803 20:10246312-10246334 GTATGTGAGGTGAGGGGAGAAGG + Intronic
1170161659 20:13319731-13319753 GTGTGTGTGTGCAGGGGGGAGGG - Intergenic
1170243804 20:14198126-14198148 GTGTGTGCGTGAGAGAGAGAGGG + Intronic
1170549396 20:17463655-17463677 GTGTGTGGGGGGTGGGGGGATGG - Intronic
1170630243 20:18058811-18058833 CTTTATGCCTGGAGGGGAGAGGG + Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170870071 20:20197625-20197647 GTGTGTGCGTGTGGGGGAGGGGG - Intronic
1171200062 20:23233515-23233537 GAGTGTGCGAGGAGAGGTGAGGG + Intergenic
1171957697 20:31472533-31472555 GTGTGTGCATGGAGGGGGTGGGG - Intronic
1172033946 20:31999031-31999053 GTGTGTGTGTGGGGGGGTGGGGG - Exonic
1172215085 20:33230034-33230056 GTGTGTGTGTGGTGGGGTGAGGG - Intergenic
1172330531 20:34073284-34073306 GTGTGTGTGTGGTGGGGCGGGGG + Intronic
1172579407 20:36034996-36035018 GTGTGTGTGTGCTGGGGAAAGGG - Intergenic
1172946105 20:38690678-38690700 GTGTGTGTGTTGGGGGGAGGGGG + Intergenic
1173032541 20:39375670-39375692 GTGTGTGTGTGTAGAGGAGGAGG + Intergenic
1173364759 20:42375144-42375166 GTGTGTGTGTCGGGGGGACAGGG + Intronic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1173631988 20:44523320-44523342 GTGTATGTGTGGTGAGGAGAGGG - Intergenic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1173672224 20:44806575-44806597 GTGGGTTTGGGGAGGGGAGAAGG - Intronic
1173966861 20:47119117-47119139 GTGAGTAGTTGGAGGGGAGACGG - Intronic
1174080550 20:47968383-47968405 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174216272 20:48918968-48918990 GTGTGTGTGTTGGGGGGAGTGGG + Intergenic
1174306067 20:49615073-49615095 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1174561991 20:51437827-51437849 ATTTGTGCGTGTTGGGGAGATGG - Intronic
1174814898 20:53678183-53678205 GTGTGTGCGGGGTGGGGGAAGGG + Intergenic
1175172573 20:57090856-57090878 GTGTGTGGGTGGAGGTGTGTGGG - Intergenic
1175787129 20:61718760-61718782 GTGTGTGTGTGCAGGGGTGTAGG - Exonic
1175932789 20:62500830-62500852 GTTTGTGTGTGCAGGTGAGAGGG + Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176283238 20:64327398-64327420 GAGTGAGCGGGGAGGGGAGATGG - Intergenic
1176309526 21:5142299-5142321 GTGGCTGCGTGGCGGGGAGAGGG - Intronic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1177436210 21:21056514-21056536 GTGTGTGTGTGCATGAGAGAGGG + Intronic
1178021844 21:28417253-28417275 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1178194068 21:30322393-30322415 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1178623643 21:34197987-34198009 GTGTGTGTGTTGAGAGGAGGAGG + Intergenic
1178837863 21:36113664-36113686 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1178942838 21:36921743-36921765 GTGTCTGAGTGCAGGGGACAGGG - Intronic
1179847534 21:44119734-44119756 GTGGCTGCGTGGCGGGGAGAGGG + Intronic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1180296793 22:10946222-10946244 TTGTGTGGGTGGGGGGGAAAAGG + Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180488007 22:15819165-15819187 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1180664897 22:17502951-17502973 GTGTGTGTGTTAAGGGGACAAGG - Intronic
1180791270 22:18576979-18577001 GTGTGTGCGTGGTTGGGGGGGGG - Intergenic
1181248182 22:21516534-21516556 GTGTGTGCGTGGTTGGGGGGGGG - Intergenic
1181586788 22:23857064-23857086 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1182666596 22:31964664-31964686 ATGTGTGTGTGGTGGGGTGAGGG + Intergenic
1182860034 22:33551727-33551749 GTGGATGCGTAGAGGGGACAGGG - Intronic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1183080037 22:35450434-35450456 GTCTGTCCCAGGAGGGGAGAGGG - Intergenic
1183110282 22:35643777-35643799 GTGTGTGTGTTGAGGGGATGGGG - Intergenic
1183131479 22:35840648-35840670 GTGTGTGTGTAGGGGGGAGGAGG + Intronic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183385470 22:37511648-37511670 GGGTGTGAGGGGAGAGGAGAGGG + Intronic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183602068 22:38845465-38845487 GTGTGTGCGTGGATGTGTGCTGG + Intergenic
1183774119 22:39951759-39951781 GTATTTGAGGGGAGGGGAGATGG - Intronic
1183824278 22:40372453-40372475 GTGTGGTCTGGGAGGGGAGAGGG + Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184035774 22:41917427-41917449 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1184212580 22:43044632-43044654 GAGTGGGCGTGGAGAAGAGAGGG - Intronic
1184284755 22:43464325-43464347 GTGTGTGTGTGGTGGGCATAGGG + Intronic
1184538149 22:45101525-45101547 GGGTGAGGGGGGAGGGGAGAAGG - Intergenic
1184602550 22:45552178-45552200 GTGTGTGCTAGGAGGGAGGAGGG + Intronic
1184796255 22:46735064-46735086 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
1184885889 22:47344200-47344222 GTGTGTGTGAGGCTGGGAGAGGG + Intergenic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
949163741 3:912303-912325 GTTTGTGCATGGAGCAGAGAGGG - Intergenic
949577587 3:5353536-5353558 GTGTGTGTGCACAGGGGAGAGGG + Intergenic
949646503 3:6101285-6101307 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
949663014 3:6303706-6303728 GTCTGTGTGTGGAGTGTAGAGGG - Intergenic
950023804 3:9807118-9807140 GTGTGTGAAAGGAGGGGAGGTGG + Intronic
950358105 3:12428649-12428671 GAGTGTGCGTGGAGCAGAAAGGG + Intronic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950903584 3:16517631-16517653 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
950916764 3:16653966-16653988 GTGTGTGTGTGGAGAAGGGAGGG - Intronic
950919786 3:16682590-16682612 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
951078700 3:18425803-18425825 GTGTGTGAGTGGGAGGGAGGAGG + Intronic
951106046 3:18744301-18744323 GTGTGTGCGTTTATGAGAGAGGG - Intergenic
951532702 3:23712651-23712673 CTGTGTGAGTCGAGGAGAGATGG + Intergenic
951588438 3:24238269-24238291 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
951882886 3:27496654-27496676 GTGTGTGTGTGAGGGAGAGAGGG - Intergenic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952124841 3:30288635-30288657 GTGTGTGTGTTGTGGGGCGATGG + Intergenic
952448539 3:33408370-33408392 GTGTGTGTGTGAAGGAGAGAGGG + Intronic
952498405 3:33936163-33936185 GTGTGTGTGTGGAGTGGGGGAGG + Intergenic
952643350 3:35625200-35625222 GTGTGTGTGTGGTGGGGGGGGGG - Intergenic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952955394 3:38554118-38554140 GTGTGTGCGTGTATGTGTGAGGG + Intronic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
953031512 3:39183000-39183022 GTGTGTGTGTGATGGGGATAGGG + Intergenic
953151362 3:40328378-40328400 GTGTGTGTGTGGGGGGGGGGCGG - Intergenic
953337988 3:42110309-42110331 GTGTGTGTGTTGAGGGGTGGGGG + Intronic
953444663 3:42952824-42952846 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
953660996 3:44891500-44891522 GTGTGTGTGTAGAGGAGGGAGGG - Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
953818556 3:46183641-46183663 GTGTGTGCGTGCTGTGGAGGAGG + Intronic
954285675 3:49617431-49617453 GTGTAAGCAAGGAGGGGAGAGGG - Intronic
954439623 3:50514746-50514768 GTGTGTGTGTGTAGGGGTGGTGG - Intergenic
954574145 3:51665816-51665838 GTGTGTGTGTTGTCGGGAGAAGG + Exonic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954659399 3:52218911-52218933 GTGGGTGGGGGGTGGGGAGATGG + Intergenic
954759802 3:52865886-52865908 GTGTGTGTGTGTAGGGGCGGTGG + Intronic
955156820 3:56425199-56425221 GTGTGTGTTTTGTGGGGAGATGG - Intronic
955286094 3:57643408-57643430 GTGTGTGTGTTGTGGGGGGAGGG - Intronic
955404894 3:58619861-58619883 ATGTGTGTGTGGTGGGGAGGTGG + Intronic
955558480 3:60163424-60163446 ATGTGTACGTGGAGGGGTGGTGG - Intronic
955863553 3:63357613-63357635 GTGTGTCTGTTCAGGGGAGAGGG + Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
955937508 3:64115454-64115476 GTGTGTGTCTGCATGGGAGATGG - Intronic
956145551 3:66187699-66187721 GTGTGTGAGTGTAGGGGTTATGG - Intronic
956167720 3:66408952-66408974 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
956189592 3:66596045-66596067 ATGGGTGCCTGGAGGGGAGGTGG + Intergenic
956245316 3:67176098-67176120 GTGTGTGAGAGGTGGGGGGAGGG + Intergenic
956312523 3:67897028-67897050 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
956610497 3:71117534-71117556 GTGTTTGTGTGTATGGGAGAGGG + Intronic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956825929 3:72996933-72996955 GTGTGTGCGAGGGAGGGGGAGGG + Exonic
956900584 3:73711797-73711819 GTGTGTGTGTGGGGGGGTGTTGG - Intergenic
956911880 3:73826630-73826652 GTATGAGCGAGGCGGGGAGACGG - Intergenic
956994417 3:74807869-74807891 GTATGTGTGTGGCAGGGAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957209113 3:77237435-77237457 GTGTGTGTGTGGTGGTGATAAGG + Intronic
957583349 3:82105026-82105048 GTGGGTGGGGGGAGGGGAGAGGG - Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
959051380 3:101527934-101527956 GTGTGTGTGTGGGGGGGGGGCGG - Intergenic
959315957 3:104807127-104807149 GGGGGTGGGTGGAGGGGGGAGGG - Intergenic
959427067 3:106204318-106204340 GTGTGTGTGTGAAAGAGAGATGG - Intergenic
959548052 3:107620934-107620956 GTGTGTGTGTGGGGGGGTGGGGG + Intronic
959805538 3:110548461-110548483 GTATATGTGTGGAGGGGACAGGG - Intergenic
959907643 3:111728413-111728435 TTGTGTGTGTGTAGGTGAGAGGG + Intronic
959948127 3:112149109-112149131 GTGTGAGCGTGGAGCAGAGAAGG + Intronic
960187767 3:114664594-114664616 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961484112 3:127205507-127205529 GGGTGTGAGTGGAGGTGAGGTGG - Intergenic
961930830 3:130531005-130531027 GTGTGTGTGTGTAGAGGAGGGGG - Intergenic
961951822 3:130757506-130757528 GTGTGTGTGTGTCGGGGAGAGGG - Intergenic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962540237 3:136374229-136374251 GTGTGTGCCTGCATGTGAGATGG + Intronic
962588219 3:136862851-136862873 GTGGGTGGGGGGAGGGGAGAGGG - Intronic
962758104 3:138483725-138483747 GGGTGAGGGTGGAGGGGAGGTGG - Intergenic
962776660 3:138667422-138667444 GTGTGTGTGTTGTGGGGAGGAGG + Intronic
963178225 3:142324237-142324259 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
964290506 3:155174370-155174392 GTGTGTGTGTGAAGGGTAAATGG + Intronic
965177981 3:165361089-165361111 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
965211049 3:165790059-165790081 GTGTGTGTGTGAGGGGGGGATGG + Intronic
965519822 3:169661300-169661322 GTGTGTGTGGGGGGGGGAGTTGG - Intronic
965567968 3:170140952-170140974 GGGTGTGCCTGGTGGGGAGAAGG + Intronic
965883410 3:173414108-173414130 GTGGGGGCCTGGAAGGGAGAGGG + Intronic
966323657 3:178730400-178730422 GTGTGTGTGTGGGGGGGTGTTGG - Intronic
966351361 3:179035505-179035527 GAGTGTGTGTGGTGTGGAGAGGG - Intronic
966656132 3:182360515-182360537 GTGTGTGTGTGTAGGGGGAAAGG + Intergenic
966917985 3:184595127-184595149 GTGTGTGTGTGGTGGGGGAAGGG + Intronic
967089758 3:186125563-186125585 GTGTGTGTGTGTAGTGGTGATGG + Intronic
967089897 3:186126446-186126468 GTGTGTGTGTGTAGTGGTGATGG + Intronic
967089920 3:186126577-186126599 GTGTGTGTGTGTAGTGGTGATGG + Intronic
967124826 3:186414009-186414031 GTGTGTGTGTTGAGGGGGGCCGG + Intergenic
967266985 3:187699718-187699740 GTGTGTGTGTGGAGTGGCAATGG - Intronic
967276470 3:187780330-187780352 GTGTGTGTGTAGGGGGCAGAAGG - Intergenic
967424986 3:189316658-189316680 CAGTGTGCGTGGTGGGGACAGGG - Intronic
967676513 3:192305518-192305540 GTGTGTGTCTGGAAGAGAGACGG - Intronic
967889190 3:194352960-194352982 GTGGGTGTGTGGAGGCGAGCAGG + Intergenic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
967986271 3:195097815-195097837 GTGTGTGCGTGGTGGGGGGGTGG - Intronic
967997955 3:195180731-195180753 GTGTGTGCTTGCAGGGGTGGGGG - Intronic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968085968 3:195874031-195874053 CTGTGTGCGTGCTGGGGAGCCGG - Intronic
968103927 3:195988178-195988200 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
968302229 3:197625768-197625790 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
968576310 4:1367842-1367864 GTGTGTGTGGGGTGGGGACAGGG - Intronic
968833407 4:2945278-2945300 GTGTTTGCGGGGAGGGCATATGG - Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
969061037 4:4435069-4435091 GTGTGTGTGTGATGGGGAGGGGG + Intronic
969103022 4:4784304-4784326 GTGTGTGTGTGGTGGGGATAAGG - Intergenic
969115634 4:4869162-4869184 GTGTGTGTGTGGTGGGGGGGAGG + Intergenic
969162533 4:5273841-5273863 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
969496494 4:7529387-7529409 GTCTGTTCTAGGAGGGGAGATGG - Intronic
969599149 4:8165640-8165662 GTGTGGGCATGGAAGGGATAAGG + Intergenic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
969860309 4:10030569-10030591 GTGTGTGGGTGTAGGGGGGCAGG + Intronic
970041180 4:11798589-11798611 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970754893 4:19413881-19413903 GTGTGTGTGTGGCGGGGGGGGGG - Intergenic
970980861 4:22095417-22095439 GTGTGTGGGTGGAGTGGGGTAGG + Intergenic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
971504887 4:27355707-27355729 GTGTGTGTGTTGCGGGGGGAGGG + Intergenic
971598151 4:28558243-28558265 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
971846214 4:31922154-31922176 GTGTGTTTGTGGTGGGGAGCAGG - Intergenic
972446355 4:39148044-39148066 GTGTGTGTGTGGAGGGGGGGCGG - Intergenic
973001832 4:44961404-44961426 GCGTGAGCATGGAAGGGAGAAGG + Intergenic
973110349 4:46390197-46390219 GTGTGTGGGGGGGGGGGAGGGGG - Intronic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973570479 4:52233939-52233961 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
973856818 4:55019740-55019762 GTGTGGGCTGGGAGGTGAGAAGG - Intergenic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
974102773 4:57436128-57436150 GGGGGTGCGTGGAGGGGGAAGGG - Intergenic
974164490 4:58184136-58184158 GTATGTGTGTGGGGGGGAGTGGG + Intergenic
974394136 4:61313475-61313497 GTGTGCCCATGCAGGGGAGAAGG + Intronic
974459359 4:62167229-62167251 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
974758354 4:66242823-66242845 GGGTGGGCGGGGAGGGGGGAGGG - Intergenic
974795546 4:66744515-66744537 GTGTGTGTGTGGAGGTGGGTGGG - Intergenic
975043959 4:69780007-69780029 GTGTGTGTGTGAGGGAGAGAGGG - Intronic
975244360 4:72102517-72102539 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
975799503 4:78045121-78045143 GTGTGTGTGTGTGGGGGAGGGGG + Intergenic
976114261 4:81710204-81710226 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
976432623 4:84980831-84980853 ATGGGTGGGGGGAGGGGAGAGGG - Intergenic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976657454 4:87504173-87504195 GTGTGTGTGTGGTGGGGTGGGGG + Intronic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977113248 4:92987442-92987464 GGGGGTGGGAGGAGGGGAGAGGG + Intronic
977286538 4:95114633-95114655 GTGTGTGTGTCTAGGGGAAAAGG - Intronic
977429713 4:96915946-96915968 GTTTGTGTGTACAGGGGAGATGG + Intergenic
977435766 4:96992392-96992414 GTGTGTGGGTGGGTGGGGGAAGG - Intergenic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
977671099 4:99696614-99696636 GTGGGTGCAGGGAGGGGTGAAGG - Intergenic
978085418 4:104646166-104646188 GTGTGTAAGAGGTGGGGAGAAGG + Intergenic
978781004 4:112554194-112554216 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
978861155 4:113450495-113450517 GTGTGTGCCTGGTGGGGATAGGG + Intergenic
978980396 4:114937879-114937901 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
979171620 4:117607687-117607709 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980688725 4:136263269-136263291 GTGTGTGTGTGGTGGAGCGAGGG - Intergenic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
981784357 4:148461176-148461198 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
982120690 4:152140302-152140324 GTGAGTTGGGGGAGGGGAGAGGG + Intergenic
982149294 4:152434953-152434975 GTGTGTGGGGGGGGGGGAGCGGG - Intronic
982353484 4:154442530-154442552 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
982705116 4:158700545-158700567 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
982934001 4:161447991-161448013 GTGTTTGTTTGGAGTGGAGAGGG + Intronic
983415527 4:167448116-167448138 TTGTGTGCGTGGAGTGCAGGGGG + Intergenic
983474288 4:168195692-168195714 GTATGGGCATGGAGTGGAGAGGG - Intergenic
983861209 4:172709230-172709252 TGGGGTGCTTGGAGGGGAGAGGG - Intronic
984867300 4:184292613-184292635 GAGTGTGTGTGGAGGGGCGGGGG + Intergenic
984902956 4:184600978-184601000 GTTTGAGCTTGGTGGGGAGAGGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985490426 5:175609-175631 GTGTCTGCCTGGAGGGGTCAGGG - Intronic
985490510 5:175903-175925 GTGTCTGCCTGGAGGGGTCAGGG - Intronic
985490526 5:175961-175983 GTGTCTGCCTGGAGGGGTCAGGG - Intronic
985498093 5:221890-221912 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
985516105 5:345490-345512 GTGTGTATGTGGGGGGGAGGGGG + Intronic
985524403 5:394769-394791 CTGGTTGCGTGGAGGGCAGAGGG + Intronic
985632488 5:1021357-1021379 GTGGGTGGGTGGAGGGGCGGGGG - Intronic
985673822 5:1219984-1220006 GTGTGTGTGTGCAGGGGGGTGGG + Intronic
985986542 5:3521208-3521230 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986350834 5:6878142-6878164 GTGAGTGCCTGGTGGGCAGAGGG + Intergenic
986428436 5:7657555-7657577 ATGTGTGCATGGCAGGGAGATGG - Intronic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
987058527 5:14219185-14219207 GTGTGTATGTGAAGTGGAGAGGG + Intronic
987095557 5:14546266-14546288 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
987385436 5:17324808-17324830 GTGTGTGTGTGGTGGGGAAGGGG - Intergenic
987435786 5:17892595-17892617 GTGTGTGAGGGGAGAGGAAACGG + Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
987591411 5:19932555-19932577 GTGTGTGTATTGTGGGGAGAGGG - Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987699404 5:21376531-21376553 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
987703668 5:21434949-21434971 TGGGGTGCGGGGAGGGGAGAGGG - Intergenic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
988489806 5:31696789-31696811 GTCAGTGCTTGTAGGGGAGAAGG - Intronic
988494167 5:31730599-31730621 GTGTGTGTGTGTAAGGGAGTTGG + Intronic
988735478 5:34016215-34016237 GTGCGGGGGTGGTGGGGAGAGGG + Intronic
988867931 5:35355579-35355601 GTGTGTGTGTGTAGTGGGGAGGG + Intergenic
989300246 5:39882866-39882888 GTGTGTGTGTGGTGGTGGGAAGG + Intergenic
989445399 5:41522705-41522727 GAGTGTGGGGGCAGGGGAGAAGG - Intergenic
990151271 5:52820372-52820394 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
990683135 5:58268554-58268576 GTGAGTGGGTGGGGAGGAGAGGG - Intergenic
991038630 5:62153565-62153587 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
991044804 5:62211428-62211450 GTGTGTGTTTGTATGGGAGAGGG - Intergenic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
991584780 5:68190810-68190832 GTGTGTGGGTGGAGGGTTGGGGG - Intronic
992147774 5:73869208-73869230 GTGTGTGTGTGGGGTGGAGGGGG + Intronic
992179866 5:74185372-74185394 GTGTATGTTTGGATGGGAGAGGG - Intergenic
992487046 5:77207729-77207751 GTGTGCAAGTGGAGGGGAAATGG - Intergenic
992492502 5:77259072-77259094 GTGTGTGTGTGGGGGGGGGGCGG - Intronic
992775064 5:80082173-80082195 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993426011 5:87765002-87765024 GTGTGTGTGCGGGGGGGAGGTGG + Intergenic
993566311 5:89480153-89480175 GTGTGTGTGTGAAGGGGAAGAGG - Intergenic
993759613 5:91776786-91776808 GTGTGTGCTTGGAAGGGAGGGGG + Intergenic
994382177 5:99084576-99084598 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
994615620 5:102100580-102100602 GTGGGAACATGGAGGGGAGAAGG - Intergenic
994682060 5:102900245-102900267 GTGTGTGTGTGGGGGGGGGGCGG + Intronic
995312135 5:110726097-110726119 GTGTGTGTGTGAAAGAGAGAGGG - Intronic
995492555 5:112708005-112708027 GGGAGTGCGGGGAGGGGAGAGGG - Intronic
995501544 5:112812474-112812496 GTGTGTGTGTGGAGAGGAAGGGG - Intronic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
996336090 5:122385701-122385723 GTGTGTGTGTGTAGGGGTGCAGG + Intronic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996645273 5:125807265-125807287 GTGTGTGTGTGTATGAGAGATGG - Intergenic
996772123 5:127097004-127097026 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
997620959 5:135294602-135294624 GTGTGTGTGTGTATGAGAGAGGG + Intronic
997652590 5:135533618-135533640 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
997869906 5:137498255-137498277 GTGTGTGTGTGGTTGGGAGGGGG - Intronic
998052897 5:139051185-139051207 GTGTGTGTGTTCAAGGGAGAGGG - Intronic
998150560 5:139754952-139754974 GTGTGTGTGTGCAGTGGAGAGGG + Intergenic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998200220 5:140113294-140113316 GTGTGTGCGGGGAGGGGGAGCGG + Intronic
998228032 5:140341912-140341934 GTGTGTGGGTGGAGGGGCTGTGG - Intronic
998234800 5:140389113-140389135 GTGTGTGTGTGTAGTAGAGACGG - Intergenic
998394201 5:141807780-141807802 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998849276 5:146338577-146338599 GTGTGTGTGTGTGGTGGAGAGGG + Intronic
998954105 5:147420733-147420755 GTGTGTTGGTGGTGGAGAGAAGG - Intronic
998957655 5:147453795-147453817 GGGTGTGCGTGGGGGGGCGGGGG - Intronic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999195347 5:149778000-149778022 GTGTGTCTGTGGGGGGGGGAAGG - Intronic
999442453 5:151612982-151613004 GTGTGTGTGTGGTGGGGGGGTGG + Intergenic
999484574 5:151983115-151983137 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
999842451 5:155443475-155443497 GTGTGTGTGTGCTAGGGAGATGG + Intergenic
999956469 5:156708738-156708760 GTGTGTGCGTGTGTGAGAGAGGG + Intronic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000714561 5:164624517-164624539 GTGTGTGTGTGGAGAGGTGTTGG - Intergenic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1001051192 5:168415789-168415811 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1001064377 5:168524276-168524298 GTGTGTGTGTTCAGGAGAGACGG - Intergenic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1001229601 5:169974832-169974854 GTGTGTGTGTCGGGGGGAGGGGG - Intronic
1001230007 5:169978383-169978405 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1001304667 5:170563011-170563033 GTGTGTGGGTGGAGGTGAGGAGG - Intronic
1001638967 5:173232178-173232200 GTGGGTGCGTGGGCGGGCGACGG + Exonic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1002183364 5:177442676-177442698 CTGTGTGGGTGAAGGGGATAGGG + Intronic
1002187148 5:177459655-177459677 GGGAGTCCGTGGAGGGGAGGAGG + Intronic
1002345948 5:178547627-178547649 GTGTGTGTGTGGGGGGGTGTGGG - Intronic
1002346092 5:178548062-178548084 GTGTGTGTGTGGGGGTGAGGGGG - Intronic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1002526691 5:179819311-179819333 GGGGGGGCGGGGAGGGGAGAAGG - Intronic
1002624798 5:180518495-180518517 TTGTGTGTGTGGGGGGGAGGAGG + Intronic
1002893788 6:1362107-1362129 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1002915858 6:1527237-1527259 GGGTGTGTGTGGAGGGGGCAGGG - Intergenic
1002923664 6:1592305-1592327 GTGTGTGTGTGGAGAGGGGTAGG - Intergenic
1003256988 6:4483238-4483260 GTGTCTGTGTGGTGGGGAGGGGG - Intergenic
1003281500 6:4696115-4696137 GTGGCTGAGGGGAGGGGAGATGG + Intergenic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004313096 6:14563259-14563281 ATGTGTGTGTGGAGTGGGGAAGG + Intergenic
1004720687 6:18265188-18265210 GTGTGAGAGAGGAGAGGAGAAGG - Intergenic
1004889739 6:20089139-20089161 GTGTATGGGTAGAGGGGACAGGG + Intergenic
1005108017 6:22246417-22246439 GTGTGTCTGTAGAGTGGAGAAGG + Intergenic
1005161093 6:22864648-22864670 GTTTGTGGGAGGTGGGGAGAAGG + Intergenic
1005364138 6:25060505-25060527 GTGTGTGTGTGGAAAGGGGAGGG + Intergenic
1005511617 6:26516935-26516957 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1005573796 6:27173044-27173066 GTGTGTTTGTGTAGGGGAGGAGG + Intergenic
1005882647 6:30072653-30072675 GTGTGTGTGTGGAGTGGGGGAGG - Intronic
1005988948 6:30891561-30891583 GTGTGTGTGTGTAGGGGGGCTGG + Intronic
1005990588 6:30899465-30899487 GTGTGTCCAGGAAGGGGAGAAGG - Intronic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006405073 6:33840334-33840356 GTGTGTGCGTGGAAGAGGGGAGG - Intergenic
1006450774 6:34104606-34104628 GTGTGTGCCAGGTGGGGAGCAGG - Intronic
1006643385 6:35499889-35499911 GTGTGTGTGTGAGGGGGTGAGGG + Intronic
1006779551 6:36623068-36623090 GTGTGTGTGTGGAGGGGGTGAGG + Intergenic
1006795713 6:36731130-36731152 GTGTGTGTGTGTAGGGGTGGGGG - Intronic
1006804172 6:36777755-36777777 GTGTGTGTGTGGTGGGGGGGGGG - Intronic
1006917361 6:37603145-37603167 GTGTGTGTGTGGAGGGGGGGCGG + Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007210174 6:40187386-40187408 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007362839 6:41371257-41371279 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1007384206 6:41509779-41509801 GTGTGTGTGTAGCGGGGAGGGGG - Intergenic
1007462903 6:42030909-42030931 GAGTGTGCGTGGATGGGGGTGGG + Intronic
1007466910 6:42058938-42058960 GTGTGTGGTTGGGGGGCAGAGGG + Intronic
1007561046 6:42808670-42808692 GGGTGTGTGTGGGGGAGAGATGG + Intronic
1007652120 6:43429400-43429422 GTGTGTGTGTGGCGGGGGGGAGG + Intronic
1007659575 6:43475535-43475557 GTGTGTGCGTTGATGGGGGGTGG + Intergenic
1007701673 6:43769726-43769748 GTGTGTGCGTGTGGGGTTGAGGG + Intergenic
1007751248 6:44073275-44073297 GAGCGTGCGCGGAGTGGAGAGGG + Intergenic
1007775588 6:44222906-44222928 GTGTGCGCGCGGAGGGGGGTGGG - Intronic
1007907595 6:45477927-45477949 GTGTGTGGGTGGAAGGCAGTTGG - Intronic
1008023512 6:46607454-46607476 GTGTGTGTGTGTAGGGGGAAGGG - Intronic
1008042758 6:46819202-46819224 GTGGGTTTGTGGAGGTGAGAAGG + Intronic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008129303 6:47702250-47702272 GTGTGTGTGTTGGGGGGAGTTGG + Intronic
1008153581 6:47987250-47987272 GTGGGTGGGGGGAGGGGGGAAGG + Intronic
1008224235 6:48892898-48892920 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1008396726 6:51017300-51017322 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1008544119 6:52570796-52570818 GTGTGTGCGTGTGGGGGGGGGGG - Intronic
1008646229 6:53517668-53517690 GTGTTTGTGTGGAAGGGAGAAGG + Intronic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1008936421 6:56997414-56997436 GTGTGTATGTGGTGGGGAGATGG - Intronic
1009032435 6:58076048-58076070 GTATGTGCTTGCAGGGGTGAAGG - Intergenic
1009208044 6:60827821-60827843 GTATGTGCTTGCAGGGGTGAAGG - Intergenic
1009290507 6:61875168-61875190 GTGTGGGCGTGGTGGGGGCAGGG + Intronic
1010205049 6:73315068-73315090 GAGTGTGCTGGGCGGGGAGAGGG - Intergenic
1010977588 6:82333241-82333263 GTGTGGCAGTGGAGGGGTGAGGG - Intergenic
1011009908 6:82692128-82692150 GTGTGTATGTGGAGGGGAGGAGG - Intergenic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011311199 6:85981492-85981514 GAATGTGCATGGAGTGGAGAAGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011785783 6:90843112-90843134 GGGTGGGGGTGGAGTGGAGATGG + Intergenic
1011891085 6:92160512-92160534 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1011926780 6:92655033-92655055 GTGTGTCTGTGCAGGTGAGATGG + Intergenic
1012033096 6:94098246-94098268 TTGTGTGCCTGCAGGAGAGAGGG - Intergenic
1012398948 6:98828830-98828852 GGGTGGGCGGGGAGGGGAGCAGG - Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012654963 6:101805927-101805949 GTCTGAGCCTGGAGTGGAGATGG + Intronic
1012790104 6:103682414-103682436 GTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1012950163 6:105509738-105509760 GTGTGTGTGGGGTGGGGAGGTGG + Intergenic
1013115310 6:107099091-107099113 GTGTGTGGGTGGAGGGGGATGGG + Intronic
1013597183 6:111670767-111670789 GTGGGTGGGTGGTGGGGAGGCGG + Intronic
1013697301 6:112718795-112718817 GTGTGTGTGTGGTGGGGATTAGG + Intergenic
1013759762 6:113503578-113503600 GTGTGTGAGTTGAAGGGGGAGGG + Intergenic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1014082204 6:117300668-117300690 GTGTGTGGGGGGAGAAGAGAAGG + Intronic
1014107339 6:117582263-117582285 GTGTGTGTGTGTAGGGGGGGAGG - Intronic
1014193013 6:118519572-118519594 GTGTGTGTGTGGCGGGGGGGGGG + Intronic
1014384949 6:120788668-120788690 GTGTGTGTGTGGGCAGGAGAGGG - Intergenic
1014564586 6:122932065-122932087 GTGTGTGTGTTGTGGTGAGAGGG + Intergenic
1014878707 6:126694651-126694673 GAGAGAGAGTGGAGGGGAGAGGG + Intergenic
1015267740 6:131305989-131306011 GTGTGTGTGTGTAGGAGAGCTGG - Intergenic
1015356870 6:132287607-132287629 GTGTATGGGGGTAGGGGAGAGGG + Intergenic
1015847146 6:137532497-137532519 GTGTGTGTGTGGCGGGGGTAGGG + Intergenic
1016013380 6:139161044-139161066 GTGTGTGTGTGTCGGGGACAGGG + Intronic
1016068354 6:139707591-139707613 GTGTGTGGGTTGCGGGGGGAGGG + Intergenic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016376862 6:143430222-143430244 GTGTGCGAGTGGAGTGGAGGGGG - Intronic
1016440932 6:144082625-144082647 GGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1016612025 6:146000474-146000496 GAGTGTGTGTGGAGGGGATGGGG + Intergenic
1016764298 6:147774872-147774894 GTGTGTGTGTGAAGAGGAGGTGG - Intergenic
1017013345 6:150080015-150080037 GTATGTACTTGGAGGGCAGATGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017705983 6:157123236-157123258 GTGTGTGTGTGGGGGGGGGGCGG - Intronic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1017878598 6:158544207-158544229 GTGTGTGTGTGTTGGGGTGAGGG + Intronic
1018128932 6:160709552-160709574 GTGTGTGCTTGGGGTGGTGAAGG - Intronic
1018397203 6:163387609-163387631 GTGTGTGTGTGGAGCGGGAAGGG - Intergenic
1018541793 6:164888702-164888724 GTTTGTGTGTGTAGGGGAAAGGG - Intergenic
1018732156 6:166659379-166659401 GGGTGGCCGGGGAGGGGAGAGGG + Intronic
1018747240 6:166772169-166772191 GTGCTTGCCAGGAGGGGAGAAGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018767422 6:166945098-166945120 GTGTGGACGTGGATGGGTGAGGG - Intronic
1019036754 6:169067315-169067337 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1019381694 7:727409-727431 GTGCGGGCGTGGAGGGGGGCGGG - Intronic
1019401886 7:859487-859509 GTGTGTGTGGGGAGGAGTGAGGG + Intronic
1019537445 7:1536732-1536754 TTCTGTGCATGGTGGGGAGAGGG + Intronic
1019546861 7:1582065-1582087 GTGTGTTCGTGGAGGGGCTGTGG + Intergenic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019693938 7:2434091-2434113 GTGGGCGGGCGGAGGGGAGAGGG - Exonic
1020084731 7:5304079-5304101 GTTTGTGCGTGGACGGGGGCTGG + Exonic
1020154429 7:5710724-5710746 GGGTGGGAGTGGAGTGGAGATGG - Intronic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020401980 7:7789614-7789636 GGGTCTGTGGGGAGGGGAGAAGG - Intronic
1020579902 7:9983941-9983963 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1020873577 7:13665850-13665872 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021168135 7:17365567-17365589 GTGTGTGTGTTGGGGGCAGAAGG - Intergenic
1021189397 7:17602698-17602720 GCCTGCGCGTGGAGTGGAGAGGG - Intergenic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021652082 7:22842234-22842256 GTATGTGTGTGGCGGGGGGAGGG - Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022812731 7:33885557-33885579 GTGTGTGTTTGGTGGGGGGATGG - Intergenic
1023259268 7:38341808-38341830 GTGTGTGTGTGGCGGGGGGCGGG + Intergenic
1023346026 7:39271985-39272007 GTGTGTGGGGGTGGGGGAGAGGG + Intronic
1023535780 7:41207734-41207756 GGGTGTGGGGGGTGGGGAGATGG + Intergenic
1023649124 7:42350365-42350387 GTGTTTGCGTGTATGTGAGAAGG + Intergenic
1023806027 7:43873494-43873516 GTGTGTATGTGGCGGGGCGAGGG + Intronic
1023826760 7:44014953-44014975 GTGTGTGTGTGGCGGGGGTAGGG - Intergenic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024343886 7:48293193-48293215 GTGTGTGTGTGGCGGGGGGGGGG - Intronic
1024728501 7:52228720-52228742 GTGGGTGTGGGAAGGGGAGAGGG + Intergenic
1024967411 7:55036262-55036284 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1025262245 7:57426861-57426883 GTGTGTGTGTGTAGGGGGGGGGG + Intergenic
1025662373 7:63563729-63563751 GTTTGTGCATGGACGGGAGCTGG + Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026361150 7:69601121-69601143 GTGTGTGGGGGGTGGGGACAGGG - Intronic
1026438012 7:70416828-70416850 GTGTGTCAGAGGAGGGGAGCAGG - Intronic
1026796472 7:73369112-73369134 GTGTGTGTGTGAAGAGGGGATGG - Intergenic
1026800699 7:73398024-73398046 GGCTGTGCGTGGAGCAGAGATGG - Intergenic
1026869106 7:73840123-73840145 GTGTGTGTGTGGGGGGGGGTGGG + Intronic
1026931423 7:74224847-74224869 GAGTGTGGGTGGAGGGGCCATGG + Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027137859 7:75637981-75638003 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1027154336 7:75755877-75755899 GTGTGTGTGTGTAGTAGAGATGG - Intergenic
1027231721 7:76276556-76276578 GTGGGTGGGAGGTGGGGAGAGGG + Intronic
1027629527 7:80585313-80585335 GTGTGTGTGTGGAGGTGGGGGGG + Intronic
1027828083 7:83142033-83142055 GTGTGTGTGTCGGGGGGAGGGGG - Intronic
1027828085 7:83142035-83142057 GTGTGTGTGTGTCGGGGGGAGGG - Intronic
1027861799 7:83593324-83593346 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1027869286 7:83686121-83686143 GTGTGTGTGTGTAGTAGAGACGG - Intergenic
1028033162 7:85944404-85944426 GTGTGTGTGTGGTGGGGTGGGGG - Intergenic
1028091692 7:86710554-86710576 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
1028385013 7:90244958-90244980 ATGAGTGGGTGGAGGGGTGAGGG - Intergenic
1028487924 7:91380281-91380303 GTGTGTGTGTTGGGGGGAGGGGG - Intergenic
1028487926 7:91380283-91380305 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1028541471 7:91947186-91947208 GTGTGTGTGTGCTGGAGAGAGGG + Intronic
1028796546 7:94908704-94908726 GGGGGTGTGTGTAGGGGAGAGGG + Intronic
1028821319 7:95215112-95215134 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1029699264 7:102235767-102235789 GTGTGTGTGTGGCGGGGACGGGG - Intronic
1029737916 7:102474704-102474726 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029755048 7:102568354-102568376 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029772998 7:102667434-102667456 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030088133 7:105834849-105834871 GTGATGGAGTGGAGGGGAGAGGG + Intronic
1030112469 7:106038495-106038517 GTGTGTGTGTGGTGGTGAGTGGG + Intergenic
1030271488 7:107673566-107673588 GTGTATGGGTGGTGGGGACAGGG - Intronic
1030655453 7:112162540-112162562 GTGTGTGGGTGGCAGGGAGAGGG - Intronic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031481046 7:122279055-122279077 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1031662683 7:124445767-124445789 GTGTGAGGGCTGAGGGGAGAAGG - Intergenic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1032417449 7:131747319-131747341 GTGTGTGTATGGAGGGGTGGGGG + Intergenic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032876163 7:136040762-136040784 GTGTGTGTGTGGGGGGGCGGTGG + Intergenic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1032902321 7:136323755-136323777 GTGTGTGTGTGGTGGGGTGGTGG + Intergenic
1033013036 7:137642960-137642982 GTGTGTGTGTGTATGGGGGATGG + Intronic
1033016635 7:137678269-137678291 GTGTGTTGGTGGGGGGCAGAGGG - Intronic
1033019215 7:137705555-137705577 GTTGCTGAGTGGAGGGGAGATGG + Intronic
1033181331 7:139182088-139182110 GTGTGTGTGTGGAGGGGCGGGGG + Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033571199 7:142630443-142630465 GTGTGTGTGTGTTGGGGAGGAGG - Intergenic
1033671089 7:143493926-143493948 GTGTGTGGGAGGAGGGGTGAAGG - Intergenic
1033808852 7:144986071-144986093 GGGTGTGGGTGGATGGGGGATGG + Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034416371 7:150966376-150966398 GTGTGTGGGGGGGGGGGAGGGGG - Intronic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034440863 7:151085573-151085595 GTGTGTTGGTGGGGGGGAGGGGG + Intergenic
1034858968 7:154580190-154580212 GTGTGTGTGTGTAAGGGGGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035054500 7:156025274-156025296 GTGTGTGTGTGGATGGGTGTGGG + Intergenic
1035122475 7:156579748-156579770 GTCTGTGAGTGGTGGGGGGAGGG + Intergenic
1035278954 7:157765466-157765488 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035279069 7:157765961-157765983 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035288194 7:157819550-157819572 GTGTGTGCTTGGGGCGGGGAGGG - Intronic
1035330231 7:158091924-158091946 GTGGGTGGGTGGATGGGTGAGGG + Intronic
1035583310 8:753723-753745 GTGTGTCTGTGGAGTGGATAAGG - Intergenic
1035714098 8:1740632-1740654 GGCTATGCGTGCAGGGGAGAGGG - Intergenic
1035815920 8:2540300-2540322 GTGTGTGCGGAGAAGGGAGGCGG + Intergenic
1035866128 8:3084073-3084095 ATCTGTGAGTGGATGGGAGAAGG + Intronic
1036141202 8:6210344-6210366 GTGTGTGTGTAGAGAGGAGTTGG - Intergenic
1036273169 8:7325883-7325905 GTGTGTGTGTGGCGGGGGGTGGG - Intergenic
1036348181 8:7984467-7984489 GTGTGTGTGTGGCGGGGGGGGGG + Intergenic
1036410330 8:8494011-8494033 GTGTGTGCGTGGATGGATGGTGG + Intergenic
1036727119 8:11230274-11230296 GTGTGTGCGTGGAGGAGGAAGGG + Intergenic
1036963743 8:13273718-13273740 GTGTGTGTGTGTAAGGGGGAAGG + Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037670726 8:21013138-21013160 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1037674253 8:21040872-21040894 GTGTGTGTGTGCATGAGAGAGGG - Intergenic
1037808237 8:22070103-22070125 GTGTGAGGGGGGAGGGGTGAAGG + Intronic
1038007401 8:23444403-23444425 GTGGGTTCCTGGAGGGGAGAGGG - Intronic
1038205282 8:25459121-25459143 GAGTGTGCGCGGACTGGAGAAGG + Exonic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1038533824 8:28339590-28339612 GTGTGTGTGTGGAGTGGGGAGGG - Intronic
1038588765 8:28816294-28816316 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1038740254 8:30211053-30211075 GGGTGGGCGTGGAAGGCAGAGGG - Intergenic
1038786476 8:30622114-30622136 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1038887842 8:31685132-31685154 GTTTGAGCTTGGAGGGGAAATGG + Intronic
1039053449 8:33514952-33514974 GTGTGTGCGCGCAGGGGCGAGGG + Intergenic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1040354832 8:46607682-46607704 GTGTGTGCATGTAGGGGGGTGGG + Intergenic
1040534809 8:48299537-48299559 GTGTGTGTGTGTTGGGGAGGCGG - Intergenic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1040975692 8:53191921-53191943 ATGTGTGCATGAGGGGGAGATGG - Intergenic
1041015877 8:53592868-53592890 GTGTGTGTGTTGGGGGGTGAGGG - Intergenic
1041100996 8:54396347-54396369 GTGTGGGCATTGCGGGGAGAAGG + Intergenic
1041351019 8:56947653-56947675 GTGTGTGTGTTGCAGGGAGAGGG - Intergenic
1041446445 8:57955929-57955951 GTGTGTGCATGGAGTGGGGTGGG - Intergenic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1041750507 8:61255486-61255508 ATGTGTGTGTGGAGAGGTGAAGG + Intronic
1042077335 8:65010455-65010477 GTGTGTGGGTGGCAGGGAGTAGG - Intergenic
1042103721 8:65301487-65301509 GTGTGTGCATGGAGTGGGGGTGG - Intergenic
1042164543 8:65933098-65933120 GTGTGTGCATGCATGGGGGAGGG + Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042702647 8:71633455-71633477 GTGTGTGTGTTGGGGGGAGATGG + Intergenic
1042910532 8:73821510-73821532 GTGTGTGTGTGGTGGGGGGGTGG + Intronic
1043151267 8:76719176-76719198 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
1043202068 8:77382846-77382868 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1043428361 8:80171180-80171202 GTGTGCGTGTGTGGGGGAGAGGG - Intronic
1043440974 8:80276830-80276852 GTGTGTGTGTGTATGTGAGATGG - Intergenic
1043725079 8:83601309-83601331 GTGTGTGTGTGGTCGGGGGAGGG + Intergenic
1043792483 8:84490111-84490133 GTGTGTGTGTTGAGTGGGGAGGG + Intronic
1044646492 8:94449189-94449211 GTGTGTGTGTGGTGGGGGGCGGG - Intronic
1044727928 8:95208172-95208194 GTGTGTGTGTGTGGGGGAGGGGG + Intergenic
1045039742 8:98211756-98211778 GTGTGTGTGTGTAGGGGTGGGGG + Intronic
1045420399 8:102008907-102008929 GTGTGTGTGTGTAGGGGGGCGGG - Intronic
1045594532 8:103636789-103636811 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1045739143 8:105334150-105334172 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1045788055 8:105946887-105946909 GTGTGTGTGTGGCGGGGGGTTGG - Intergenic
1046360494 8:113147660-113147682 GTAGGTGTGTGGAGGGGAGAGGG + Intronic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1046605694 8:116369247-116369269 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1046707492 8:117471369-117471391 GTGTGTGTGTGGAGTGGGGTGGG - Intergenic
1046739821 8:117816006-117816028 GTGTGTGTGTGGGGTGGGGAGGG + Intronic
1046890357 8:119415853-119415875 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1047192234 8:122688648-122688670 GTTTGTGCGGGGCGGGGTGAAGG - Intergenic
1047789175 8:128185206-128185228 CCGTGTACGTGGAGGGGGGAGGG - Intergenic
1048274551 8:133056499-133056521 GTGTGTGCCTGGAAAGGACAGGG - Intronic
1048633611 8:136271550-136271572 GTGTGTGTGTGGCGGGGGGGGGG - Intergenic
1048786030 8:138051339-138051361 TTGTGTGTGTGGCGGGGAGTTGG + Intergenic
1048995469 8:139791310-139791332 GTGTGTCTGTGCAGGGGAGACGG - Intronic
1048995501 8:139791565-139791587 GTGTGTCTGTGCAGGGGAGATGG - Intronic
1049202391 8:141346682-141346704 GCCTGTGCGTGGAGGGTGGAGGG + Intergenic
1049325917 8:142021381-142021403 ATGTGTTCGTGGATGGTAGAAGG - Intergenic
1049410046 8:142469793-142469815 GCGTGTGCGTGGGGGGGATGGGG + Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049465024 8:142747150-142747172 GTGGGTGGGTGGAGGAGGGATGG + Intergenic
1049569317 8:143361003-143361025 GTGTGTGCGTGGTGGGGCTGGGG + Intergenic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1049736422 8:144209065-144209087 GTGTGTGTGTTTAGTGGAGACGG + Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050151364 9:2622077-2622099 GTGGGGGCGGGGAGGGGAAAGGG - Exonic
1050403606 9:5283588-5283610 GTGTGTGGGGGGAGGAGATATGG - Intergenic
1050654789 9:7815896-7815918 GTGTTTGCGGGGAGGGGGGAGGG - Intronic
1050791675 9:9479217-9479239 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1050860129 9:10418436-10418458 GTGTGTGTGTGTAGAGGGGAAGG - Intronic
1051604798 9:18908649-18908671 GGGTGTGTGTGGAGTGGGGAGGG - Exonic
1051714697 9:19970128-19970150 GGTTATGCGTGGAGGGGTGATGG - Intergenic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052438388 9:28460815-28460837 GTGTGTGGGGGGAGGGGTGGAGG + Intronic
1052554857 9:30000605-30000627 GTGTGTGTGTGTTGGGGCGAGGG + Intergenic
1053056640 9:34996885-34996907 GTGTGTGTGTGCTGGGGAGATGG + Intronic
1053141168 9:35683528-35683550 GTGCTTGCTTAGAGGGGAGAGGG + Intronic
1053272412 9:36759392-36759414 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1053303426 9:36967720-36967742 GTGAGTGAGTGGAGGTGAGGGGG + Intronic
1053345780 9:37377300-37377322 GTGTGTGTGTGTAGGAGAGAAGG + Intergenic
1053606650 9:39666820-39666842 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054158647 9:61658565-61658587 TTGCGTGCGTGTTGGGGAGAGGG - Intergenic
1054175135 9:61869613-61869635 TTGCGTGCGTGTTGGGGAGAGGG + Intergenic
1054246887 9:62675586-62675608 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1054478421 9:65589570-65589592 TTGCGTGCGTGTTGGGGAGAGGG - Intergenic
1054662402 9:67711183-67711205 TTGCGTGCGTGTTGGGGAGAGGG - Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1054959139 9:70947741-70947763 GTGTGTGGGTGGGGGAAAGAAGG + Intronic
1054993231 9:71354362-71354384 GTGTGTGGGTGGATGGGATGCGG - Intronic
1055008282 9:71534483-71534505 GTGTGTGTGTGGAGGGGTGGTGG + Intergenic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1055447118 9:76394432-76394454 GTGTGAGCGGGGTGGGGGGAGGG + Exonic
1055494932 9:76844594-76844616 GTATGTATGTGGAGGGGAGATGG - Intronic
1055801622 9:80042902-80042924 GTGTGTGCGTGTAGGGGAATGGG - Intergenic
1055967585 9:81880658-81880680 GGGTGTGAGTGTTGGGGAGAGGG + Intergenic
1056658494 9:88527731-88527753 GTGTATGTGTGGAGGGGTGTGGG + Intergenic
1056806082 9:89729802-89729824 GTGTGTGTGTGTGGTGGAGAGGG + Intergenic
1057117715 9:92541412-92541434 GTGTGGGCGGGGTGGGGAGGGGG - Intronic
1057140348 9:92722937-92722959 GTGACTGCCTGGAGAGGAGAGGG + Intronic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057439306 9:95071279-95071301 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057837310 9:98455552-98455574 GTGTGTGTGTGGTGGAGGGAGGG + Intronic
1057869566 9:98708167-98708189 GTGTGTGTGGGGAGGGGTGGGGG - Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058017247 9:100048171-100048193 TTGGGTGGGTGGAGGGGGGAGGG + Intronic
1058117337 9:101099095-101099117 GTGTGTGTGTCGGGGGGAGGCGG + Intronic
1058604593 9:106707141-106707163 GTGTGTGGGTGGGGGGGTGGAGG - Intergenic
1058622613 9:106899230-106899252 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1058719541 9:107751160-107751182 GTGTGTGTGTGGAGGCGGGGGGG + Intergenic
1058797989 9:108516975-108516997 GTGTGTGGGGGGAGGGGGCAAGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059115923 9:111599892-111599914 GTGTGTGCGTGTAGGGGGTTAGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059458895 9:114417196-114417218 GTGTCTGCTTTGAGGGGAAATGG + Intronic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1059688604 9:116661863-116661885 TGGGGTGCGGGGAGGGGAGAGGG + Intronic
1059907417 9:119003615-119003637 GTGTGTGTGGGCAGGGGAGGTGG - Intergenic
1060176374 9:121499949-121499971 GTGTGTGTGTGCCGGGGAGGCGG + Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060584842 9:124779535-124779557 GTGTGTGTGTGGTGGGGGGGGGG + Intronic
1060982437 9:127801464-127801486 GTGTGTGTGTGTATGGGGGAAGG + Intronic
1061005182 9:127924863-127924885 GTGTGTGTGTGTAGAGGGGAGGG - Intronic
1061151729 9:128832510-128832532 GTGTGTGTGTGGAGAGGATTGGG - Intergenic
1061213129 9:129204807-129204829 GGGGGTGCGGGGAGGGGTGAGGG + Intergenic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1061483410 9:130908489-130908511 GTGGGTGGAAGGAGGGGAGATGG - Intronic
1061507783 9:131041392-131041414 GTGAGTGCGTGGATGACAGATGG + Intronic
1062063836 9:134515258-134515280 GTGAGTGGGCGGTGGGGAGATGG - Intergenic
1203655961 Un_KI270752v1:25056-25078 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1185451458 X:283079-283101 GTGTGTGTGTGTAGGCGACACGG + Intronic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185709724 X:2293809-2293831 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1185771729 X:2770007-2770029 GTGCGTGTGTGGAGGGGTGGGGG + Intronic
1185815466 X:3151154-3151176 GTGTTTGTGTGTTGGGGAGATGG + Intergenic
1186307913 X:8284275-8284297 GTGTGTGCCTGGAGGAGAACTGG + Intergenic
1186376959 X:9014031-9014053 ATGTGTGTGTGGGGGGGAGGAGG - Intergenic
1186583456 X:10846262-10846284 GTGTGTGCGTGAGGGGGTGGGGG + Intergenic
1186621303 X:11243224-11243246 GTGAGTAGGTGGAGGGGAGCAGG - Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186717673 X:12269735-12269757 GTGTGTGTGTGGAGTGGAAGAGG - Intronic
1187471530 X:19574015-19574037 GGGTGGGCTTGGAGTGGAGATGG + Intronic
1187648166 X:21373151-21373173 GTGTGTGTGTGTGGGGGGGAAGG + Intergenic
1187857292 X:23649585-23649607 GTGTGTCCGTGCACGTGAGATGG + Intergenic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1188170465 X:26918187-26918209 GTGTGTGTGTGGAGGGGGGTGGG + Intergenic
1188732499 X:33668261-33668283 GTGTGTGTGTATATGGGAGATGG + Intergenic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1188919034 X:35948807-35948829 GTGTGTGTGTGTAGGGGTGGTGG + Intronic
1189132493 X:38514747-38514769 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1189273383 X:39767498-39767520 GTGTGTGTGTGCAGGGGGCAAGG - Intergenic
1189700694 X:43714774-43714796 GTGTGTGTGTGGTGGGGAAATGG + Intronic
1189756775 X:44280020-44280042 GTGTGTGTGTGTATGGGGGATGG - Intronic
1189843894 X:45114157-45114179 TTTTGTGGGGGGAGGGGAGAGGG + Intergenic
1190357610 X:49620014-49620036 GTGTGTGCCTGCGGGGGACAGGG - Intergenic
1190368808 X:49722502-49722524 GTGTGTGTGTGGTGAGGGGAAGG + Intergenic
1190440636 X:50471298-50471320 GTGTGTGTGTGGTGGGGGGGGGG + Intergenic
1190454641 X:50615774-50615796 GTTTGTGTGTGGTGGGGGGAGGG + Intronic
1190606168 X:52145469-52145491 GTGGGTGGGGGGAGGGGACAGGG - Intergenic
1190741072 X:53289158-53289180 ATGTGTGTGTGGAGGGGGAAGGG - Intronic
1191902229 X:66053367-66053389 GTGTGTGTGTGGGGGGGGGCGGG - Intergenic
1192146839 X:68688110-68688132 GTGTATGTATGGAGGGGAAAGGG + Intronic
1192319224 X:70076155-70076177 GTGTGTGCGTGGTGGGGCAGGGG - Intergenic
1193191501 X:78576290-78576312 GTGTGTGCGTGCATGTGTGAAGG - Intergenic
1193442270 X:81557036-81557058 GTGTGTGTGTGGGAGGGGGAAGG - Intergenic
1193454514 X:81713700-81713722 GTGGGTGGGAGGAGGGGGGAGGG + Intergenic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1193779759 X:85686841-85686863 GGGTGTGTGTGCAGGAGAGAAGG + Intergenic
1194267958 X:91778578-91778600 GTGTGTGTGTGAAGGAGGGAAGG - Intergenic
1194518343 X:94887654-94887676 GTGTGTGGGTGCTGGGGAGCAGG + Intergenic
1194600422 X:95913814-95913836 GTGTGTGGGTGGGGGGGCGGGGG - Intergenic
1194608864 X:96015684-96015706 ATGTGTGTGTGGAGGGGGGTGGG - Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1194985780 X:100488247-100488269 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1194986590 X:100496423-100496445 GTGTGTGTGTGTAGAGGACAGGG + Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1195600019 X:106735900-106735922 GTGTGTGTGTGTTGGGGGGAGGG - Intronic
1195660278 X:107371183-107371205 GTGTGCGTGTGGAGTGGGGAGGG - Intergenic
1195694263 X:107655230-107655252 GTGTGCGCGTGGAGGGGGAGGGG - Intergenic
1195935022 X:110116891-110116913 GTGTGTGTGTGAAGGGGGGCAGG + Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196160568 X:112478117-112478139 GTGTGTGTGTGAAGGTGAAAAGG + Intergenic
1196322677 X:114360707-114360729 GTGGGAAAGTGGAGGGGAGATGG + Intergenic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1196482675 X:116167795-116167817 GTGTGTGGGTGGAGGTGAGGCGG + Intergenic
1196893611 X:120311932-120311954 GTGTGTGTGGGGCGGGGGGAGGG + Intergenic
1196909155 X:120468606-120468628 GTGTGTGGGTGGGGGACAGATGG - Intronic
1196918143 X:120560692-120560714 CTGCGTGCGTGTAGGAGAGAAGG + Intronic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1197187277 X:123601715-123601737 TTGTGTGCGTGTGGGAGAGAGGG + Intronic
1197630081 X:128848346-128848368 GTGTGTGTGTTGGGGGTAGATGG + Intergenic
1197896938 X:131326378-131326400 GTGTGTGTGTGTTTGGGAGAGGG + Intronic
1198330421 X:135617711-135617733 GTTTCTGTGTGGAGGAGAGATGG - Intergenic
1198336506 X:135671288-135671310 GTTTCTGTGTGGAGGAGAGATGG + Intergenic
1198480755 X:137037686-137037708 GTGTGTGTGTGGTGGGGCTAGGG + Intergenic
1198708009 X:139470262-139470284 GTGTGTGGGTGGGCGAGAGAGGG - Intergenic
1198847585 X:140929348-140929370 GTATGTGTGTGGAGGGGAGGAGG + Intergenic
1198882288 X:141294747-141294769 GGGGGTGGGTGGAGGGGGGATGG - Intergenic
1198968164 X:142249973-142249995 GCCTGGGCGTGGAGAGGAGAGGG + Intergenic
1199053053 X:143260063-143260085 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1199469811 X:148181884-148181906 GTGCGAGCGTGGTGGGGGGAGGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1200120184 X:153786469-153786491 GAGAGTGGGTGGAGGGCAGAAGG + Intronic
1200585164 Y:4999503-4999525 GTGTGTGTGTGAAGGAGGGAAGG - Intergenic
1200778270 Y:7190159-7190181 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201490881 Y:14540114-14540136 GTGTGTGTGTGGTGGGGGGGCGG + Intronic
1201676165 Y:16586949-16586971 GTGTGTGTGTGGCGGGGTGGGGG - Intergenic
1202391504 Y:24375052-24375074 GGGTGTGTGTGGAGTGTAGAGGG - Intergenic
1202479281 Y:25295065-25295087 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic