ID: 1176004106

View in Genome Browser
Species Human (GRCh38)
Location 20:62850467-62850489
Sequence TTCCCATCACAACCCCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 199}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176004098_1176004106 9 Left 1176004098 20:62850435-62850457 CCCAGCCACCGAGGCCAAACCCT 0: 1
1: 0
2: 0
3: 40
4: 1278
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004103_1176004106 -10 Left 1176004103 20:62850454-62850476 CCCTGACGCCTTTTTCCCATCAC 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004095_1176004106 17 Left 1176004095 20:62850427-62850449 CCCATCCACCCAGCCACCGAGGC 0: 1
1: 0
2: 7
3: 63
4: 1088
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004101_1176004106 1 Left 1176004101 20:62850443-62850465 CCGAGGCCAAACCCTGACGCCTT 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004099_1176004106 8 Left 1176004099 20:62850436-62850458 CCAGCCACCGAGGCCAAACCCTG 0: 1
1: 0
2: 1
3: 27
4: 475
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004096_1176004106 16 Left 1176004096 20:62850428-62850450 CCATCCACCCAGCCACCGAGGCC 0: 1
1: 0
2: 3
3: 65
4: 595
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004093_1176004106 18 Left 1176004093 20:62850426-62850448 CCCCATCCACCCAGCCACCGAGG 0: 1
1: 0
2: 3
3: 35
4: 309
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004102_1176004106 -5 Left 1176004102 20:62850449-62850471 CCAAACCCTGACGCCTTTTTCCC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004100_1176004106 4 Left 1176004100 20:62850440-62850462 CCACCGAGGCCAAACCCTGACGC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199
1176004097_1176004106 12 Left 1176004097 20:62850432-62850454 CCACCCAGCCACCGAGGCCAAAC 0: 1
1: 0
2: 1
3: 21
4: 241
Right 1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG 0: 1
1: 0
2: 0
3: 26
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176004106 Original CRISPR TTCCCATCACAACCCCCAAC TGG Intronic
900004608 1:36491-36513 TCCCCAACACATCCCCCAACAGG + Intergenic
900024331 1:207010-207032 TCCCCAACACATCCCCCAACAGG + Intergenic
901203372 1:7479425-7479447 TCCCCATCACCACCCCAAAATGG + Intronic
902844522 1:19099447-19099469 TTCTCCACACAACCCCAAACAGG + Intronic
903646415 1:24898817-24898839 TTCCCTTCACAAATCCCAACTGG + Intergenic
905535749 1:38720524-38720546 TTCCCATCCAAAGCCCCAATAGG + Intergenic
905962290 1:42053447-42053469 TCCCCACCACATCCCTCAACAGG + Intergenic
910129477 1:83886619-83886641 TTTACATGACAAACCCCAACAGG + Intronic
912270477 1:108203583-108203605 CTCCCCTCCCCACCCCCAACAGG + Intergenic
912639753 1:111333495-111333517 TTCCCAGCACATCTCCAAACTGG + Intergenic
912693405 1:111821655-111821677 TTCTCCTCACCACCCCCAACTGG + Intronic
914196921 1:145452428-145452450 CTCCCACCCCAGCCCCCAACGGG + Intergenic
914402053 1:147330561-147330583 CTCGCCTCCCAACCCCCAACAGG - Intergenic
914862959 1:151401352-151401374 TTCCCAGCACATCCCTCACCCGG - Exonic
915936109 1:160091213-160091235 TTCCCACCACAAACACCATCTGG - Intergenic
919112871 1:193241981-193242003 TCCCAATCACAGCCACCAACTGG - Intronic
919920986 1:202166279-202166301 TGCCCCTCCCAACCCCCACCTGG - Intergenic
920997724 1:211011127-211011149 CTACCCCCACAACCCCCAACAGG + Intronic
922451897 1:225744228-225744250 TTCCCCTGCCCACCCCCAACAGG - Intergenic
924735872 1:246755240-246755262 TTCCCATCAAAATCACAAACAGG + Intronic
1063795254 10:9507359-9507381 TTGAAATCACAAACCCCAACTGG - Intergenic
1065398128 10:25263788-25263810 CACCCATCACCACACCCAACTGG - Intronic
1065850722 10:29785504-29785526 TTTCCACCCCAACCCCCACCTGG + Intergenic
1068880952 10:62048258-62048280 TGCCCAGCACAACACCCAAAAGG - Intronic
1068948704 10:62755763-62755785 GACCCATCTCAAGCCCCAACTGG + Intergenic
1069628402 10:69882094-69882116 TTCCCATCACCACCTTCATCAGG - Intronic
1069709880 10:70481352-70481374 GTACCATCACCACCCCAAACAGG - Intronic
1070557274 10:77538465-77538487 TTGCCATCATTACCCCCAGCTGG + Intronic
1073102106 10:101011866-101011888 GTCCCATCCCCACCCCCAGCAGG + Intronic
1073251428 10:102122087-102122109 TCCCCATCTCCACCCCCACCAGG + Intergenic
1075176556 10:120168766-120168788 ATCCCATCACAACACCCTGCGGG - Intergenic
1075234326 10:120712680-120712702 TTCCCATCAGAACTTCCCACGGG - Intergenic
1075340771 10:121645412-121645434 TTCCCATCTCAACCCCACCCAGG + Intergenic
1078806730 11:14713267-14713289 TAACCATCACAAACCCCAAATGG - Intronic
1079381517 11:19942341-19942363 TTCCCAGCACGACCCACAAGAGG + Intronic
1080334973 11:31185252-31185274 TTAGCCTCCCAACCCCCAACAGG - Intronic
1084589474 11:70082086-70082108 TAAACACCACAACCCCCAACTGG - Intronic
1086332705 11:85769931-85769953 TTCCCCTAACAACCTCCACCTGG + Intronic
1087059114 11:93961312-93961334 TTCTAATCACAAGCCCTAACTGG - Intergenic
1088960089 11:114654470-114654492 TCACCACCCCAACCCCCAACAGG + Intergenic
1090279752 11:125445593-125445615 ATCCCACCACGACCCACAACAGG + Intergenic
1091378028 12:38545-38567 TCCCCAACACATCCCCCAACAGG + Intergenic
1094309715 12:29066157-29066179 TTCCAATCACAACTCCCACTGGG + Intergenic
1095885058 12:47180090-47180112 CTCTCCTCACACCCCCCAACAGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1099510433 12:83529157-83529179 TTCCCTTCATAAACCCCAACTGG - Intergenic
1100377982 12:94035077-94035099 TCCCCAACCCCACCCCCAACAGG - Intergenic
1103021466 12:117538070-117538092 TTCCCATGACCACCCACACCTGG - Intronic
1103764149 12:123269882-123269904 TGCCCCTCCCAACCCCCCACGGG - Intronic
1105622338 13:22080370-22080392 TCCCCATAACACCCCCCAAAAGG - Intergenic
1106603639 13:31208556-31208578 TTCCCGTCTCACCCCCCACCCGG + Intronic
1107228520 13:38080401-38080423 CTCTCATCCCATCCCCCAACAGG - Intergenic
1108321285 13:49293313-49293335 ATCCCATCCCAACACCCAACAGG - Exonic
1111499499 13:89097893-89097915 TTCTCATCACTACCCTGAACTGG + Intergenic
1112063999 13:95771785-95771807 TTCCCATCCCACCCCCCCACAGG + Intronic
1112975455 13:105312461-105312483 TTCTCATGACAACCCCATACAGG - Intergenic
1113217867 13:108063334-108063356 TTCCCAGAAAAAACCCCAACTGG - Intergenic
1117375040 14:55112037-55112059 TTCCCCTAACAACCTCCACCTGG - Intergenic
1117882838 14:60328613-60328635 TGCCCATCCCAAGCCCAAACTGG - Intergenic
1118501378 14:66365576-66365598 TTCCCCTCACATCTCCAAACTGG + Intergenic
1119136199 14:72222964-72222986 TTCGTATCACAAACTCCAACTGG + Intronic
1120895381 14:89526698-89526720 TTCCCAACAAAAATCCCAACAGG + Intronic
1122972936 14:105159643-105159665 TTCCATCCACACCCCCCAACAGG + Intronic
1125994602 15:44146151-44146173 TTCCCTTGCCATCCCCCAACAGG + Intronic
1127030610 15:54857411-54857433 CTACCCCCACAACCCCCAACAGG - Intergenic
1130272598 15:82459828-82459850 TTCCCACCACAAGCCCTCACTGG + Intergenic
1130464950 15:84187181-84187203 TTCCCACCACAAGCCCTCACTGG + Intergenic
1130487738 15:84407623-84407645 TTCCCACCACAAGCCCTCACTGG - Intergenic
1130499315 15:84486356-84486378 TTCCCACCACAAGCCCTCACTGG - Intergenic
1130587240 15:85191795-85191817 TTCCCACCACAAGCCCTCACTGG + Intergenic
1132153922 15:99482108-99482130 TTCCCATATCAACCACTAACAGG - Intergenic
1132448900 15:101954452-101954474 TCCCCAACACATCCCCCAACAGG - Intergenic
1132587771 16:713716-713738 TAGCCATCACAATCCCCAAAAGG - Intronic
1132875342 16:2134717-2134739 TCCGCATGACGACCCCCAACAGG + Intronic
1133685327 16:8160702-8160724 TCCCCCTCCCAACCTCCAACAGG - Intergenic
1133920587 16:10149607-10149629 TTCCAAGCACATCCCCAAACTGG + Intronic
1134519640 16:14912643-14912665 TCCGCATGACGACCCCCAACAGG - Intronic
1134554291 16:15153592-15153614 TCCGCATGACGACCCCCAACAGG + Intergenic
1134707312 16:16311299-16311321 TCCGCATGACGACCCCCAACAGG - Intergenic
1134960229 16:18400826-18400848 TCCGCATGACGACCCCCAACAGG + Intergenic
1135795915 16:25442312-25442334 GTCCCACCCCCACCCCCAACTGG - Intergenic
1136063499 16:27743007-27743029 CTCCCACTACACCCCCCAACAGG + Intronic
1137043716 16:35637767-35637789 CTCCCCCCACACCCCCCAACTGG - Intergenic
1137901112 16:52270666-52270688 TCCTCACCGCAACCCCCAACAGG + Intergenic
1141859809 16:86708779-86708801 TTCCAATCAGAATCCCCACCAGG - Intergenic
1145071568 17:19813900-19813922 TTCCCATCAAAATCCCAAAATGG + Intronic
1145410198 17:22653568-22653590 TAGCCCTCCCAACCCCCAACAGG - Intergenic
1147659701 17:42111010-42111032 TTCCCTTCACAACCTGCAGCTGG + Intronic
1149363736 17:55920094-55920116 TTCCCCTAACAACCTCCACCTGG + Intergenic
1151418999 17:73985360-73985382 TTCCCATCACCATCCTCAGCAGG + Intergenic
1151437401 17:74106348-74106370 TCCCCATCCCAACTCCCAACAGG - Intergenic
1152685344 17:81691083-81691105 TTCACATCAAAACCCCCTCCAGG + Intronic
1153661564 18:7330711-7330733 TTTCCATCAGAAGCCCAAACAGG + Intergenic
1154073733 18:11178964-11178986 TGCCCAGCACAACCCACAGCTGG + Intergenic
1155939459 18:31789263-31789285 TCCCCCCCACCACCCCCAACAGG + Intergenic
1156515294 18:37674125-37674147 TGGCCTTCACAAACCCCAACTGG - Intergenic
1158491591 18:57915020-57915042 TTTCCATCCCTACCCTCAACCGG - Intergenic
1158609414 18:58925041-58925063 TATCCATCATAGCCCCCAACTGG - Intronic
1158892141 18:61882767-61882789 TTCCCTTCCCAACCCCCACTTGG + Intronic
1159000863 18:62974060-62974082 ATCCCTTCACAACCCCCAAAAGG + Intronic
1159084025 18:63767125-63767147 TTCACATCACAGTCCCCAACTGG - Intronic
1159538812 18:69749148-69749170 TCCCCACCCCAACCCCCAACAGG - Intronic
1160636360 19:78100-78122 TCCCCAACACATCCCCCAACAGG + Intergenic
1165781065 19:38434602-38434624 TTCCCATCCCTGCCCCCAGCTGG - Intronic
1166690429 19:44819034-44819056 TTCCCATCCCCACCACCCACAGG + Exonic
1167611590 19:50510445-50510467 TCCCCCTCCCAACCCCCAGCAGG - Exonic
925731181 2:6920229-6920251 TTCCCATCTCTACCCCCAGAGGG - Intronic
925965228 2:9059292-9059314 TTCCCATCTCAGCCCCCAAAGGG - Intergenic
926050886 2:9744172-9744194 TTCTCATCACATCCCTCAGCAGG + Intergenic
926613580 2:14972291-14972313 CTCACCTCCCAACCCCCAACAGG - Intergenic
928414388 2:31079498-31079520 TTCCCTTAACAACCTCCACCTGG - Intronic
929449628 2:42028048-42028070 CTCCCATCCCCACCCCCATCTGG - Intergenic
929575897 2:43051474-43051496 TACCCCTCACAAGCCCCAGCTGG + Intergenic
931219929 2:60279896-60279918 TTCCCATCAAATCCCCTCACTGG - Intergenic
931561161 2:63562366-63562388 CTCCCACCACAACCCCCGACAGG - Intronic
935232343 2:101109864-101109886 TTCCCTCCACAAGCCCAAACCGG + Intronic
936565120 2:113576949-113576971 TCCCCAACACATCCCCCAACAGG - Intergenic
937065181 2:119012153-119012175 TTCCCATGCCAACCCCCACAGGG + Intergenic
937288842 2:120769800-120769822 TTCCCAACACACTCCCAAACAGG - Intronic
938252081 2:129823065-129823087 TTCCCTTCACACCTCCCAAGGGG - Intergenic
939033998 2:137109546-137109568 CTCCCATCACCACCCCCAGATGG - Intronic
940857461 2:158740523-158740545 TCCCCATCACAGCCTCCATCTGG - Intergenic
946878718 2:224156718-224156740 TTCCCTTGACAACCCCAAAGAGG - Intergenic
947568916 2:231215585-231215607 TTCCCATCTCCAGCCCCATCTGG - Intronic
948331251 2:237167567-237167589 TTCCCATCAGTACTCCCTACTGG + Intergenic
1170142013 20:13133865-13133887 TTTCCCTAACAACCCCCACCTGG + Intronic
1170211412 20:13849360-13849382 TTCCCATCACAGCCCTGAGCGGG + Intronic
1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG + Intronic
1176673521 21:9755784-9755806 TTCCCGTCACTACCCCAAACAGG - Intergenic
1177651005 21:23962010-23962032 TTGCCACCACCACCCCCGACAGG - Intergenic
1177876099 21:26633314-26633336 TTCCCATCACCACCGGCTACAGG - Intergenic
1178616182 21:34135171-34135193 TACCTATAACAACCCCAAACTGG - Intronic
1178665280 21:34541236-34541258 ATCCCATCTCAACCTCCAATTGG + Intronic
1178857966 21:36266030-36266052 TGCCAATCACAAGCCCCAAGTGG + Intronic
1179354043 21:40642081-40642103 TTCCCATCCCAATCCACAACAGG - Intronic
1179397176 21:41051419-41051441 TTCCCAACACAACACCCTAGGGG + Intergenic
1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG + Intronic
1182036573 22:27203145-27203167 TTCCCATCACCAGCACGAACTGG - Intergenic
1184449512 22:44574693-44574715 TTCCCTTCACAAGCCCCTTCCGG - Intergenic
952985966 3:38783628-38783650 TGCCCATAAAAACCCCAAACCGG - Intronic
954368598 3:50158662-50158684 CTCCTACCACCACCCCCAACCGG - Intronic
955499908 3:59573275-59573297 TACCCATCCCTACCACCAACAGG - Intergenic
955702222 3:61693272-61693294 TTCCCATCACAAAACCTAATGGG - Intronic
959097881 3:101975320-101975342 TCCCCCACCCAACCCCCAACAGG - Intergenic
960062552 3:113339271-113339293 TTCTCTTCACCACCCCCAGCTGG - Intronic
960426921 3:117520189-117520211 TTATCAGCAGAACCCCCAACAGG - Intergenic
961735595 3:129000813-129000835 GTCCTATCCCCACCCCCAACAGG + Intronic
963545883 3:146658149-146658171 GTCCCCTCACAACCCCAAGCAGG - Intergenic
963934337 3:151036721-151036743 TTCTCGTGACAACCCCCACCTGG + Intergenic
967601691 3:191397980-191398002 TTCCCATCAGAACCCACCACTGG - Intronic
971772197 4:30911151-30911173 TTGCCCCCACAACCTCCAACAGG - Intronic
972682644 4:41321525-41321547 TTCCCATCACAGGCCCCAGATGG - Intergenic
975242864 4:72082154-72082176 TTCCCATCACAACTTCAAAAAGG + Intronic
976936667 4:90644616-90644638 CTCCCTCCCCAACCCCCAACAGG + Intronic
978942660 4:114456093-114456115 TTCCCACCCCACCCCCCAATAGG + Intergenic
980687626 4:136250649-136250671 TCCCAATCAAAACCCCCAGCAGG - Intergenic
983213463 4:164980772-164980794 TTGCCCTCCCACCCCCCAACAGG - Intergenic
985551434 5:535304-535326 TCCCCACAACGACCCCCAACGGG - Intergenic
985664780 5:1176436-1176458 TTCCCGTCACTACCACCCACAGG - Intergenic
985836345 5:2274871-2274893 CTCCCATCACACCCTCCCACAGG + Intergenic
985836559 5:2276329-2276351 CTCCCATCACACCCTCCCACAGG + Intergenic
986950250 5:13074288-13074310 CTTCCATCCCAACCCCCAACAGG + Intergenic
987266829 5:16264360-16264382 CTCCCATCCCACCCTCCAACAGG + Intergenic
987584362 5:19835362-19835384 TTCCCTCCCCACCCCCCAACAGG - Intronic
989671981 5:43928711-43928733 TGCTCCCCACAACCCCCAACAGG - Intergenic
992802467 5:80306024-80306046 TTCCCCCCACAGTCCCCAACTGG + Intergenic
993402266 5:87468249-87468271 TACCCATCCCCTCCCCCAACAGG + Intergenic
993614540 5:90095568-90095590 TTCTCTGTACAACCCCCAACTGG + Intergenic
994263908 5:97692024-97692046 ATCCCCACACAACCCCCAAAAGG - Intergenic
996997934 5:129721750-129721772 TCCCCTTCTCCACCCCCAACAGG + Intronic
997207047 5:132056271-132056293 TTCCCATCACTCACCCCCACAGG - Intergenic
997984292 5:138491174-138491196 TTCCCATCACAGCCAGAAACTGG - Intergenic
1005366623 6:25084528-25084550 TCCCCCTCACACCACCCAACTGG - Intergenic
1006180586 6:32151438-32151460 CTCCCTTGACAACCCCCATCTGG + Intronic
1007223642 6:40297813-40297835 CTCCCACCCCAACCCCCAGCTGG + Intergenic
1008249939 6:49227393-49227415 TTGCCCCCTCAACCCCCAACAGG + Intergenic
1018034703 6:159872035-159872057 CTGCCATCACCACCCCCACCAGG - Intergenic
1022791016 7:33689195-33689217 CTCCCGTTCCAACCCCCAACAGG - Intergenic
1024176417 7:46845220-46845242 TCCCCATAACAACCTCCACCTGG - Intergenic
1024715518 7:52075572-52075594 TTGCCCCCACAACCCCCGACAGG + Intergenic
1024997209 7:55280804-55280826 TTCCCACCTCAGCCCCCAAGTGG - Intergenic
1030708932 7:112726344-112726366 TTCCCATTGCAACCCCCGAGTGG + Intergenic
1031244982 7:119300185-119300207 TTCACTTCCCAACCCCCAACAGG + Intergenic
1032098749 7:128955207-128955229 TTTCCCTCACACCCCCAAACAGG + Exonic
1032946158 7:136855318-136855340 TTCTCACCCCCACCCCCAACAGG + Intergenic
1033651323 7:143346053-143346075 TTCCCAGAACATCCACCAACTGG + Intronic
1036572234 8:9990626-9990648 TTCCAATCACCTCCCACAACTGG - Intergenic
1037181142 8:16006931-16006953 CTCCCCTCACAACCACCAGCTGG - Intergenic
1037834222 8:22206887-22206909 GTACCATCACCAGCCCCAACTGG + Exonic
1044940769 8:97340895-97340917 TCCCCACCACCACCCCCGACAGG - Intergenic
1046759637 8:118008065-118008087 TTCACCTCCCAACCCCCGACAGG + Intronic
1047925692 8:129680305-129680327 TCCCCATCACATTCCCCAAGGGG + Intergenic
1049576899 8:143393714-143393736 CTCCCACCCCAACCCCCACCAGG - Intergenic
1049887303 9:36274-36296 TCCCCAACACATCCCCCAACAGG + Intergenic
1049989528 9:977862-977884 TACCCATTCCAACCCCCAAATGG - Intronic
1050040556 9:1488632-1488654 TTCCCATCCCAACCTCCTTCAGG + Intergenic
1054823509 9:69547825-69547847 TTTCCAACACAACCACCACCTGG + Intronic
1058936925 9:109778433-109778455 TTTCCAGCACAAGCCCCAGCAGG - Intronic
1059717054 9:116923026-116923048 ATCTCATAACAAACCCCAACAGG + Intronic
1059789140 9:117620895-117620917 CTCCCATCACATGCCCCAAAAGG - Intergenic
1060111769 9:120911550-120911572 TTCCCATCCCATCCCCAAGCCGG - Intronic
1060289340 9:122286080-122286102 GTCCCATCTCTACCACCAACTGG + Intronic
1060329691 9:122655681-122655703 CCCCCACCCCAACCCCCAACAGG - Intergenic
1061266888 9:129511386-129511408 TTGCCCACACAACCACCAACTGG + Intergenic
1062046246 9:134425774-134425796 TCCCCATCACAAGCCCCATGGGG + Intronic
1062424198 9:136498506-136498528 TTCCCATCCCCACCCCCGCCTGG + Intronic
1062540258 9:137038916-137038938 CTCCCATCACACCCCTCACCTGG + Intergenic
1062697813 9:137884414-137884436 CTCCCACCCCAGCCCCCAACGGG - Intronic
1188707906 X:33357897-33357919 TTCTCATCACAACGCCCTAATGG - Intergenic
1190588836 X:51976197-51976219 ATCCCACCACAACCACCTACAGG + Intergenic
1191570655 X:62613006-62613028 TTCCCATCATAGCCCTCAAAGGG - Intergenic
1193209825 X:78793697-78793719 CCCCCACCACACCCCCCAACAGG - Intergenic
1194418597 X:93644578-93644600 CTCTCACCACAACCCCCAACAGG + Intergenic
1196106739 X:111904626-111904648 TCCCCACCCCAGCCCCCAACAGG - Intronic
1196324618 X:114388777-114388799 TTTCCCTCACACCCCCAAACAGG + Intergenic
1197112306 X:122790656-122790678 TTCCCCTCACTACCCTCAGCAGG + Intergenic
1198623703 X:138543963-138543985 TTCTCATCACAGCCCACCACGGG + Intergenic
1199264449 X:145814424-145814446 TTCTCATGACAATCCTCAACAGG - Intergenic
1199448306 X:147952526-147952548 TTCCCATCACCAGCCCCAGCAGG - Intergenic
1199567848 X:149234619-149234641 CTCCCCTCACCACCCCCCACAGG - Intergenic
1200926195 Y:8657105-8657127 TTCCCATTAAAGCCACCAACAGG + Intergenic
1200931924 Y:8704639-8704661 TTCCCATTACAGCCACCAAAAGG - Intergenic
1200938234 Y:8757041-8757063 TTCCCATCACTGCCACCAAAAGG - Intergenic
1202130392 Y:21603818-21603840 TTCCCATTACAGCCACCAACAGG - Intergenic
1202370288 Y:24191507-24191529 TTCCCACCACAAGCCCTCACTGG - Intergenic
1202500496 Y:25478610-25478632 TTCCCACCACAAGCCCTCACTGG + Intergenic