ID: 1176004155

View in Genome Browser
Species Human (GRCh38)
Location 20:62850682-62850704
Sequence TGGGGGCCTCGGCAGTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176004155_1176004160 -6 Left 1176004155 20:62850682-62850704 CCCAAAGACTGCCGAGGCCCCCA 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1176004160 20:62850699-62850721 CCCCCAACCCTCAGGACTAGCGG 0: 1
1: 0
2: 0
3: 12
4: 172
1176004155_1176004166 3 Left 1176004155 20:62850682-62850704 CCCAAAGACTGCCGAGGCCCCCA 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1176004166 20:62850708-62850730 CTCAGGACTAGCGGTCCACCAGG 0: 1
1: 0
2: 0
3: 3
4: 58
1176004155_1176004168 19 Left 1176004155 20:62850682-62850704 CCCAAAGACTGCCGAGGCCCCCA 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1176004168 20:62850724-62850746 CACCAGGCCCCAGCCTGCCCCGG 0: 1
1: 1
2: 9
3: 110
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176004155 Original CRISPR TGGGGGCCTCGGCAGTCTTT GGG (reversed) Intronic
900417599 1:2542304-2542326 TGGGGTCCTGGGCTGACTTTTGG + Intergenic
902133645 1:14285354-14285376 TGGAGGCTTTGGCAGTCTATTGG + Intergenic
904852276 1:33468073-33468095 TGGGGGCCTCGGCAGTCTCCAGG + Intergenic
910282576 1:85517742-85517764 TGGGGGCTTGGGCTGCCTTTGGG - Intronic
916127964 1:161588334-161588356 TCTGGGCCTGGGCAGTCTCTGGG + Intronic
916137882 1:161670164-161670186 TCTGGGCCTGGGCAGTCTCTGGG + Intronic
922920053 1:229294451-229294473 TGGGGACCTTGACAGGCTTTTGG + Intronic
1067448754 10:46368638-46368660 TGGAGACCTGGGCAGTCCTTTGG - Intergenic
1067635744 10:48000218-48000240 TGGAGACCTGGGCAGTCCTTTGG + Intergenic
1067877771 10:50020170-50020192 TGGAGACCTGGGCAGTCCTTTGG - Intergenic
1069121583 10:64575648-64575670 TGGGGGACTCTGCTGTGTTTAGG + Intergenic
1070132303 10:73664225-73664247 TGGAGACCTAGGCAGTCCTTTGG + Intergenic
1071609377 10:87019851-87019873 TGGAGACCTGGGCAGTCCTTTGG - Intergenic
1076846481 10:133071817-133071839 TGGGGGCCTCGGGAAGCTGTGGG + Intronic
1078565611 11:12411585-12411607 TGATGGCCTCGGCACTTTTTAGG + Intronic
1078829384 11:14964982-14965004 TGATGGCCACTGCAGTCTTTAGG + Intronic
1083713037 11:64560369-64560391 TGGGGCCCTCGGAGGACTTTGGG - Intronic
1088729437 11:112667937-112667959 TTTGGGCCTGGGCAGGCTTTTGG - Intergenic
1090182873 11:124716440-124716462 TGAGGATCTCGGCAGTTTTTTGG - Intergenic
1101479467 12:105083648-105083670 AGGGGGCCTCGGGACTGTTTAGG - Intronic
1101987179 12:109456547-109456569 TAGGGGCCAGGGCTGTCTTTTGG - Intronic
1107339228 13:39388390-39388412 TGGGGTCCTAGGCAATCATTGGG + Intronic
1109380170 13:61549425-61549447 TGTGGGCCTCAGCTGTGTTTGGG - Intergenic
1113848948 13:113407224-113407246 CGAGGGCCTTGGCTGTCTTTGGG + Intergenic
1121616194 14:95315330-95315352 TGGGGGCCTGGGCAGCTCTTTGG - Intronic
1126691353 15:51291160-51291182 TGGGGGCACTGGCAGTTTTTGGG + Intronic
1126856151 15:52841306-52841328 TGGGGTCCTGGTGAGTCTTTTGG + Intergenic
1129552352 15:76466747-76466769 TGGGGGCCTCTGAAAACTTTGGG + Intronic
1131314580 15:91323007-91323029 TGGTGGCCTCGACAGTTTTGAGG + Intergenic
1132809758 16:1791898-1791920 CGAGGGCCTCGGCAGCCTCTGGG - Exonic
1138754286 16:59464497-59464519 TGGGGGACTCGGCATTATGTGGG + Intergenic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1150000975 17:61439770-61439792 AGGGGGCCTCTTCAGACTTTTGG - Intergenic
1150108763 17:62479553-62479575 TGGAGGCCTCGGCAGCCTCCCGG + Intronic
1154109163 18:11551181-11551203 TGGGGTTCTCATCAGTCTTTTGG + Intergenic
1154349838 18:13573714-13573736 TGGGGGCAGTGACAGTCTTTTGG + Intronic
1160340789 18:78087132-78087154 TGGGGGCCTGGGCAGTGTGGCGG + Intergenic
1161950412 19:7464601-7464623 GGGGGGCCTCGCCAGTCTCGGGG - Exonic
1162031937 19:7921266-7921288 TAGGGGCCTTGGCAGTCACTGGG + Intronic
1162439935 19:10686653-10686675 AAGGGGCCTCGGGAGTCATTAGG + Intronic
1165810098 19:38606934-38606956 TGGGGGCCTGGGCTGACTGTTGG + Intronic
925179048 2:1804937-1804959 TGGGGGCAGGGGCAGTGTTTAGG - Intronic
927712790 2:25336173-25336195 TGGGGGCCTGGGCCGTCTGCAGG + Intronic
929174088 2:38959834-38959856 TGGGGGCATCAGATGTCTTTAGG - Exonic
930025119 2:47025042-47025064 TGGGGGCATCGGCAGGCATCAGG - Intronic
934947432 2:98551938-98551960 TGGGGGCCTGGCCAGTGTGTTGG - Intronic
936049805 2:109214147-109214169 TAGGGGCCTCAGCAGGCTGTTGG + Intronic
938795776 2:134717926-134717948 AGGGGGCATCGGCAGTCGGTGGG + Intronic
943854289 2:192768663-192768685 TGGGGGGGTTGGCAGTCTTGGGG - Intergenic
946353375 2:219169831-219169853 TTGGGGCCTCAGCTGTCTTCTGG - Exonic
948912165 2:241010183-241010205 TGGGGCCCTCGGAAGTCTCTTGG + Intronic
1171106175 20:22434877-22434899 TGGGTGCCTGGGCAGGCTCTCGG + Intergenic
1175852391 20:62100500-62100522 TGGAGGCCTCCTCAGTCTTAGGG + Intergenic
1176004155 20:62850682-62850704 TGGGGGCCTCGGCAGTCTTTGGG - Intronic
1179798080 21:43797357-43797379 TGGGGGGCACGGCTGTCTTGGGG + Intronic
1179821616 21:43940350-43940372 CGGGGGCCTGGGCAGTCCTGGGG + Intronic
1180144567 21:45912164-45912186 TGGGGGCATGGGCAGCCTTGGGG - Intronic
1181790676 22:25263300-25263322 TCTGGGCCTCAGCAGTCTGTGGG - Intergenic
1181826493 22:25520347-25520369 TCCGGGCCTCAGCAGTCTGTGGG - Intergenic
1183537901 22:38413695-38413717 TGTGGGCCCTGGCAGCCTTTGGG - Intergenic
1185324134 22:50217392-50217414 TGGGGGCCTCGGGAGACTCCAGG - Exonic
953548874 3:43885020-43885042 TGGGGACCTCAGCATTCTTTAGG + Intergenic
954445585 3:50545121-50545143 TGGGGACATTGGCAGTGTTTGGG - Intergenic
954844264 3:53541590-53541612 TGGGGGACTGACCAGTCTTTTGG + Intronic
962685213 3:137841121-137841143 TGGTGGTCTTGGCTGTCTTTAGG - Intergenic
963786181 3:149536636-149536658 GGGAGGCCTCGGAATTCTTTTGG - Intronic
976833047 4:89337053-89337075 AGGGGGCTTTGGCAGTCTGTGGG - Intergenic
978387172 4:108187690-108187712 TGGGGGGCTTGGCATTTTTTTGG + Intergenic
980894053 4:138844593-138844615 TTGGGGACTGGACAGTCTTTGGG + Intergenic
981878517 4:149578793-149578815 TGGGGGTCTCCCCAGTCTTTTGG - Intergenic
985544485 5:502289-502311 AGGGGGCCTGGGCCGTCTCTGGG - Intronic
986631218 5:9775753-9775775 TGGGGGCCTCAGGACTCTGTTGG + Intergenic
988974252 5:36499597-36499619 TGGGGGCCTTGGCAATTTTCAGG - Intergenic
989372890 5:40728379-40728401 TGGGAGTCTTGGCAGACTTTGGG - Exonic
1004515617 6:16320141-16320163 TGAGGGCCTCGGCTATTTTTAGG + Intronic
1004658050 6:17683918-17683940 TGGGGTCATGGGAAGTCTTTGGG + Intronic
1008896322 6:56560321-56560343 TGGGGGCCTCAGGAGTATCTGGG + Exonic
1013470451 6:110459494-110459516 TTGTGACCTTGGCAGTCTTTAGG - Intronic
1014176309 6:118335335-118335357 TGGGGGTCTGGGTATTCTTTTGG - Intergenic
1015165931 6:130200056-130200078 TCAAGGCCTCGGGAGTCTTTGGG + Intronic
1020003095 7:4766666-4766688 TGGGGGCTTCGGCAGTCTGGAGG - Exonic
1023396668 7:39758054-39758076 TGGGGGCCTAGGCTCTTTTTAGG - Intergenic
1026383539 7:69822919-69822941 TGGGGACCTCGGCAGTAAGTGGG - Intronic
1026792105 7:73340796-73340818 AGAGGGCCTTGGCATTCTTTTGG - Exonic
1029451179 7:100642479-100642501 TGGGGCCCTCGGAAGGGTTTGGG - Intronic
1032037777 7:128532063-128532085 TGGAGGCCTCGGCAGCCTCCCGG + Intergenic
1035064704 7:156096213-156096235 GGAGGGCCTCGGCTGTCTGTTGG - Intergenic
1037837516 8:22223009-22223031 TGAGGACCTTGGGAGTCTTTGGG - Intronic
1048163510 8:132041684-132041706 TGGGGGCCCAGGCAATCTGTGGG + Exonic
1048484034 8:134831638-134831660 TGGGGGCCGCGGGAAGCTTTCGG - Intergenic
1049309764 8:141927634-141927656 TGGGGGGCTCGGCTGCCTTATGG - Intergenic
1052861651 9:33441482-33441504 TGGGGGCTTCTACAGGCTTTTGG - Exonic
1057693895 9:97310271-97310293 TGTGGGCCTCGGGTGTCTCTTGG + Intronic
1060941629 9:127545996-127546018 TGGGGGCCTCGGCACCCCCTGGG - Intronic
1061092384 9:128433961-128433983 TGGGGCCCCCAGCAGGCTTTGGG + Intronic
1061870354 9:133517048-133517070 TGAGGGCCTTGGCAGTCTCGTGG + Intronic
1062129392 9:134884476-134884498 TGGAGGCCTCAGCAGTCTCTGGG + Intronic
1062266326 9:135688068-135688090 TGGGGGCATCGGGAGGGTTTGGG - Intergenic
1062549690 9:137080318-137080340 TGGGGGCATAGGGAGTCCTTGGG + Intronic
1186235653 X:7506289-7506311 TGGGGTCCTTGACAATCTTTAGG + Intergenic
1189349137 X:40263987-40264009 TTGGGGCTTTGGCAGTCTTGGGG - Intergenic
1190327819 X:49217629-49217651 TGAGGGCCTCTGCAGTTCTTGGG + Intronic