ID: 1176004206

View in Genome Browser
Species Human (GRCh38)
Location 20:62850874-62850896
Sequence CTCGGGGGCTGCTTTGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176004206_1176004216 14 Left 1176004206 20:62850874-62850896 CCCAATCCAAAGCAGCCCCCGAG No data
Right 1176004216 20:62850911-62850933 AGCAGCACCTTCCACCCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176004206 Original CRISPR CTCGGGGGCTGCTTTGGATT GGG (reversed) Intronic