ID: 1176005768

View in Genome Browser
Species Human (GRCh38)
Location 20:62861634-62861656
Sequence ACCGCGGGAGCCGCCGCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176005768_1176005783 17 Left 1176005768 20:62861634-62861656 CCTCCGGCGGCGGCTCCCGCGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176005783 20:62861674-62861696 GGCGCGGCGCGGCCCAACGGCGG 0: 1
1: 0
2: 3
3: 15
4: 116
1176005768_1176005782 14 Left 1176005768 20:62861634-62861656 CCTCCGGCGGCGGCTCCCGCGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176005782 20:62861671-62861693 GGCGGCGCGGCGCGGCCCAACGG 0: 1
1: 0
2: 2
3: 20
4: 191
1176005768_1176005775 -7 Left 1176005768 20:62861634-62861656 CCTCCGGCGGCGGCTCCCGCGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176005775 20:62861650-62861672 CCGCGGTCCGGGGCCCGACATGG 0: 1
1: 0
2: 0
3: 2
4: 57
1176005768_1176005780 6 Left 1176005768 20:62861634-62861656 CCTCCGGCGGCGGCTCCCGCGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176005780 20:62861663-62861685 CCCGACATGGCGGCGCGGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 70
1176005768_1176005785 23 Left 1176005768 20:62861634-62861656 CCTCCGGCGGCGGCTCCCGCGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176005785 20:62861680-62861702 GCGCGGCCCAACGGCGGCGAGGG 0: 1
1: 0
2: 1
3: 10
4: 70
1176005768_1176005776 -4 Left 1176005768 20:62861634-62861656 CCTCCGGCGGCGGCTCCCGCGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176005776 20:62861653-62861675 CGGTCCGGGGCCCGACATGGCGG 0: 1
1: 0
2: 0
3: 0
4: 81
1176005768_1176005784 22 Left 1176005768 20:62861634-62861656 CCTCCGGCGGCGGCTCCCGCGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176005784 20:62861679-62861701 GGCGCGGCCCAACGGCGGCGAGG 0: 1
1: 0
2: 3
3: 15
4: 115
1176005768_1176005778 1 Left 1176005768 20:62861634-62861656 CCTCCGGCGGCGGCTCCCGCGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176005778 20:62861658-62861680 CGGGGCCCGACATGGCGGCGCGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176005768 Original CRISPR ACCGCGGGAGCCGCCGCCGG AGG (reversed) Exonic
901641432 1:10694887-10694909 AGCGCGCGCGCGGCCGCCGGCGG - Intronic
902361750 1:15945790-15945812 GCCCCGGGAGCCGCCGCCTGTGG - Exonic
902951017 1:19882750-19882772 AGCGAGGGAGGCGGCGCCGGGGG + Intronic
904837749 1:33349918-33349940 CCCGCGGCCGCCTCCGCCGGGGG + Intronic
905410423 1:37764699-37764721 ACCGCGGGAGCCAGAGGCGGCGG - Intronic
906168967 1:43707771-43707793 AGCCCGGGACCCGCGGCCGGCGG - Intronic
906678341 1:47708984-47709006 GCCCCGGGAGCCGCAGCAGGCGG - Intergenic
906960919 1:50419098-50419120 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
911002519 1:93180647-93180669 ACTGCGTGAGGCGCCGCCGAAGG - Exonic
914428603 1:147600197-147600219 GCCGCCGCTGCCGCCGCCGGGGG + Intronic
915070371 1:153261236-153261258 ACAGCCAGAGCCCCCGCCGGAGG - Exonic
915070394 1:153261311-153261333 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
915070410 1:153261356-153261378 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
915070436 1:153261455-153261477 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG + Intronic
1065140461 10:22714415-22714437 CGCGCCGGGGCCGCCGCCGGGGG - Exonic
1067091317 10:43266961-43266983 AGCGCGGGGGCGGCCGCGGGTGG - Intergenic
1070257921 10:74826668-74826690 ACCGCTGCCGCCGCCGCCAGGGG - Exonic
1070835727 10:79445756-79445778 ACCCCCGGAGCCGCCGCTGGAGG - Intergenic
1071529418 10:86377445-86377467 GCCGCGCGAGCCGCCCCAGGAGG + Intergenic
1073503897 10:103967244-103967266 GCCGCGGGAGCGGACGGCGGCGG + Exonic
1077108065 11:850413-850435 ACCCCGCGACCCGCCGCGGGAGG - Intronic
1083227680 11:61295040-61295062 CCCGGGGGACCCGCCGCCGCCGG - Exonic
1084521535 11:69666199-69666221 CCCGCGGGAGCAGCGGCAGGTGG - Exonic
1086887837 11:92224977-92224999 GCCGCCGCCGCCGCCGCCGGGGG - Intergenic
1090068701 11:123525648-123525670 GCTGCGGGAGCTGCCGCCTGGGG + Exonic
1092462411 12:8698130-8698152 CCTGCGGGAGCCGCAGTCGGCGG + Exonic
1097929629 12:65169837-65169859 CCCGCGGCCGCCGCCGCCGCTGG - Exonic
1102197415 12:111034873-111034895 GCCGCCAGAGCCGCCGCCGCCGG + Intronic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1104835328 12:131786540-131786562 ACCGCGTGAGCCGCAGCCCTGGG + Exonic
1104954842 12:132459297-132459319 ACCGTGGAAGCAGCGGCCGGAGG + Intergenic
1106246388 13:27953896-27953918 GCAGCCGGAGCCGCCGCAGGAGG - Intergenic
1111951275 13:94711388-94711410 GCGGCGGCCGCCGCCGCCGGGGG - Exonic
1113494453 13:110715733-110715755 ACCCCGAGAGCCGCCGCCTATGG - Exonic
1113852598 13:113426335-113426357 ACCGCGGGAGCCACAGAGGGTGG + Intronic
1114037928 14:18646560-18646582 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1114120693 14:19668471-19668493 ACCGCTGCGGCCGCCGCCGCTGG - Intergenic
1116658170 14:47675795-47675817 AACGCGGGAGCGGCCGCCTGCGG + Intergenic
1118607699 14:67515404-67515426 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
1119569931 14:75661274-75661296 ACCGGGGAAGCAGCCGTCGGCGG + Exonic
1120168014 14:81220853-81220875 ACGGCTGGAGCTGCAGCCGGTGG - Exonic
1120521168 14:85529988-85530010 CCCCCGGGAGCCGCTGCCTGCGG + Intergenic
1121042217 14:90758579-90758601 CCCTCGGCAGCCGCCGCCAGGGG - Intronic
1123004409 14:105314538-105314560 GCCCCGTGAGGCGCCGCCGGAGG + Exonic
1130261138 15:82355269-82355291 GCCGCTGCTGCCGCCGCCGGGGG + Intergenic
1130280097 15:82513749-82513771 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130471472 15:84229935-84229957 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130478966 15:84344506-84344528 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130492804 15:84443625-84443647 GCCGCTGCTGCCGCCGCCGGGGG + Intergenic
1130593766 15:85234562-85234584 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130664558 15:85858895-85858917 ACCCCGGGCGCCGCCGACCGTGG - Intergenic
1131215051 15:90529764-90529786 GGCTCGGGACCCGCCGCCGGCGG - Intergenic
1132599039 16:765759-765781 CCCGCCGGAACCGCGGCCGGAGG - Exonic
1134441666 16:14302516-14302538 ACCGCCGCTGCCGCCTCCGGGGG - Intergenic
1135597353 16:23754727-23754749 ACCGTGGGAACCGGCCCCGGGGG + Exonic
1136778846 16:32885146-32885168 ACCCCCGGAGCCGCCGCGGAGGG - Intergenic
1136891772 16:33976372-33976394 ACCCCCGGAGCCGCCGCGGAGGG + Intergenic
1138016660 16:53434599-53434621 TCCGAGGCTGCCGCCGCCGGAGG - Exonic
1138179793 16:54933382-54933404 ACCGCAGGAGGCGGCGGCGGAGG - Exonic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1142812161 17:2400487-2400509 CCCGCGAGAGCCGCCGCCTGGGG - Intronic
1143548499 17:7614555-7614577 GCTGCTGCAGCCGCCGCCGGGGG - Exonic
1146052883 17:29567048-29567070 CCCTGGGCAGCCGCCGCCGGCGG - Exonic
1147564491 17:41528047-41528069 GCCGCCGTAGCCGCCGCCGTAGG + Exonic
1147686191 17:42288241-42288263 TCCCTGGGAGCCGCCGCCGAGGG + Exonic
1147967141 17:44199544-44199566 GCCGCCGTCGCCGCCGCCGGAGG - Intronic
1148262220 17:46193489-46193511 GCCGCCGCAGCCGCAGCCGGCGG - Intronic
1148388532 17:47253806-47253828 ACAGTGGGCGCCGCCGCCCGCGG - Intergenic
1148698626 17:49575654-49575676 GCCGCCGCCGCCGCCGCCGGTGG + Intergenic
1148929964 17:51120308-51120330 GCCGCGGGATCCGTCTCCGGGGG - Intronic
1152758921 17:82098354-82098376 ACCCGGCGCGCCGCCGCCGGTGG + Intergenic
1153997429 18:10454517-10454539 CCCCGGGCAGCCGCCGCCGGGGG - Intergenic
1155053261 18:22165800-22165822 CCGGCGGGAGCCGGCGCTGGGGG + Intergenic
1156275798 18:35581722-35581744 GCCGGGGGAGCCGCCGGCAGTGG + Intronic
1160202011 18:76803846-76803868 ACCACGGGAGACGCAGACGGAGG + Intronic
1160715008 19:572579-572601 ACCGCTGCCGCCGCCGCCCGCGG - Exonic
1162031140 19:7917742-7917764 GCCGCGGGGGCCGGCGCGGGAGG - Exonic
1162410681 19:10503256-10503278 CCCGCGGGCGCCTCCGCCGTCGG + Exonic
1162773614 19:12965506-12965528 GTCCCGGGAGCCGCCGCCAGAGG + Intronic
1163606978 19:18280982-18281004 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
1163607153 19:18281605-18281627 GGCGCAGGAGCCGCCGCCAGTGG - Exonic
1166361254 19:42253869-42253891 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1166984145 19:46649580-46649602 TGCGCAGGCGCCGCCGCCGGGGG - Exonic
1167018898 19:46860325-46860347 GCCGCGCGAGCCGCAGCCGCCGG - Intergenic
1167466286 19:49652419-49652441 ACCGCGACAGCCGCCGCCGGGGG + Exonic
1168257220 19:55173593-55173615 GCCGTGGGGGCGGCCGCCGGCGG - Exonic
1168689717 19:58369132-58369154 GCCCCGGGAGCCCCCGCCTGGGG + Exonic
925725381 2:6865987-6866009 GCCCCGGGAGCCGGCGCCTGGGG - Intronic
927667569 2:25042749-25042771 AAGGCGGGAGGCGGCGCCGGCGG + Intronic
928606357 2:32947621-32947643 ACCGCCGCCGCCGCCGCCGCCGG + Exonic
928964836 2:36966366-36966388 GCCGCGGCAGCCTCCGCCAGAGG + Exonic
936713607 2:115161418-115161440 ACCGCGGAAGCCGGCGGCCGTGG + Intronic
941816286 2:169799110-169799132 GCCGCGTGGGCCGCAGCCGGAGG + Intronic
942241114 2:173964681-173964703 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
942278093 2:174336941-174336963 GCCGCGGCTGCCGCCGCCGGGGG + Exonic
944743685 2:202635414-202635436 ACCGCCGCCGCCGCCGCCTGCGG - Exonic
1169044529 20:2525051-2525073 ACTGCGGGATCCGCCTCTGGAGG - Intergenic
1170756918 20:19212880-19212902 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1174258794 20:49278261-49278283 CCCGCCGGCTCCGCCGCCGGGGG - Intronic
1175911405 20:62407015-62407037 ACCGCCAGCGCCGCCGCCGCCGG - Exonic
1176005768 20:62861634-62861656 ACCGCGGGAGCCGCCGCCGGAGG - Exonic
1176071601 20:63229532-63229554 GCAGCGGCAGCCGCTGCCGGGGG - Intergenic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1178707880 21:34889704-34889726 ACCGCGGGGACCGGCGCAGGGGG - Intronic
1180193409 21:46180114-46180136 ACCGTGGACGCCGCCGCCGTGGG - Intronic
1180462055 22:15573602-15573624 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1183524975 22:38317408-38317430 AGCGCGCGAGCCGGCGGCGGGGG - Exonic
1184412115 22:44331544-44331566 CCCGCGGGAGCCGCCTGCTGGGG + Intergenic
1184749873 22:46479174-46479196 ACCCCGGGAGCGTCCGTCGGCGG - Intronic
1185248677 22:49787638-49787660 ACCGCGGAGGCCGCCGCCGCCGG + Intronic
1185333520 22:50261807-50261829 CCCGAGGCGGCCGCCGCCGGGGG + Exonic
1185336176 22:50271780-50271802 ACCGCGGCCGCGGCCGCCGGGGG + Intergenic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
950701343 3:14751373-14751395 ACAGCGGGTGCAGCCCCCGGAGG + Intronic
953899910 3:46834069-46834091 GCCCCGGGAGCCGCCGCCAGAGG + Exonic
954152417 3:48664044-48664066 ATCGCGGGAGCCGCACCCTGTGG - Intergenic
954274245 3:49532128-49532150 ACTGCGGGAGCAGCAGCTGGTGG + Exonic
962520740 3:136195842-136195864 AGTGCGCGGGCCGCCGCCGGCGG + Exonic
968571809 4:1346286-1346308 AGGGCGGGGGCCGCCGGCGGCGG - Intergenic
968593681 4:1471940-1471962 ACTGCGGGAAGCGCGGCCGGCGG + Intergenic
969619019 4:8269728-8269750 GGCGCGGGACCCGCCGCCCGCGG + Intergenic
972817180 4:42657142-42657164 AGCTCGGGCGCCGGCGCCGGGGG + Intergenic
973551247 4:52038140-52038162 CCCGCGGGAGCCCTGGCCGGGGG - Intronic
975616395 4:76251755-76251777 CCGGCCGGAGCCGCCGCCTGCGG - Exonic
976595579 4:86892250-86892272 TCCCCGCGAGCCGGCGCCGGCGG + Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
992269824 5:75053161-75053183 CCCGCGGCAGCCGCCGCCTGCGG - Intergenic
992939697 5:81750606-81750628 ACCTGGGGAGCCGCCGGGGGTGG - Intronic
992950368 5:81852014-81852036 AGCGCGGCAGCCGCGGCGGGAGG - Intergenic
993900507 5:93581272-93581294 GCCGCCGCTGCCGCCGCCGGGGG - Intergenic
995764597 5:115602058-115602080 AGGGCGGGGGCCGCCGCCGGGGG - Intronic
1002046443 5:176543962-176543984 GCCGCGGGTCCCGGCGCCGGAGG + Intronic
1003624094 6:7727055-7727077 GCCGCGGCCGCCGCCGCCGGGGG + Exonic
1005838203 6:29723599-29723621 ACTCAGGGAGCCGCCTCCGGAGG + Intronic
1007784201 6:44270777-44270799 ACCGCCGCCGCCGCCGCCGGCGG - Exonic
1016010748 6:139135499-139135521 GCGGCGGGAGCGGCGGCCGGGGG + Exonic
1018774001 6:166998149-166998171 GCAGCGGGAGCCGCGGCCGTAGG - Intergenic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1021845333 7:24757547-24757569 GCCGCGGGACTGGCCGCCGGAGG + Intronic
1022629362 7:32070850-32070872 AAAGCGGGAGCCGGCGCGGGCGG + Intronic
1023073414 7:36459853-36459875 ACCACTGGAGCCGCAGCTGGAGG + Intergenic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1026764989 7:73154836-73154858 ACCGGGGGAGCCCCCCCAGGCGG + Intergenic
1027082179 7:75237776-75237798 ACCGGGGGAGCCCCCCCAGGCGG - Intergenic
1028621486 7:92833566-92833588 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1029495370 7:100893511-100893533 AGCGCGGGAGCCGCCTCGGTGGG - Exonic
1029640537 7:101816753-101816775 GCCGCCGCCGCCGCCGCCGGTGG - Intronic
1031531922 7:122886386-122886408 CCCGCGGGCGCAGCCGCCGGGGG - Intronic
1032086818 7:128888815-128888837 ACCCCGGGAGCCCCAGCAGGGGG + Intronic
1037879536 8:22566081-22566103 ACCGGGGTCGCGGCCGCCGGGGG + Intronic
1037928778 8:22865325-22865347 GCAGCGGGAGACGCCGCAGGGGG - Intronic
1040545745 8:48396862-48396884 ACCGCGGGAACCACGGCGGGGGG - Intergenic
1042246375 8:66712699-66712721 TCCGCGGGAGGAGCCGCCAGCGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1045516298 8:102863629-102863651 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1045653881 8:104367400-104367422 AGGCCGGGAGCCGCCTCCGGGGG + Intronic
1048553984 8:135457632-135457654 AGCGCGGGGGCCGCCGGCGCTGG + Exonic
1049777560 8:144413642-144413664 ACCGCGGGAGGCGGAGCCGCAGG + Intronic
1052964440 9:34329201-34329223 AACCCGGGAGCCACCGGCGGCGG + Intergenic
1058467565 9:105244660-105244682 GCCGCCGTCGCCGCCGCCGGGGG + Exonic
1059633955 9:116154394-116154416 CCCGCTGCTGCCGCCGCCGGGGG - Exonic
1060389890 9:123268525-123268547 GCCGCCGCAGCCGCCGCCGCTGG - Intronic
1060825100 9:126683278-126683300 GCGGCGGGAGCCGCGGGCGGGGG - Intronic
1061862947 9:133477210-133477232 ACCCTGGGAGCAGCGGCCGGAGG - Exonic
1062314800 9:135961345-135961367 GCCGCCGCAGCAGCCGCCGGGGG + Exonic
1062462591 9:136668123-136668145 TCCGCTGGAGCCTCCACCGGTGG - Intronic
1062567531 9:137169954-137169976 ACCGCGGGTGCCGGGGGCGGGGG - Exonic
1187064822 X:15823133-15823155 GCCGCAGGAGCCGCCGCAGCCGG + Exonic
1189002875 X:36963969-36963991 GCCGCGGGAGCCGCGGGCGGGGG - Intergenic
1198276332 X:135098371-135098393 TCCGCGGCCGCCGCCGCCGCCGG + Intergenic
1200100952 X:153688894-153688916 ACCCCCGGAGCCGCCGCGGAGGG + Intronic