ID: 1176006993

View in Genome Browser
Species Human (GRCh38)
Location 20:62870864-62870886
Sequence TACAGGAGGATGAGAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176006993_1176007000 -6 Left 1176006993 20:62870864-62870886 CCCCTTCCTCTCATCCTCCTGTA No data
Right 1176007000 20:62870881-62870903 CCTGTAGCTTCTTGGACTCCTGG No data
1176006993_1176007001 -5 Left 1176006993 20:62870864-62870886 CCCCTTCCTCTCATCCTCCTGTA No data
Right 1176007001 20:62870882-62870904 CTGTAGCTTCTTGGACTCCTGGG No data
1176006993_1176007004 24 Left 1176006993 20:62870864-62870886 CCCCTTCCTCTCATCCTCCTGTA No data
Right 1176007004 20:62870911-62870933 GATTTTTCTGTTCCGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176006993 Original CRISPR TACAGGAGGATGAGAGGAAG GGG (reversed) Intergenic
No off target data available for this crispr