ID: 1176008203

View in Genome Browser
Species Human (GRCh38)
Location 20:62877489-62877511
Sequence CCATCGTCTCCAGAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176008192_1176008203 25 Left 1176008192 20:62877441-62877463 CCAGGAGAGGGTCTGAAGGGGGT No data
Right 1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG No data
1176008194_1176008203 -3 Left 1176008194 20:62877469-62877491 CCTCCTCCCGACCTTCCTGCCCA No data
Right 1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG No data
1176008190_1176008203 26 Left 1176008190 20:62877440-62877462 CCCAGGAGAGGGTCTGAAGGGGG No data
Right 1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG No data
1176008193_1176008203 -2 Left 1176008193 20:62877468-62877490 CCCTCCTCCCGACCTTCCTGCCC No data
Right 1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG No data
1176008195_1176008203 -6 Left 1176008195 20:62877472-62877494 CCTCCCGACCTTCCTGCCCATCG No data
Right 1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG No data
1176008197_1176008203 -10 Left 1176008197 20:62877476-62877498 CCGACCTTCCTGCCCATCGTCTC No data
Right 1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG No data
1176008196_1176008203 -9 Left 1176008196 20:62877475-62877497 CCCGACCTTCCTGCCCATCGTCT No data
Right 1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG No data
1176008188_1176008203 27 Left 1176008188 20:62877439-62877461 CCCCAGGAGAGGGTCTGAAGGGG No data
Right 1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176008203 Original CRISPR CCATCGTCTCCAGAGCTGGA TGG Intergenic
No off target data available for this crispr