ID: 1176008615

View in Genome Browser
Species Human (GRCh38)
Location 20:62880194-62880216
Sequence GGTCAGAGAGGACCACCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176008615_1176008621 -3 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008621 20:62880214-62880236 ACCTCCAAACTGAGAGGGAGGGG 0: 1
1: 0
2: 4
3: 9
4: 214
1176008615_1176008624 -1 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008624 20:62880216-62880238 CTCCAAACTGAGAGGGAGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 325
1176008615_1176008618 -8 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008618 20:62880209-62880231 CTCTGACCTCCAAACTGAGAGGG 0: 1
1: 0
2: 2
3: 18
4: 205
1176008615_1176008623 -2 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008623 20:62880215-62880237 CCTCCAAACTGAGAGGGAGGGGG 0: 1
1: 0
2: 3
3: 18
4: 267
1176008615_1176008626 8 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008626 20:62880225-62880247 GAGAGGGAGGGGGGCCGCCTCGG 0: 1
1: 0
2: 2
3: 27
4: 494
1176008615_1176008617 -9 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008617 20:62880208-62880230 TCTCTGACCTCCAAACTGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 197
1176008615_1176008628 10 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008628 20:62880227-62880249 GAGGGAGGGGGGCCGCCTCGGGG 0: 1
1: 0
2: 1
3: 27
4: 318
1176008615_1176008620 -4 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008620 20:62880213-62880235 GACCTCCAAACTGAGAGGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 167
1176008615_1176008627 9 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008627 20:62880226-62880248 AGAGGGAGGGGGGCCGCCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 292
1176008615_1176008629 11 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008629 20:62880228-62880250 AGGGAGGGGGGCCGCCTCGGGGG 0: 1
1: 0
2: 0
3: 24
4: 284
1176008615_1176008619 -5 Left 1176008615 20:62880194-62880216 CCAGGGGGTGGTCCTCTCTGACC 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1176008619 20:62880212-62880234 TGACCTCCAAACTGAGAGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176008615 Original CRISPR GGTCAGAGAGGACCACCCCC TGG (reversed) Exonic
900108539 1:996390-996412 GGGCAGAAAGGACCCCCCGCTGG + Intergenic
900108564 1:996456-996478 GGACAGAAAGGACCCCCCGCTGG + Intergenic
900108590 1:996522-996544 GGGCAGAAAGGACCCCCCGCTGG + Intergenic
900108613 1:996588-996610 GGACAGAAAGGACCCCCCGCTGG + Intergenic
900108640 1:996654-996676 GGGCAGAAAGGACCCCCCGCGGG + Intergenic
900108689 1:996785-996807 GGGCAGAAAGGACCCCCCGCGGG + Intergenic
900114557 1:1022978-1023000 GGTCAGGGAGGGCCACTCCTCGG - Intronic
901329100 1:8390840-8390862 CGTCAGGGAGGACCCCCCGCTGG - Intronic
901690738 1:10971582-10971604 GGTCAGTGAGGACCTCCCAGAGG - Intronic
902270546 1:15301329-15301351 TGTCAGAGACCACCACCTCCAGG + Exonic
902329541 1:15724589-15724611 GGTCCGAGAGGCCGCCCCCCAGG - Intronic
902336979 1:15759330-15759352 GCCCAGAGAGGAGCAGCCCCGGG - Intronic
902530939 1:17090317-17090339 CGTCAGAGATGAGCACCCCAAGG + Intronic
902796921 1:18806152-18806174 GGTCGGAGAAGGCCACCCACAGG - Intergenic
904404370 1:30276264-30276286 TGTCAGTGAGGACCCCTCCCAGG + Intergenic
905318204 1:37097019-37097041 GGGCATAGAGGACACCCCCCAGG + Intergenic
905437156 1:37964719-37964741 GCACATAGAGGACCACCGCCAGG - Intronic
905437353 1:37966321-37966343 GCACATAGAGGACCACCGCCAGG - Intronic
905772204 1:40645695-40645717 AGCAAGAGAGTACCACCCCCAGG + Intronic
907469979 1:54667210-54667232 GGTCAGAGAAGACCACTCAGAGG - Intronic
908734548 1:67262445-67262467 GGTCAGGAAAGACCACTCCCAGG + Intergenic
909840491 1:80315509-80315531 GGTCAGAAAAGACCTCTCCCAGG - Intergenic
910065960 1:83151168-83151190 AGGCAGAGAGGAACAACCCCGGG - Intergenic
914223392 1:145700374-145700396 GGCCAGAGAGTTCCACCGCCTGG + Intronic
915501433 1:156321460-156321482 GGTCAAAGATGACCACCAACTGG + Intronic
917232999 1:172857971-172857993 GGTGAGAGAGGACCAGAGCCAGG - Intergenic
917739882 1:177952012-177952034 AGTCAGCGAGGACCAAGCCCAGG + Intronic
919596678 1:199572566-199572588 AGTCAGAGAGGACAAGCCACAGG + Intergenic
921367907 1:214392031-214392053 GGTCAGAGAGTATCGCCCTCTGG + Intronic
1065134302 10:22653106-22653128 TATGAGAAAGGACCACCCCCGGG + Intronic
1067210835 10:44259428-44259450 CTACAGAGAGGACCTCCCCCTGG - Intergenic
1067854946 10:49784016-49784038 GGTCAGGGAAGGCCTCCCCCAGG + Intergenic
1068243987 10:54341135-54341157 GGCAGGAGAGGACCACCCCCAGG - Intronic
1069739363 10:70677702-70677724 AGTCAGGGAGTACCACTCCCAGG - Intronic
1071731055 10:88248999-88249021 GATCAGAGGGGACCAGGCCCAGG - Intergenic
1074137829 10:110643735-110643757 GGTCTCAGATGACCATCCCCGGG - Intergenic
1074491851 10:113945632-113945654 GGTCAGAGGGGAGCAGGCCCTGG - Intergenic
1074787792 10:116856635-116856657 GGTCAGAGGGTGCCATCCCCTGG - Exonic
1075306701 10:121374417-121374439 GGACAGAGAAGACCAAACCCTGG + Intergenic
1075949480 10:126464428-126464450 GCTGAGAGAAGACCACACCCAGG - Intronic
1076634745 10:131875075-131875097 GGTCCGAGAGCACCACCCCGCGG + Intergenic
1077324227 11:1956805-1956827 GGCCAGAGAGGGCCACACACAGG + Intronic
1080559462 11:33449661-33449683 GGTCAGAGAGGACCATCAGGAGG - Intergenic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1082822318 11:57552438-57552460 GGTCAGCGAGGTCCATCCGCAGG + Exonic
1083284698 11:61650967-61650989 GGCCAGAGGGGACCTCCCCCAGG + Intergenic
1083304038 11:61753602-61753624 GGTCAGAGAGGCACAGCTCCAGG - Intronic
1083882027 11:65553554-65553576 GGTCACAGAGCACCCCGCCCCGG + Intronic
1084771400 11:71344867-71344889 GGTCAGAAAGGCCGAACCCCAGG + Intergenic
1086937796 11:92763714-92763736 GGTCAGCCAGGACCACATCCTGG + Intronic
1202807213 11_KI270721v1_random:12000-12022 GGCCAGAGAGGGCCACACACAGG + Intergenic
1094205122 12:27831663-27831685 GGTCAGAGAGCATCCCTCCCAGG - Intergenic
1096868325 12:54578178-54578200 GGTCAGAGATGCCAGCCCCCTGG + Exonic
1097448145 12:59700741-59700763 GGTCAGAGAGGAACACACAGAGG + Intronic
1100260736 12:92929619-92929641 GGTCAGGGAGGGACACCCCCAGG - Intergenic
1101085914 12:101236020-101236042 GGTCTGTGAGGACCACTTCCTGG - Intergenic
1101962377 12:109259656-109259678 GGTCAGGGAGGGGCAGCCCCAGG + Intronic
1102347149 12:112167566-112167588 GGGCACAGAGGCCCACGCCCAGG - Intronic
1102758420 12:115364110-115364132 GGAGAGAGAGGAGCACCTCCAGG - Exonic
1106200173 13:27529388-27529410 AGTCATATAGGACAACCCCCAGG + Intergenic
1106411976 13:29516968-29516990 GCACAGAGAGGACCAGACCCTGG - Intronic
1107890737 13:44912011-44912033 GTGGAGAGAGGTCCACCCCCTGG - Intergenic
1111889020 13:94058631-94058653 GGGCAGAGAGGAACTGCCCCAGG - Intronic
1113057642 13:106287057-106287079 GGTCAGAGAGCCCCTCCTCCAGG + Intergenic
1113145181 13:107200214-107200236 GGTCAGGGAGGACCTCCTCCTGG + Intronic
1113806966 13:113115597-113115619 GGTCAGCGAGAGCCAGCCCCCGG - Intronic
1113807571 13:113118534-113118556 GGTCAGTGAGGACCACGGGCTGG - Exonic
1125522485 15:40356109-40356131 GGTCACTGCGGGCCACCCCCTGG + Exonic
1125859638 15:42986852-42986874 GGCCAGAGGGCACCAACCCCAGG + Intronic
1132798757 16:1741203-1741225 GTTCAGAGACCACCACCCCCAGG - Intronic
1134482193 16:14629836-14629858 GGTCAGGGGGGACAAGCCCCGGG + Intronic
1134859068 16:17544962-17544984 GGTCAAAGAGGAACTCCACCAGG + Intergenic
1136017240 16:27408544-27408566 GGTCAGAGAGGAGGACCAGCAGG + Intronic
1137072317 16:35914320-35914342 GTTCAGAGAGTACGACCCTCAGG - Intergenic
1137420620 16:48330449-48330471 TGTCAGAAAGGACCAGCACCAGG - Intronic
1137563679 16:49519990-49520012 GGTCAGGGAGGGCCTCCCCGAGG - Intronic
1138352823 16:56355414-56355436 GGGCTGAGAGGAACACCCCGGGG - Intronic
1139657367 16:68397200-68397222 GGTAAGGGAGGAACACCCCAGGG + Intronic
1141078694 16:81032111-81032133 GGGCAGAGAGGAACTCCCTCTGG + Intronic
1141180010 16:81746131-81746153 AGTCAGACAGGACCAGCCCATGG + Intronic
1141504428 16:84465298-84465320 GGTCAGAGTGGACCCCTGCCAGG + Intergenic
1142171438 16:88624721-88624743 GGCCAGCCAGGACCCCCCCCAGG + Exonic
1142552117 17:747268-747290 GCTGACAGAGGACGACCCCCAGG - Exonic
1144680018 17:17187040-17187062 GGCCAGTGGGGTCCACCCCCAGG - Exonic
1144782411 17:17814710-17814732 TGTCAGAGAGGCCCACCACTTGG + Exonic
1144789022 17:17847346-17847368 GGGCAGAGTGGCCCAGCCCCAGG - Exonic
1145091665 17:19991435-19991457 GGACAGAGACCACGACCCCCAGG + Intergenic
1148103670 17:45108016-45108038 GCTCAGAGAGCACCATCCCGGGG + Exonic
1152711014 17:81870686-81870708 GGTCAGGGAGCAGCACACCCGGG + Intronic
1157014819 18:43699524-43699546 GGTCAGAGAGGAGTTCCACCAGG - Intergenic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1160871046 19:1278205-1278227 GGTCAGGGAGGGCCTCTCCCTGG + Intronic
1161326994 19:3668788-3668810 GCTCAGACAGGACCAGCCCAGGG - Intronic
1162028938 19:7909183-7909205 GGTCAGGGAGGGCCCCCCTCGGG - Intronic
1162726006 19:12690006-12690028 AGGCAGCGAGGACCACACCCTGG - Exonic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1163609080 19:18291939-18291961 GGGGAGAGAGGACCCCACCCCGG + Intergenic
1163677282 19:18661393-18661415 GGACAGAGAGGACCTCCCTCTGG - Intronic
1164051397 19:21587720-21587742 GGTCAGGGAGCACCCTCCCCTGG + Intergenic
1164552699 19:29224817-29224839 GGTCAGAAAGCAGCAGCCCCTGG + Intergenic
1165067581 19:33237961-33237983 GGATAGGGAGGACCACCCCAGGG - Intergenic
1165104316 19:33460063-33460085 GTTCAAAGAGGCACACCCCCGGG + Intronic
1167663777 19:50811711-50811733 AGTCAGTGAGGACCATCCCAGGG + Intergenic
1167670078 19:50846855-50846877 GGTCAGAGAGGCCCTCCCCCAGG - Intergenic
1168557963 19:57359231-57359253 GGTCAGAGAAGACCCATCCCTGG - Exonic
925875564 2:8308601-8308623 GGTCAGGGAAGACCCCGCCCAGG - Intergenic
926331892 2:11832482-11832504 GATCAGAAAGCACCACCCCTTGG + Intergenic
927961356 2:27242349-27242371 GGTCGGAGAGCACCCCACCCAGG + Exonic
932569999 2:72933637-72933659 GGTCAGAGGGGACCCCGGCCTGG + Intronic
934047490 2:88184952-88184974 GCTCACAGAGCACCTCCCCCAGG - Intronic
937516397 2:122660822-122660844 GGACAGAGAGGACCGCAGCCTGG - Intergenic
946167434 2:217873554-217873576 GGTGAGAGAGAGCCAGCCCCTGG + Intronic
949071311 2:242026378-242026400 GGACACAGAGGACCTCCACCAGG + Intergenic
1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG + Intergenic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1176008615 20:62880194-62880216 GGTCAGAGAGGACCACCCCCTGG - Exonic
1178609360 21:34067418-34067440 GGCCAGGGAGGCCCAGCCCCTGG + Intergenic
1183109346 22:35637621-35637643 GCTCTGACAGGGCCACCCCCAGG - Intronic
1184095818 22:42315706-42315728 GGTCAGAGAGGACTACCCAGAGG + Intronic
1184411216 22:44327580-44327602 GGTCACTGAGACCCACCCCCGGG - Intergenic
1184636536 22:45836596-45836618 GGTCAATGAGGACTCCCCCCTGG + Intronic
1184857935 22:47156669-47156691 GGGTAGAGAGGGACACCCCCAGG - Intronic
950336103 3:12194735-12194757 GCTCAGAGAAGACCGCACCCTGG + Intergenic
950431317 3:12952747-12952769 GCTCAGAGCGGACTTCCCCCAGG + Intronic
951810154 3:26689678-26689700 GGGTAGAGTGGCCCACCCCCAGG + Intronic
953979551 3:47406829-47406851 AGACAGAGAAGGCCACCCCCTGG - Intronic
954517383 3:51190813-51190835 GGTCAGGTAGGTCCACACCCTGG + Intronic
954618516 3:51982995-51983017 CGTCAGGGAGGACCTCCCCGAGG + Intronic
960993170 3:123324821-123324843 GGGCAAAGGGGACCACCACCTGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
967956494 3:194881369-194881391 GGGCAGGGAGGCCCACCTCCAGG + Intergenic
969712098 4:8850313-8850335 GGGCAGAGCTGACCACCCCAAGG - Intronic
972072425 4:35038414-35038436 GGGCAGAGTGGATCACTCCCCGG - Intergenic
973815686 4:54617016-54617038 GGTGAGTGAAGACCAACCCCTGG + Intergenic
975512069 4:75205194-75205216 GGTCAGAGATCACCTCCCCAAGG + Intergenic
976596359 4:86898741-86898763 GATCATAGAGCACCACCTCCTGG - Intronic
978838250 4:113179041-113179063 AGTCAAAGAGCACCACCACCAGG + Intronic
981574876 4:146193986-146194008 GGGCAGAAAGGATCACTCCCTGG + Intronic
985999168 5:3616634-3616656 GGTCAATGAGGACCACCTGCTGG - Intergenic
986285869 5:6358573-6358595 GGTCAGAGGGGACCAGTCTCTGG + Intergenic
990295674 5:54399106-54399128 GGTCACGGAGGTCCACCTCCTGG + Intergenic
990463142 5:56047906-56047928 GGTCAGAGAGGAGCTCCTCTGGG + Intergenic
990464671 5:56060825-56060847 AGGCAGAGAGGACCACCTGCAGG + Intergenic
992259394 5:74954495-74954517 GATCAGAGAGAACCAGGCCCTGG + Intergenic
997878643 5:137570871-137570893 GGTCAGAAAAGACCACCTGCAGG + Intronic
997879835 5:137579719-137579741 GGTCAGAGAAGGCCTCCCCAGGG + Intronic
1002044328 5:176533501-176533523 CGACGGAGAGGACCAGCCCCAGG + Intronic
1003059020 6:2848094-2848116 GGTGAGACAGGACCACACACAGG - Intergenic
1003925923 6:10877374-10877396 GGTCAAAGAGGGCCAGCTCCTGG + Exonic
1004721390 6:18270531-18270553 GGTCAGGGAGGACCCCCTCAAGG + Intergenic
1008640435 6:53456886-53456908 GGTCAGAAAGGACCAGACACAGG - Intergenic
1010175011 6:73017914-73017936 AGTAAAAGAGGACCACCCCTAGG + Intronic
1011258163 6:85445287-85445309 GGACAGAGAGGATCTGCCCCAGG + Intergenic
1015450372 6:133360713-133360735 GGTTAGAGAGGAACACGACCAGG - Intronic
1016269238 6:142269361-142269383 GGTCAGAAATGACCATCCCTAGG + Intergenic
1018057944 6:160068625-160068647 GGTGAGAGAGGACCTCCTCATGG + Intronic
1019015830 6:168878851-168878873 GGTCAGAAAGGCCCCCCCCCAGG + Intergenic
1019557924 7:1641796-1641818 GCTCAGGCAGGACCATCCCCTGG - Intergenic
1020271651 7:6600187-6600209 GGTCGAAGAGGATCAGCCCCAGG - Exonic
1023054162 7:36278452-36278474 GATCAGAGAGGCCCAGCCCTGGG - Intronic
1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG + Intergenic
1027278147 7:76583605-76583627 AGGCAGAGAGGAACAACCCCGGG + Intergenic
1033599489 7:142878382-142878404 GGTCAAACAGGACCACTCCAGGG - Intronic
1034398978 7:150848881-150848903 TGTCACAGAGGACCACACACAGG - Intronic
1034885522 7:154795517-154795539 GGGCAGTGATGACCGCCCCCTGG + Intronic
1035391433 7:158507299-158507321 GGTCAGTGAGGACCATCCAGGGG + Intronic
1035391446 7:158507358-158507380 GGTCAGTGAGGACCATCCAGGGG + Intronic
1035391458 7:158507417-158507439 GGTCAGTGAGGACCATCCAGGGG + Intronic
1035391589 7:158508118-158508140 GGTCAGTGAGGACCATCCAAGGG + Intronic
1037769727 8:21791238-21791260 GCTCAGTGAGAACCATCCCCAGG - Intronic
1038824671 8:30987949-30987971 GATCAGAGAGGCACACTCCCAGG - Intergenic
1039059721 8:33564138-33564160 GGACAGAGAATACCAGCCCCAGG + Intronic
1039511087 8:38092444-38092466 GGCCTGAGATGACCAACCCCGGG - Intergenic
1043854070 8:85245134-85245156 TGTTAGAGAGGACCAGCTCCCGG - Intronic
1045393085 8:101734304-101734326 GGTCAGAGAAGGCCTCCCCAAGG - Intronic
1045499268 8:102732379-102732401 GGTCAGAGCTGACCAGCTCCTGG + Intergenic
1049192309 8:141295142-141295164 GGTCAGAGAGGAGCTGCCACAGG + Intronic
1049852547 8:144840813-144840835 GCTCAGAGAAGCCCACCCCAGGG + Intronic
1050222397 9:3408138-3408160 GGTCAGGGAGCAACAACCCCTGG - Intronic
1050492035 9:6198212-6198234 GGTCAGAGAAGTCCAACACCAGG - Intergenic
1051502612 9:17794402-17794424 GGACAGAGAGCACCACCTGCCGG - Intronic
1053141974 9:35688227-35688249 GGTCACAGAAGCCCAACCCCTGG + Intronic
1055637947 9:78296584-78296606 GGAGAGAGAGGACCCCCCCAAGG - Intergenic
1058756521 9:108087838-108087860 GTCCAGAGAGAACCACCACCTGG - Intergenic
1060062982 9:120477597-120477619 AGTCAGAGAGCACCACCTTCAGG + Intronic
1060742778 9:126110602-126110624 GTTCAGAGAGGAAGATCCCCAGG - Intergenic
1061884740 9:133585803-133585825 GGGCAGAGAGGGCCAACCCTGGG + Intronic
1062064969 9:134521836-134521858 GGCCAGAGACGGCAACCCCCAGG + Intergenic
1062203700 9:135322903-135322925 GGTCTGTGAGGACCACCCTTGGG + Intergenic
1185450065 X:277029-277051 GGGTGGAGAGGACCTCCCCCAGG + Intronic
1185505939 X:632235-632257 GGCCAGAGGGGAGCTCCCCCGGG - Intronic
1185596200 X:1308501-1308523 GGTGGGAGAGGGCCACCCACGGG - Intronic
1187830992 X:23380777-23380799 CCTCAGAGAGGTCCTCCCCCGGG + Intronic
1190263945 X:48816436-48816458 GCACAGAGAGGAGCACCCGCAGG - Intronic
1193387967 X:80893397-80893419 GCTCAGAGAGTCCCACGCCCAGG - Intergenic